BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2026. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Diabetes. Feb 15, 2026; 17(2): 111453
Published online Feb 15, 2026. doi: 10.4239/wjd.v17.i2.111453
Integrated hepatic transcriptome and metabolome reveal the mechanisms of Jiangtang Tiaozhi formula on improving glycolipid metabolic disorder
Jia-Xing Tian, Yan-Jiao Zhang, Kai-Le Ma, Institute of Metabolic Diseases, Guang’anmen Hospital, China Academy of Chinese Medical Sciences, Beijing 100053, China
Yu-Xin Zhang, Department of Acupuncture and Moxibustion, Beijing Hospital of Traditional Chinese Medicine, Capital Medical University, Beijing Key Laboratory of Acupuncture Neuromodulation, Beijing 100010, China
Jia-Hua Wei, Hui-Fang Guan, Graduate College, Changchun University of Chinese Medicine, Changchun 130117, Jilin Province, China
Xin-Yi Fang, Hao-Ran Wu, Graduate College, Beijing University of Chinese Medicine, Beijing 100029, China
Run-Yu Miao, Department of Integrative Medicine, China-Japan Friendship Hospital, Beijing 100029, China
Xin-Miao Wang, Department of Oncology, Guang’anmen Hospital, China Academy of Chinese Medical Sciences, Beijing 100053, China
ORCID number: Jia-Xing Tian (0000-0002-1473-8474); Yan-Jiao Zhang (0000-0002-6453-8948); Yu-Xin Zhang (0000-0003-0631-8688); Xin-Yi Fang (0000-0002-7794-9068); Run-Yu Miao (0000-0001-9954-7150); Hui-Fang Guan (0000-0003-1677-6949); Hao-Ran Wu (0000-0003-2906-510X).
Co-first authors: Jia-Xing Tian and Yan-Jiao Zhang.
Co-corresponding authors: Xin-Miao Wang and Hao-Ran Wu.
Author contributions: Tian JX and Zhang YJ contributed to conceptualization; Wang XM and Wu HR contributed to methodology; Fang XY contributed to software; Zhang YX contributed to validation and formal analysis; Ma KL contributed to investigation; Zhang YJ contributed to resources, data curation and writing original draft preparation; Tian JX contributed to writing review and editing, project administration, funding acquisition; Wei JH contributed to visualization; Miao RY and Guan HF contributed to supervision; all authors have read and agreed to the published version of the manuscript.
Supported by the National Natural Science Foundation of China, No. 82474323; CACMS Outstanding Young Scientific and Technological Talents Program, No. ZZ13-YQ-026; High Level Chinese Medical Hospital Promotion Project, No. HLCMHPP20230CZ40907; Open Project of National Facility for Translational Medicine, No. TMSK-2021-407; and Qiushi Project of the China Association of Chinese Medicine, No. 2024-QNQS-12.
Institutional review board statement: This study does not involve any human experiments.
Institutional animal care and use committee statement: The animal study protocol was approved by the Ethics Committee of Guang’anmen Hospital, China Academy of Chinese Medical Sciences (No. IACUC-GAMH-2019–002).
Conflict-of-interest statement: The authors declare that they have no conflict of interest.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: The datasets presented in this study can be found in online repositories. The names of the repository and accession number(s) can be found below: The transcriptomics data have been deposited to the PRJNA1119699 dataset (https://www.ncbi.nlm.nih.gov/sra/PRJNA1119699). Metabolomics data have been deposited to the EMBL-EBI MetaboLights database with the identifier MTBLS10385 (https://www.ebi.ac.uk/metabolights/MTBLS10385).
Corresponding author: Hao-Ran Wu, MD, Doctor, Graduate College, Beijing University of Chinese Medicine, No. 11 Beisanhuandong Road, Chaoyang Street, Beijing 100029, China. dr-whr@foxmail.com
Received: June 30, 2025
Revised: September 1, 2025
Accepted: December 8, 2025
Published online: February 15, 2026
Processing time: 221 Days and 21 Hours

Abstract
BACKGROUND

Glycolipid metabolic disorder includes a series of chronic diseases that are closely associated with disturbances in both glucose and lipid metabolism. Jiangtang Tiaozhi formula (JTTZF) demonstrating significant hypoglycemic, lipid-modifying, and anti-inflammatory effects. However, the specific molecular mechanisms underlying JTTZF’s hepatoprotective effects and its ability to ameliorate glycolipid metabolic disorder remain largely unexplored.

AIM

To investigate how JTTZF improves glycolipid metabolic disorder using hepatic transcriptome and metabolome analyses.

METHODS

To induce glycolipid metabolic disorder, male C57BL/6J mice were fed a high-fat diet (HFD) for 12 weeks, after which they received an 8-week administration of JTTZF. Liver tissues were analyzed using transcriptomics and metabolomics. Real-time quantitative polymerase chain reaction validated key gene expression.

RESULTS

Metabolomics data revealed that JTTZF significantly regulated HFD-induced alterations in glycolipid metabolism, with notable changes in pathways such as the pentose phosphate pathway, steroid hormone biosynthesis, and purine metabolism. Transcriptomics profiles indicated that JTTZF exerted regulatory effects on lipid and glucose metabolism, primarily through pathways including peroxisome proliferators-activated receptor signaling, drug metabolism other enzymes, and regulation of lipolysis in adipocytes. Real-time quantitative polymerase chain reaction confirmed that JTTZF modulated pivotal genes associated with fatty acid synthesis, lipolysis, insulin resistance, energy metabolism, and inflammation. These findings suggest that JTTZF may act through multiple pathways to improve glycolipid metabolic disorder.

CONCLUSION

JTTZF can ameliorate the glycolipid metabolic disorder induced by HFD-diet by regulating lipid metabolism and improving insulin tolerance.

Key Words: Glycolipid metabolic disorder; Hepatic transcriptome; Hepatic metabolome; Jiangtang Tiaozhi formula; Multi-omics

Core Tip: This study explores the effects of Jiangtang Tiaozhi formula (JTTZF) on glycolipid metabolic disorder in high-fat diet-induced mice. By integrating hepatic transcriptome and metabolome analyses, we find that JTTZF regulates key genes and metabolites linked to glucose and lipid metabolism. Our results highlight the potential of JTTZF as a therapeutic agent for glycolipid metabolic disorder and provide valuable insights into its underlying mechanisms.



INTRODUCTION

Glycolipid metabolic disorder is caused by a variety of risk factors, including genetic, molecular, psychological, and environmental factors[1]. Glycolipid metabolic disorder, encompassing conditions like non-alcoholic fatty liver disease, type 2 diabetes mellitus (T2DM), and obesity, represent a major global public health challenge driven by lifestyle factors and unhealthy eating and living habits[2,3]. These disorders arise from dysregulated glucose and lipid metabolism, underpinned by core pathologies including insulin resistance, oxidative stress, inflammation, and gut microbiota dysbiosis, which depends on the high cooperation of various organs and tissues[1]. The liver plays a crucial role in regulating systemic glucose and lipid concentration. It is an intermediate organ between endogenous and exogenous energy supply to extrahepatic organs and serves as the major metabolic control hub for the synthesis and metabolism of glucose, lipids, carbohydrates, and proteins[4]. Consequently, understanding the precise molecular mechanisms governing hepatic glycolipid metabolism is critical, yet remains incompletely elucidated. The challenging task of researching and developing effective therapies and drugs to improve glycolipid metabolic disorder is still ongoing.

Traditional Chinese medicines are characterized by multi-components, multi-pathways, and multi-targets. Substantial preclinical and clinical evidence supports the efficacy of various traditional Chinese medicines modalities (monomers, compounds, decoctions) in managing glycolipid metabolic disorder with favorable safety profiles[5-7]. Jiangtang Tiaozhi formula (JTTZF), derived from Dahuang Huanglian Xiexin decoction, is composed of Coptis chinensis, Rhizoma anemarrhenae, Monascus, Aloe, Salvia miltiorrhiza, Schisandrae chinensis fructus, Momordica charantia, and Zingiberis rhizoma[8]. It is a clinically established formulation for treating T2DM and dyslipidemia, demonstrating significant hypoglycemic, lipid-lowering, and anti-inflammatory effects[8,9]. Modern pharmacological studies show that the prescription exerts its effects through multiple components, targets, and pathways, which makes JTTZF a promising candidate for treating the complex network dysregulation of glycolipid metabolic disorder, potentially outperforming single-target therapies. However, despite its clinical utility, the specific molecular mechanisms underlying JTTZF’s hepatoprotective effects and its ability to ameliorate glycolipid metabolic disorder in vivo, particularly at a systems level, remain largely unexplored. A critical gap exists in the comprehensive understanding of how JTTZF modulates hepatic gene expression and metabolic pathways.

Current research lacks a comprehensive analysis of the hepatic transcriptomic and metabolomic changes induced by JTTZF in high-fat diet (HFD)-induced models. This deficiency restricts our comprehension of the molecular pathways through which JTTZF ameliorates glycolipid metabolic disorder. Transcriptomics and metabolomics analyses are powerful high-throughput technologies that are increasingly used to identify key genes and metabolites from large-scale interaction networks of multisystem diseases, which provides a new method and insight for traditional Chinese medicines research[10,11]. In this research, we combined transcriptomic and metabolomic approaches to identify key genes, metabolites, and pathways altered after JTTZF treatment and investigated the detailed mechanism of JTTZF in ameliorating glycolipid metabolic disorder. Our research is designed to elucidate the detailed mechanisms underlying JTTZF’s effects on glycolipid metabolism and to offer convincing evidence of its therapeutic potential.

MATERIALS AND METHODS
Animals and drugs

Male C57BL/6J mice (7 weeks old, specific pathogen-free) were obtained from the Beijing Vital River Laboratory Animal Technology Company (Beijing, China). These mice were raised in a specific pathogen free laboratory animal facility at the Guang’anmen Hospital, China Academy of Chinese Medical Sciences (Beijing, China), where the room temperature was maintained at 22 ± 2 °C and humidity at 55% ± 5%, with a 12-hour light/12-hour dark cycle. The JTTZF formula granules utilized in the experiment were supplied by Tianjiang Pharmaceutical Co., Ltd. (Jiangsu Province, China).

HFD-induced model and drugs administration

Randomly divided the mice into three groups (n = 8): Control group, model group, and JTTZF group. The control group received a standard rodent diet, while the model and JTTZF groups were given a HFD containing 60 kcal% from fat (D12492; Research Diets, New Brunswick, New Jersey, United States) for 6 weeks to form an HFD-induced model (weight gain ≥ 30%, fasting blood glucose ≥ 7.0 mmoL/L). Mice in the JTTZF group were administered with JTTZF, and those in the control and model groups were administered with normal saline. Based on a human dose of 84 g/day (for an average body weight of 70 kg), and a reference equivalent dose for mice that is 9.1 times higher. Thus, the calculated equivalent dose for mice is 10.92 g/kg. All groups were administered orally once daily for 8 weeks at a dose of 10 mL/kg.

Index detection

Fasting blood glucose and body weight were measured at fixed time points each week. oral glucose tolerance test (OGTT) was conducted on the first day after 8 weeks of administration. Mice were fasted overnight (12 hours) with free access to water and then given 2 g/kg glucose intragastrically. Whole blood was collected from the tail vein at 0, 15, 30, 60, and 120 minutes, blood glucose levels were measured using a Roche Accu Chek blood glucose meter, and area under the curve was calculated. triglyceride (TG) and total cholesterol (TC) were detected by the selective inhibition method on an automated biochemistry analyzer (Olympus AU480; Olympus Corporation, Tokyo, Japan).

Sample collection

After 8 weeks of continuous administration, blood samples were collected from the retro-orbital venous plexus of mice following a 12-hour fast. The serum sample was centrifuged at 1000 g for 20 minutes at 4 °C and then stored at -80 °C. The mice were cervically dislocated under pentobarbital sodium anesthesia, and liver tissue samples were immediately stored at -80 °C for further analysis.

Transcriptomics analysis

Liver tissue RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, United States) following the manufacturer’s protocol. RNA quantity and integrity were evaluated with the RNA Nano 6000 assay kit on the Bioanalyzer 2100 system (Agilent Technologies, CA, United States). A complementary DNA library was constructed and sequenced on the Illumina Novaseq platform, generating an end reading of 150 bp pairing. The raw data were converted to FASTQ format and processed with FASTP software. Adapters, N-bases, and low-quality reads were removed to obtain clean reads. Hisat2 (v2.0.5) was used to index the reference genome and align paired-end clean reads to it[12]. Gene read counts were obtained using feature counts (v1.5.0-p3), and fragments per kilobase per million (FPKM) values were calculated based on gene length[13,14]. Differential expression analysis was conducted using the DESeq2 R package (1.20.0), with P values adjusted using the Benjamini and Hochberg method to control the false discovery rate (FDR). Genes with P < 0.05, |fold change (FC)| > 1.5, and FPKM > 1 were identified as differentially expressed genes (DEGs)[15,16]. Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses of DEGs were performed using the clusterProfiler R package (3.8.1)[17,18].

Metabolomics analysis

Injecting liver extract into liquid chromatograph mass spectrometer/mass spectrometer system (ThermoFisher, Germany) for analysis[19]. The raw data were processed using compound discoverer 3.1 (ThermoFisher). Metabolites were annotated using the KEGG database (https://www.genome.jp/kegg/pathway.html). In the multivariate statistical analysis, partial least squares discriminant analysis (PLS-DA) and principal components analysis (PCA) were conducted to visualize the metabolic difference after log transformation (log 10) in metaX[20]. The statistical significance of differences in metabolite levels between groups was assessed using the t test. P values obtained were adjusted for multiple comparisons using the Benjamini and Hochberg method to control the FDR. FC values were calculated to quantify relative differences in metabolite levels. Metabolites with P value < 0.05, variable important in projection (VIP) > 1, and FC > 1.5 or FC < 0.667 were considered as differentially expressed metabolites (DEMs)[21]. Hierarchical clustering analysis of DEMs was performed using R (heatmap package) to analyze metabolite expression patterns across samples. Volcano plots were utilized to filter metabolites of interest through R (ggplot2 package). Metabolic pathway enrichment analysis of DEMs was conducted using MetaboAnalyst (v 5.0) with a P value < 0.05 from the hypergeometric test.

Quantitative polymerase chain reaction assay

The messenger RNA (mRNA) expression of genes related to glycolipid metabolic disorder was assessed via real-time polymerase chain reaction (PCR). Total hepatic RNA was isolated from samples using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, United States). Reverse transcription of total RNA was performed using a SweScript All-in-One RT SuperMix for quantitative PCR (Servicebio, Wuhan, Hubei Province, China). The target gene was measured using SYBR Green quantitative PCR master mix on BioRad Laboratories CFX ConnectTM real-time PCR detection system. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal reference gene, the expression was calculated using 2-△△ct. The PCR protocol included initial activation at 95 °C for 30 seconds, followed by 40 cycles of denaturation at 95 °C for 15 seconds, and annealing and extension at 60 °C for 30 seconds. Fluorescence signals were collected once every 0.5 °C increase in temperature from 65 °C to 95 °C[22]. Primer sequences are detailed in Table 1.

Table 1 Forward and reverse primer sequences for real-time polymerase chain reaction.
Gene name
Forward
Reverse
Cry1TACTGAGGCTGGCGTGGAAAGTGGCTCCATCTTGCTGACG
Ces2aCTAAATCTGGTGTCCATGCCTTCATTCATTTCCTTCGCATCCTCT
Ces1dCATTGCTGGTCTGGTTGCTACTTGCTTGTTGATGCCCACTATGT
GpnmbGCCAAGCGATTTCGTGATGTAGTCCTTCCACCTGCCGTCT
CideaGTCCTACTGACCCCCCTCATATCCTCCAGCACCAGCGTAA
Gprc5bTGGCAAGTTCAAACGGTGGTGGGAGAAGGGTGTAGTGGAT
Fabp4GTGATGCCTTTGTGGGAACCCCAGTTTGAAGGAAATCTCGGT
Fabp3GACCAAGCCTACTACCATCATCGTGAGTTTGCCTCCGTCCAGC
Cry1TACTGAGGCTGGCGTGGAAAGTGGCTCCATCTTGCTGACG
Statistical analysis

Data analysis was conducted using GraphPad Prism 9.5.0 (GraphPad, La Jolla, CA, United States), and results are presented as mean ± SE. Multiple comparisons were analyzed by one-way analysis of variance and the Kruskal-Wallis test. Differences were considered statistically significant at the level of aP < 0.05, bP < 0.01, cP < 0.001.

RESULTS
Effects of JTTZF on metabolic parameters in HFD-induced glycolipid metabolic disorder mice

As shown in Figure 1, HFD-induced glycolipid metabolic disorder was observed in the model group. After 8 weeks treatment with JTTZF, a notable reduction in blood glucose was observed (Figure 1A, P < 0.001). The OGTT results indicated that, after 60 minutes, the blood glucose level in the JTTZF group was significantly lower compared with the control group (Figure 1B). Compared with the control group, the model group had a higher body weight gain (Figure 1C, P < 0.0001). Although JTTZF treatment appeared to reduce weight gain, this effect did not reach statistical significance compared with the model group. However, the trend may still be biologically meaningful, it could suggest a longer term effect not captured within the study period. The serum TG and TC levels were significantly elevated in HFD-induced mice (Figure 1D and E, P < 0.01). JTTZF treatment led to a marked reduction in serum TG levels. While JTTZF also appeared to decrease TC levels, this change was not statistically significant compared with the model group (Figure 1F, P < 0.001). Moreover, JTTZF significantly reduced fasting glucose levels and the area under the curve of the OGTT compared with the model group (Figure 1G, P < 0.01). In summary, JTTZF can reduce body weight, blood lipids, and blood glucose in HFD-induced mice, and ameliorate the glycolipid metabolic disorder.

Figure 1
Figure 1 Jiangtang Tiaozhi formula attenuated glycolipid metabolic disorder in vivo. A: Fasting glucose of mice during treatment (n = 8); B: Oral glucose tolerance test (OGTT) (n = 8); C: Body weight (n = 8); D: Triglyceride (n = 8); E: Total cholesterol (n = 8); F: Fasting glucose of mice after 8 weeks of treatment (n = 8); G: Area under the curve of OGTT (n = 8). aP < 0.05. bP < 0.01. cP < 0.001. NS: Not significant; JTTZF: Jiangtang Tiaozhi formula; OGTT: Oral glucose tolerance test; TG: Triglyceride; TC: Total cholesterol; AUC: Area under the curve.
Effects of JTTZF supplementation on hepatic transcriptome

Figure 2 illustrates the gene transcript expression levels of the control, model and JTTZF groups as determined by RNA sequencing. The PCA score plot (Figure 2A) indicates a distinct separation among the three groups. The JTTZF group exhibits a tendency to return to the control group, indicating that JTTZF supplementation significantly alters the liver transcriptome of mice with glycolipid metabolic disorder. Compared with the control group, there are 1220 DEGs in the model group, including 607 up-regulated and 613 down-regulated genes. In contrast to the model group, the JTTZF have 1206 DEGs, including 990 up-regulated and 216 down-regulated genes (Figure 2B and C). The heat map shows expression of representative DEGs (Figure 2D). Relative to the control group, 215 genes were down-regulated in the model group but up-regulated in the JTTZF group. These genes are primarily clustered in pathways such as mainly clustered in linoleic acid metabolism, biosynthesis of unsaturated fatty acids, inflammatory mediator regulation of transient receptor potential channels (Figure 2E). 90 genes were up-regulated in the model group but down-regulated in the JTTZF group. These genes were enriched in the in pathways such as ErbB signaling pathway, peroxisome proliferators-activated receptor signaling pathway, Regulation of lipolysis in adipocytes, interleukin-17 signaling pathway, Fat digestion and absorption, fructose and mannose metabolism, ferroptosis (Figure 2F). The specific information of these potential genes are summarized in Table 2. To identify the transcriptional profile results, we measured the mRNA levels of 8 potential genes by real-time PCR, the results showed a high consistency with the transcriptome data (Figure 3). The results of our transcriptome analysis reveal significant changes in gene expression patterns in the liver of glycolipid metabolic disorder mice treated with JTTZF. The PCA analysis confirmed distinct separation among the control, model, and JTTZF groups, indicating that JTTZF treatment has a profound effect on the liver transcriptome. The volcano plots and heat map further illustrate the differential expression of genes, with JTTZF reversing many of the changes observed in the model group. This suggests that JTTZF may act by modulating specific pathways involved in glycolipid metabolism.

Figure 2
Figure 2 Jiangtang Tiaozhi formula modulates liver transcriptome profiles. A: Principal components analysis [control vs model vs Jiangtang Tiaozhi formula (JTTZF) mice, n = 8]; B: Volcano plots (model vs control mice, n = 8); C: Volcano plots (JTTZF vs model mice, n = 8); D: Heatmap of representative differentially expressed genes (control vs model vs JTTZF mice, n = 8), with red indicating up-regulation and blue indicating down-regulation; E: Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis to annotate the biological function of differential genes(model vs control mice, n = 8); F: KEGG pathway analysis to annotate the biological function of differential genes (JTTZF vs model mice, n = 8). JTTZF: Jiangtang Tiaozhi formula; PC: Principal component.
Figure 3
Figure 3 The messenger RNA levels of potential genes by real-time polymerase chain reaction. A: Ces1d; B: Ces2a; C: Cry1; D: Cidea; E: Fabp3; F: Fabp4; G: Gprc5b; H: Gpnmb. aP < 0.05. bP < 0.01. cP < 0.001.
Table 2 The specific information of these potential genes.
No.Gene IDGene nameModel vs control
JTTZF vs model
Pathway
log2FC
Trend
log2FC
Trend
1ENSMUSG00000020038Cry1-1.65Db1.92Ub
2ENSMUSG00000055730Ces2a-3.09Db1.64UbPathway1
3ENSMUSG00000056973Ces1d-1.91Db1.91Ub
4ENSMUSG00000029816Gpnmb3.55Ub-2.79Db
5ENSMUSG00000024526Cidea4.14Ub-2.99Db
6ENSMUSG00000008734Gprc5b1.73Ub-2.15Db
7ENSMUSG00000062515Fabp41.52Ub-1.58DbPathway2,3
8ENSMUSG00000028773Fabp34.51Ub-2.90DbPathway2
Effects of JTTZF on hepatic metabolic profiles

To explore the impact of JTTZF on hepatic metabolites in mice with HFD-induced metabolic disorders, we conducted untargeted metabolomics analysis (Figure 4). The PCA model showed good differentiation between the control and model groups, indicating significant differences in metabolic liver function (Figure 4A). The model and JTTZF groups also exhibited clear differentiation, indicating changes in the amount and concentration of metabolites after drug intervention, although PCA analysis revealed slight overlap (Figure 4B). Furthermore, the control and model groups were significantly separated, with explanatory power (R2) Y = 0.99 and predictive power (Q2) Y = 0.96 (Figure 4C) in the positive ion mode and (R2) Y = 0.99 and (Q2) Y = 0.96 (Figure 4D) in the negative ion mode, respectively. Similarly, the model and JTTZF groups showed significant separation, with R2Y = 0.97 and Q2Y = 0.68 in the positive ion mode (Figure 4E), and R2Y = 0.97 and Q2Y = 0.62 in the negative ion mode (Figure 4F). These results indicated the robust predictive reliability of the orthogonal PLS-DA model. The PLS-DA model’s permutation test demonstrated stability and strong predictive power, suitable for identifying DEMs (Figure 4G-J).

Figure 4
Figure 4 Multivariate statistical analysis of liver samples among the control, model, and Jiangtang Tiaozhi formula groups. A: Principal components analysis (PCA) score plot of liver samples among control, model, and Jiangtang Tiaozhi formula (JTTZF) groups in the positive ion mode; B: PCA score plot of liver samples among control, model, and JTTZF groups in the negative ion mode; C: Scores plots of partial least squares discriminant analysis (PLS-DA) between control and model groups in the positive ion mode; D: Scores plots of PLS-DA between control and model groups in the negative ion mode; E: Scores plots of PLS-DA between and between model and JTTZF groups in the positive ion mode; F: Scores plots of PLS-DA between model and JTTZF groups in the negative ion mode; G: Permutation tests of PLD-DA models between control and model groups in the positive ion mode; H: Permutation tests of PLD-DA models between control and model groups in the negative ion mode; I: Permutation tests of PLD-DA models between model and JTTZF groups in the positive ion mode; J: Permutation tests of PLD-DA models between model and JTTZF groups in the negative ion mode. PC: Principal component; J: Jiangtang Tiaozhi formula group; Mo: Model group; C: Control group; Cor: Correlation.

DEMs were filtered using the following criteria: (1) VIP > 1.0; (2) P < 0.05; and (3) FC > 1.5 or FC < 0.667[23-25]. According to the volcano plots, in the positive ion mode, 108 metabolites were significantly up-regulated and 81 metabolites were down-regulated between control and model groups (Figure 5A and B). In the negative ion mode, 87 metabolites were increased and 88 metabolites were decreased (Figure 5C and D). These metabolites were enriched in pathways such as steroid hormone biosynthesis, tricarboxylic acid cycle (TCA cycle), pentose phosphate pathway, glycerophospholipid metabolism, glycolysis/gluconeogenesis (Figure 5E). Between the model and JTTZF groups, 53 metabolites were increased and 78 metabolites were decreased in the positive ion mode, while 62 metabolites were increased and 39 metabolites were decreased in the negative ion mode. These metabolites were enriched in TCA cycle, pentose and glucuronate interconversions, pentose phosphate pathway, arachidonic acid metabolism, fatty acid degradation (Figure 5F). The results gained under these two modes are shown in Figure 5. Compared with the control group, 41 metabolites were increased in the model group and decreased in the JTTZF group, while 34 metabolites were decreased in the model group and increased in the JTTZF group. The TCA cycle, pentose phosphate pathway, pyrimidine metabolism, steroid hormone biosynthesis, purine metabolism are common to all three groups, suggesting their involvement in glycolipid metabolic disorder. We selected 25 significantly altered endogenous metabolites associated with glycolipid metabolic disorder as potential biomarkers for liver tissue (Table 3).

Figure 5
Figure 5 Jiangtang Tiaozhi formula modulates liver metabolite profiles. A: Volcano plots under the positive ion mode (model vs control mice, n = 8); B: Volcano plots under the ion mode (model vs control mice, n = 8); C: Volcano plots under the positive ion mode [Jiangtang Tiaozhi formula (JTTZF) vs model mice, n = 8]; D: Volcano plots under the negative ion mode (JTTZF vs model mice, n = 8); E: Overview of metabolic pathway analysis of liver metabolism (model vs control mice, n = 8); F: Overview of metabolic pathway analysis of liver metabolism (JTTZF vs model mice, n = 8). J: Jiangtang Tiaozhi formula group; Mo: Model group; C: Control group; VIP: Variable important in projection; TCA: Tricarboxylic acid cycle.
Table 3 The endogenous metabolites associated with glycolipid metabolic disorder.
No.FormulaRT (minute)m/zMetabolitesIon modeModel vs control
JTTZF vs model
VIP
FC
Trend
VIP
FC
Trend
1C23H45NO47.12400.34 PalmitoylcarnitineESI +2.476.69Ub2.450.26Da
2C23H44NO46.80398.33 ACar 16:1ESI +1.884.10Ub2.420.27Da
3C25H48NO47.25426.36 ACar 18:1ESI +2.266.38Ub2.110.28Da
4C21H42NO46.67372.31 ACar 14:0ESI +1.212.22Ub2.540.34Da
5C28H54NO47.89468.40 ACar 21:1ESI +2.3411.32Ub1.550.27Da
6C10H14N5O7P1.60348.07 Adenosine 5’-monophosphateESI +1.020.41Db1.220.45Da
7C26H48NO7P8.34562.32 LPC 18:3ESI -1.680.44Db1.681.82Ua
8C26H50NO8P7.06536.33 PC (5:0/13:1)ESI +2.540.38Db1.891.74Ua
9C23H40NO7P7.90472.25 LPE 18:4ESI -2.250.21Db1.532.25Ua
10C25H44NO46.72422.33 ACar 18:3ESI +1.232.69Ub2.460.32Da
11C23H42NO7P8.32474.26 LPE 18:3ESI -1.550.37Db1.311.89Ua
12C26H52NO47.78442.39 ACar 19:0ESI +2.063.17Ub2.180.38Da
13C26H52NO8P8.43538.35 PC (9:0/9:0)ESI +1.041.50Ua2.190.55Da
14C25H46NO46.95424.34 ACar 18:2ESI +1.342.19Ub2.380.41Da
15C22H44NO7P7.72466.29 LPC 14:1ESI +1.840.46Db1.641.66Ua
16C10H15N5O10P21.47428.04 Adenosine diphosphateESI +1.280.33Ub1.200.36Da
17C9H9NO35.35132.04 Hippuric acidESI -1.420.42Db1.632.09Ua
18C28H50NO8P7.62560.34 PC (4:0/16:3)ESI +1.130.67Da2.272.03Ua
19C29H46NO46.93472.34 ACar 22:6ESI +1.963.10Ub2.000.52Db
20C5H10O51.41149.05 D-RiboseESI -1.601.87Ub1.860.61Db
21C4H8O32.79105.06 2-hydroxybutyric acidESI +1.151.69Ub2.070.62Db
22C21H30O29.29315.23 ProgesteroneESI +1.022.15Ub2.020.60Db
23C23H44NO7P7.40478.29 LysoPE 18:2ESI +1.090.65Da1.451.52Ub
24C24H45O9P8.26507.27 LPG 18:2ESI +1.011.82Ua1.160.60Db
25C26H46NO7P7.72516.31 LPC 18:4ESI +1.990.10Db1.072.44Ub
Integrated enrichment analysis of transcriptome and metabolite profiles

To understand the changes occurring in the liver, the potential relationships between genes and metabolites were further analyzed. To systematically evaluate the metabolic disturbances and potential regulatory factors of JTTZF in ameliorating the HFD-induced glycolipid metabolic disorder, we jointly analyzed the DEGs in transcriptomics and the characteristic metabolic pathways in metabolomics. The DEGs and DEMs were simultaneously mapped to the KEGG pathway database to identify the common pathways. Through mapping the metabolic enzyme-related genes of metabolic pathways enriched in the metabolomics, we speculated that JTTZF may alleviate glycolipid metabolic disorder by regulating the pathways related to energy production, lipid metabolism, and glucose metabolism (Figure 6).

Figure 6
Figure 6 Integrated transcriptomics and metabolomics analyses of Jiangtang Tiaozhi formula on improving glycolipid metabolic disorder.
DISCUSSION

Glycolipid metabolic disorder is a complex chronic metabolic disease, and our previous study reported that JTTZF showed therapeutic effects for patients. Moreover, JTTZF can effectively and safely reduce blood glucose and lipids in glycolipid metabolic disorder patients. It also enhances insulin sensitivity, reduces chronic inflammation, and modifies the gut microbiota structure. Currently, identifying potential intervention targets for JTTZF to improve glycolipid metabolic disorder is an important goal. However, the characteristics of metabolites in glycolipid metabolic disorder have not been fully demonstrated and there is a lack of integrated transcriptome metabolome analysis of liver in HFD-induced glycolipid metabolic disorder mice. In this study, transcriptomics and the metabolomics of HFD-induced glycolipid metabolic disorder mice were performed. Integrated transcriptome metabolome analysis revealed the mechanism of JTTZF amelioration of the glycolipid metabolic disorder from the perspective of regulation of metabolites accumulation and expression of genes.

Transcriptome analysis showed that JTTZF ameliorated the HFD-induced glycolipid metabolic disorder induced in several ways. Specifically, JTTZF regulated key genes associated with lipid metabolism. Compared with the control group, Cry1, Ces2a, and Ces1d were down-regulated, while Gpnmb, Cidea, Gprc5b, Fabp4, and Fabp3 were up-regulated in the model group. After JTTZF intervention, the expression levels of these genes were restored to levels comparable to those in the control group. Cry1 is related to the lipids utilization and the foemation of lipid droplets. Knocking down Cry1 inhibits the expression of adipogenic markers and reduces lipid droplet formation in cells under adipogenic induction[26,27]. High-fat feeding accelerates the degradation of autophagic Cry1, leading to obesity-related hyperglycemia[28]. Additionally, down-regulation of hepatic Cry1 is linked to heightened hepatic glucose production through the mediation of FOXO1 degradation[29-31]. Carboxylesterases, including mouse Ces2a and Ces1d, are important hydrolytic enzymes involved in lipid metabolism. Ces2a, a highly efficient diglyceride and monoglycerides hydrolase, is vital for energy and lipid metabolism[32-34]. Ces2a knockout mice exhibit increased body and liver weight, insulin resistance, and liver steatosis due to impaired diacylglycerol and lysophosphatidylcholine (LPC) catabolism[35,36]. Ces1d, a major hepatic cholesteryl ester hydrolase, is notably elevated in obese patients with T2DM. Ces1d knockout mice show increased fat mass and abnormal lipid droplet deposition in adipocytes, leading to ectopic TG accumulation in other tissues[37,38]. Cell death-inducing DNA fragmentation factor-like Cidea, highly expressed in thermogenic adipose tissues like brown and beige, regulates the britening/beiging of human adipocytes, thereby regulating energy expenditure[39,40]. HFD significantly increase the levels of Cidea mRNA in the liver and adipose tissue[41]. Knocking down Cidea in the liver of ob/ob mice markedly reduced small lipid droplets and hepatic lipid accumulation[42].

JTTZF also appears to modulate inflammation, a crucial factor in metabolic disorders. Gpnmb is associated with inflammation and serves as a crucial factor in combating obesity-related metabolic disorders by diminishing the inflammatory activity of macrophages[43]. Gpnmb secreted by the liver promoted lipogenesis in white adipose tissue and exacerbated insulin resistance and obesity. Inhibiting or specifically knocking down Gpnmb in the liver increases insulin sensitivity and reduces weight gain[44]. Gprc5b is highly expressed in both mice and human pancreatic islets. It is up-regulated 2.5-fold in islets with T2DM[45]. Gprc5b-deficient mice are protected against diet-induced insulin resistance and obesity by reducing inflammation in white adipose tissue and cytokine-induced apoptosis[45,46]. Fabp family genes encode proteins involved in the transport of long-chain fatty acids. These proteins also play a role in regulating phospholipid synthesis, lipid metabolism, and mitochondrial β-oxidation. The expression levels of Fabp3/Fabp4/Fabp5 increased during the differentiation of preadipocyte[47-49]. Elevated expression of these genes has been observed in obese mice and patients with T2DM[50-55]. Targeted silencing of Fabp4 and Fabp5 in white adipocytes can combat obesity and inflammation and reverse insulin resistance[56].

Metabolomic results showed that JTTZF regulates several metabolites involved in energy metabolism, such as acylcarnitines, LPC, lysophosphatidyl ethanolamine (LPE) and others. These metabolites are critical for energy storage, cell membrane integrity, and signal transduction. Lipids are among the most crucial biomolecules involved in energy storage, cell membranes, signal transduction, and so on[57]. Lipids mainly include lysophosphatidylserine, phosphatidyl inositol, phosphatidyl ethanolamine (PE), phosphatidylcholine (PC), phosphatidic acid, sphingomyelin. PC and PE can be hydrolyzed into LPC and LPE, respectively. These lysophospholipids are closely associated with diabetes-related oxidative stress and inflammation[58]. LPE 18:2 inhibits fatty acid biosynthesis and lipolysis, contributing to lipid droplet formation[59]. HFD upregulate exosomal PC, which exacerbates insulin resistance[60]. LPC is closely related to diabetes-related indicators such as glycosylated hemoglobin, high-density lipoprotein cholesterol, TG, and alanine aminotransferase[61]. In our study, the model group showed significant decreases in several lipids, including LPC 18:3, LPC 18:4, LPE 18:4, LPE 18:3, PC (5:0/13:1), PC (9:0/9:0), LPC 14:1, PC (4:0/16:3), and lysophosphatidylethanolamine 18:2. JTTZF treatment restored these lipid levels, which is associated with the improvement glycolipid metabolic disorder. Acylcarnitines, intermediates of fatty acid metabolism, are early biomarkers of insulin resistance in diabetes in animal studies and a population-based study[62-65]. They are important energy source for β cells, but their accumulation impairs insulin synthesis, energy metabolism, and the TCA cycle, leading to β-cell dysfunction[66]. Acylcarnitines were significantly increased in the model group, JTTZF can improve glycolipid metabolic disorder by decreasing them. Researches have indicated that palmitoyl carnitine was positively correlated with the risk of T2DM. It has been identified as a novel metabolic marker for incident T2DM in two prospective case-control studies involving Chinese adults[67,68]. It can induce significant insulin insensitivity, decrease muscles glucose uptake, and increase blood glucose levels Carnitine palmitoyl transferase 2 knockout in C2C12 cells exacerbated insulin resistance. Adenosine diphosphate (ADP) and Adenosine 5’-monophosphate (AMP) are important participants in energy metabolism processes, the mutual conversion between ATP and ADP is accompanied by the release and storage of energy, related to glycolysis and/or oxidative metabolism[69]. AMP can effectively improve high-density lipoprotein cholesterol, plasma TGs, hepatic lipids, and glucose levels[70,71]. An elevated ADP/ATP ratio activates adenosine 5’-monophosphate-activated protein kinase, which in turn inhibits fat synthesis and promotes fat degradation[69]. This mechanism is implicated in metabolic disorders such as diabetes and obesity. JTTZF improved glucose metabolism in HFD-induced glycolipid metabolic disorder by regulating ADP and AMP via the TCA cycle. The TCA cycle is the hub of amino acid, lipid, and carbohydrate metabolism, serving as a major energy source and pathway for glucose degradation. Hippuric acid levels are decreased in HFD-induced mice, impaired glucose tolerance, and obese patients[72,73]. Increased hippuric acid is linked to improved insulin secretion and fasting glucose levels in high-risk T2DM populations[74]. In our study, hippuric acid was significantly decreased in the model group. JTTZF increased its levels via phenylalanine metabolism, improving glycolipid metabolic disorder. D-ribose plays an important role in T2DM, it reacts with hemoglobin to produce hemoglobin A1c[75]. It is significantly increased in Zucker diabetic fatty rats and diabetic patients, which is consistent with our research findings[76]. 2-hydroxybutyric acid has been demonstrated as a clinical monitoring molecule and functioned as an insulin resistance biomarker, utilized for tracking disease progression during insulin resistance treatment[77]. It is significantly higher in T2DM mice and women with gestational diabetes mellitus, and a significant decrease of 2-hydroxybutyric acid was observed after six months in patients who underwent gastric bypass surgery, which is associated with improved insulin resistance[78,79]. In our study, JTTZF ameliorated glycolipid metabolic disorder by propanoate metabolism. Progesterone, a neurosteroid, plays a role in energy metabolism. Studies found a positive correlation between progesterone and T2DM, it was increased in db/db mice, and low levels of progesterone can reduce the incidence of T2DM[80-82]. Progesterone can lead to apoptosis of rat pancreatic islet primary β-cells and enhance the activity of the rate-limiting enzyme glucokinase to increase glucose metabolism in MIN6 beta-cells[83,84]. It also increased blood glucose via gluconeogenesis when insulin action is limited or impaired[85]. Progesterone receptor-knockout mice showed improved glucose tolerance[86]. In our study, progesterone levels were increased in the model group, JTTZF increased its level by ameliorating glycolipid metabolic disorder via steroid hormone biosynthesis.

In conclusion, the conjoint analysis of transcriptome and metabolome showed that JTTZF could regulate glycolipid metabolic disorder through multiple metabolic pathways. These findings lay the groundwork for future research into JTTZF’s role in precision medicine approaches for metabolic disorders, which suggest that JTTZF has the potential to be developed as a therapeutic strategy for metabolic disorders. Given the increasing prevalence of metabolic disorders, JTTZF could offer a promising alternative or complementary therapy to existing treatments with its ability to modulate key metabolic pathways, could offer a promising alternative or complementary therapy to existing treatments. Future clinical trials should explore the safety and efficacy of JTTZF in human with metabolic disorders, particularly those who are unresponsive to conventional therapies. Long-term studies in human clinical trials are needed to evaluate the sustained effects of JTTZF on glycolipid metabolism and to determine the optimal dosing regimen. Furthermore, integrating JTTZF into multimodal treatment strategies, such as combining it with lifestyle modifications or other pharmacological agents, could be a promising approach to enhance therapeutic outcomes. While our study offers valuable insights into the mechanisms underlying JTTZF’s effects, several limitations of the current study should be acknowledged. Firstly, our study relied on an animal model of glycolipid metabolic disorder induced by a HFD. While animal models are valuable for initial mechanistic studies, they may not fully replicate the complexity and variability of human metabolic disorders. The short treatment duration is another limitation, as it does not allow us to assess the long-term effects of JTTZF on glycolipid metabolism. Additionally, it is important to note that multi-omics approaches are primarily correlational, we did not determine whether the beneficial effects of JTTZF on HFD mice depended on changes in liver metabolites. Establishing causality will require further validation through targeted studies, such as gene knockout or metabolite-targeting experiments. Therefore, the potential mechanism and causality between the anti-glycolipid metabolic disorder effects of JTTZF and changes in genes and metabolites of the liver deserve further investigation. Additionally, future research should explore the underlying mechanisms of JTTZF’s effects in more detail, including its impact on other organs and systems involved in metabolic regulation.

CONCLUSION

In conclusion, JTTZF can ameliorate the glycolipid metabolic disorder induced by HFD-diet by regulating lipid metabolism and improving insulin tolerance. We found that JTTZF can restore 8 genes abnormally expressed in the pathway associated with the glucose and lipid metabolism disorder and 25 DEMs involved in glucose, fatty acid and amino acid metabolism. These genes and metabolites may provide valuable insights into the molecular mechanisms underlying JTTZF’s effects, but its complex mechanisms require further research and validation. Importantly, these findings lay a solid foundation for future investigations into JTTZF’s potential role in precision medicine approaches for metabolic disorders. By elucidating the intricate interplay between gene expression and metabolite regulation, our study offers insights that could inform the design of future omics-based personalized therapies, ultimately contributing to more effective and tailored treatment strategies for patients with metabolic disorders.

ACKNOWLEDGEMENTS

We would like to thank all the authors for their contribution to the realization of this manuscript.

References
1.  Fang X, Miao R, Wei J, Wu H, Tian J. Advances in multi-omics study of biomarkers of glycolipid metabolism disorder. Comput Struct Biotechnol J. 2022;20:5935-5951.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 95]  [Cited by in RCA: 86]  [Article Influence: 21.5]  [Reference Citation Analysis (0)]
2.  Fan L, Lai R, Ma N, Dong Y, Li Y, Wu Q, Qiao J, Lu H, Gong L, Tao Z, Chen J, Xie Q, Ren J. miR-552-3p modulates transcriptional activities of FXR and LXR to ameliorate hepatic glycolipid metabolism disorder. J Hepatol. 2021;74:8-19.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 60]  [Cited by in RCA: 52]  [Article Influence: 10.4]  [Reference Citation Analysis (0)]
3.  Cai Z, Deng X, Zhao L, Wang X, Yang L, Yuan G. The relationship between Schistosoma and glycolipid metabolism. Microb Pathog. 2021;159:105120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 4]  [Article Influence: 0.8]  [Reference Citation Analysis (0)]
4.  Bechmann LP, Hannivoort RA, Gerken G, Hotamisligil GS, Trauner M, Canbay A. The interaction of hepatic lipid and glucose metabolism in liver diseases. J Hepatol. 2012;56:952-964.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 825]  [Cited by in RCA: 743]  [Article Influence: 53.1]  [Reference Citation Analysis (4)]
5.  Di S, Wang Y, Han L, Bao Q, Gao Z, Wang Q, Yang Y, Zhao L, Tong X. The Intervention Effect of Traditional Chinese Medicine on the Intestinal Flora and Its Metabolites in Glycolipid Metabolic Disorders. Evid Based Complement Alternat Med. 2019;2019:2958920.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 32]  [Cited by in RCA: 29]  [Article Influence: 4.1]  [Reference Citation Analysis (0)]
6.  Li X, Liu Z, Liao J, Chen Q, Lu X, Fan X. Network pharmacology approaches for research of Traditional Chinese Medicines. Chin J Nat Med. 2023;21:323-332.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 136]  [Cited by in RCA: 106]  [Article Influence: 35.3]  [Reference Citation Analysis (0)]
7.  Liu M, Shi W, Huang Y, Wu Y, Wu K. Intestinal flora: A new target for traditional Chinese medicine to improve lipid metabolism disorders. Front Pharmacol. 2023;14:1134430.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 9]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
8.  Wu H, Fang X, Jin D, Miao R, Wei J, Zhao T, Dai D, Liao J, Wang J, Lian F, Tian J. Efficacy and Mechanism of the Jiangtang Tiaozhi Recipe in the Management of Type 2 Diabetes and Dyslipidaemia: A Clinical Trial Protocol. Front Pharmacol. 2022;13:827697.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 1]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
9.  Bao T, Wang S, Yang Y, He L, Han L, Zhai T, Chen J, Zhou Q, Zhao X, Lian F, Zhao L, Tong X. Exploring the Regulation of Jiangtang Tiaozhi Formula on the Biological Network of Obese T2DM Complicated With Dyslipidemia Based on Clinical Transcriptomics. Front Endocrinol (Lausanne). 2022;13:817147.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 4]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
10.  He X, Liu X, Zuo F, Shi H, Jing J. Artificial intelligence-based multi-omics analysis fuels cancer precision medicine. Semin Cancer Biol. 2023;88:187-200.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 340]  [Cited by in RCA: 269]  [Article Influence: 89.7]  [Reference Citation Analysis (10)]
11.  Yan SK, Liu RH, Jin HZ, Liu XR, Ye J, Shan L, Zhang WD. "Omics" in pharmaceutical research: overview, applications, challenges, and future perspectives. Chin J Nat Med. 2015;13:3-21.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 36]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
12.  Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods. 2008;5:621-628.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11952]  [Cited by in RCA: 10023]  [Article Influence: 556.8]  [Reference Citation Analysis (3)]
13.  Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30:923-930.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25020]  [Cited by in RCA: 19534]  [Article Influence: 1627.8]  [Reference Citation Analysis (3)]
14.  Bray NL, Pimentel H, Melsted P, Pachter L. Near-optimal probabilistic RNA-seq quantification. Nat Biotechnol. 2016;34:525-527.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9534]  [Cited by in RCA: 6790]  [Article Influence: 679.0]  [Reference Citation Analysis (3)]
15.  Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 82919]  [Cited by in RCA: 67556]  [Article Influence: 5629.7]  [Reference Citation Analysis (4)]
16.  Lu Y, Shao M, Xiang H, Zheng P, Wu T, Ji G. Integrative transcriptomics and metabolomics explore the mechanism of kaempferol on improving nonalcoholic steatohepatitis. Food Funct. 2020;11:10058-10069.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 48]  [Cited by in RCA: 44]  [Article Influence: 7.3]  [Reference Citation Analysis (1)]
17.  Young MD, Wakefield MJ, Smyth GK, Oshlack A. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol. 2010;11:R14.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6084]  [Cited by in RCA: 4957]  [Article Influence: 309.8]  [Reference Citation Analysis (5)]
18.  Kanehisa M, Goto S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000;28:27-30.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 32546]  [Cited by in RCA: 27502]  [Article Influence: 1057.8]  [Reference Citation Analysis (9)]
19.  Want EJ, Masson P, Michopoulos F, Wilson ID, Theodoridis G, Plumb RS, Shockcor J, Loftus N, Holmes E, Nicholson JK. Global metabolic profiling of animal and human tissues via UPLC-MS. Nat Protoc. 2013;8:17-32.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1392]  [Cited by in RCA: 1065]  [Article Influence: 81.9]  [Reference Citation Analysis (0)]
20.  Wen B, Mei Z, Zeng C, Liu S. metaX: a flexible and comprehensive software for processing metabolomics data. BMC Bioinformatics. 2017;18:183.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 827]  [Cited by in RCA: 669]  [Article Influence: 74.3]  [Reference Citation Analysis (1)]
21.  Fu X, Liu Z, Li R, Yin J, Sun H, Zhu C, Kong Q, Mou H, Nie S. Amelioration of hydrolyzed guar gum on high-fat diet-induced obesity: Integrated hepatic transcriptome and metabolome. Carbohydr Polym. 2022;297:120051.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 39]  [Cited by in RCA: 31]  [Article Influence: 7.8]  [Reference Citation Analysis (0)]
22.  Sarabia LD, Boughton BA, Rupasinghe T, Callahan DL, Hill CB, Roessner U. Comparative spatial lipidomics analysis reveals cellular lipid remodelling in different developmental zones of barley roots in response to salinity. Plant Cell Environ. 2020;43:327-343.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 36]  [Cited by in RCA: 25]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
23.  Heischmann S, Quinn K, Cruickshank-Quinn C, Liang LP, Reisdorph R, Reisdorph N, Patel M. Exploratory Metabolomics Profiling in the Kainic Acid Rat Model Reveals Depletion of 25-Hydroxyvitamin D3 during Epileptogenesis. Sci Rep. 2016;6:31424.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 122]  [Cited by in RCA: 112]  [Article Influence: 11.2]  [Reference Citation Analysis (0)]
24.  Haspel JA, Chettimada S, Shaik RS, Chu JH, Raby BA, Cernadas M, Carey V, Process V, Hunninghake GM, Ifedigbo E, Lederer JA, Englert J, Pelton A, Coronata A, Fredenburgh LE, Choi AM. Circadian rhythm reprogramming during lung inflammation. Nat Commun. 2014;5:4753.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 209]  [Cited by in RCA: 185]  [Article Influence: 15.4]  [Reference Citation Analysis (0)]
25.  Sreekumar A, Poisson LM, Rajendiran TM, Khan AP, Cao Q, Yu J, Laxman B, Mehra R, Lonigro RJ, Li Y, Nyati MK, Ahsan A, Kalyana-Sundaram S, Han B, Cao X, Byun J, Omenn GS, Ghosh D, Pennathur S, Alexander DC, Berger A, Shuster JR, Wei JT, Varambally S, Beecher C, Chinnaiyan AM. Metabolomic profiles delineate potential role for sarcosine in prostate cancer progression. Nature. 2009;457:910-914.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1927]  [Cited by in RCA: 1662]  [Article Influence: 97.8]  [Reference Citation Analysis (4)]
26.  Jordan SD, Kriebs A, Vaughan M, Duglan D, Fan W, Henriksson E, Huber AL, Papp SJ, Nguyen M, Afetian M, Downes M, Yu RT, Kralli A, Evans RM, Lamia KA. CRY1/2 Selectively Repress PPARδ and Limit Exercise Capacity. Cell Metab. 2017;26:243-255.e6.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 109]  [Cited by in RCA: 100]  [Article Influence: 11.1]  [Reference Citation Analysis (0)]
27.  Sun S, Zhou L, Yu Y, Zhang T, Wang M. Knocking down clock control gene CRY1 decreases adipogenesis via canonical Wnt/β-catenin signaling pathway. Biochem Biophys Res Commun. 2018;506:746-753.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 24]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
28.  Toledo M, Batista-Gonzalez A, Merheb E, Aoun ML, Tarabra E, Feng D, Sarparanta J, Merlo P, Botrè F, Schwartz GJ, Pessin JE, Singh R. Autophagy Regulates the Liver Clock and Glucose Metabolism by Degrading CRY1. Cell Metab. 2018;28:268-281.e4.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 153]  [Cited by in RCA: 140]  [Article Influence: 17.5]  [Reference Citation Analysis (0)]
29.  Kim YY, Jang H, Lee G, Jeon YG, Sohn JH, Han JS, Lee WT, Park J, Huh JY, Nahmgoong H, Han SM, Kim J, Pak M, Kim S, Kim JS, Kim JB. Hepatic GSK3β-Dependent CRY1 Degradation Contributes to Diabetic Hyperglycemia. Diabetes. 2022;71:1373-1387.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 12]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
30.  Tong X, Zhang D, Charney N, Jin E, VanDommelen K, Stamper K, Gupta N, Saldate J, Yin L. DDB1-Mediated CRY1 Degradation Promotes FOXO1-Driven Gluconeogenesis in Liver. Diabetes. 2017;66:2571-2582.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 24]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
31.  Jang H, Lee GY, Selby CP, Lee G, Jeon YG, Lee JH, Cheng KK, Titchenell P, Birnbaum MJ, Xu A, Sancar A, Kim JB. SREBP1c-CRY1 signalling represses hepatic glucose production by promoting FOXO1 degradation during refeeding. Nat Commun. 2016;7:12180.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 86]  [Cited by in RCA: 79]  [Article Influence: 7.9]  [Reference Citation Analysis (0)]
32.  Song YQ, Guan XQ, Weng ZM, Wang YQ, Chen J, Jin Q, Fang SQ, Fan B, Cao YF, Hou J, Ge GB. Discovery of a highly specific and efficacious inhibitor of human carboxylesterase 2 by large-scale screening. Int J Biol Macromol. 2019;137:261-269.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 32]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
33.  Eisner H, Riegler-Berket L, Gamez CFR, Sagmeister T, Chalhoub G, Darnhofer B, Jazleena PJ, Birner-Gruenberger R, Pavkov-Keller T, Haemmerle G, Schoiswohl G, Oberer M. The Crystal Structure of Mouse Ces2c, a Potential Ortholog of Human CES2, Shows Structural Similarities in Substrate Regulation and Product Release to Human CES1. Int J Mol Sci. 2022;23:13101.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 13]  [Cited by in RCA: 13]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
34.  Chalhoub G, Kolleritsch S, Maresch LK, Taschler U, Pajed L, Tilp A, Eisner H, Rosina P, Kien B, Radner FPW, Schicho R, Oberer M, Schoiswohl G, Haemmerle G. Carboxylesterase 2 proteins are efficient diglyceride and monoglyceride lipases possibly implicated in metabolic disease. J Lipid Res. 2021;62:100075.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 49]  [Cited by in RCA: 42]  [Article Influence: 8.4]  [Reference Citation Analysis (1)]
35.  Chalhoub G, Jamnik A, Pajed L, Kolleritsch S, Hois V, Bagaric A, Prem D, Tilp A, Kolb D, Wolinski H, Taschler U, Züllig T, Rechberger GN, Fuchs C, Trauner M, Schoiswohl G, Haemmerle G. Carboxylesterase 2a deletion provokes hepatic steatosis and insulin resistance in mice involving impaired diacylglycerol and lysophosphatidylcholine catabolism. Mol Metab. 2023;72:101725.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 31]  [Cited by in RCA: 28]  [Article Influence: 9.3]  [Reference Citation Analysis (0)]
36.  Liu J, Shang X, Huang S, Xu Y, Lu J, Zhang Y, Liu Z, Wang X. Construction and Characterization of CRISPR/Cas9 Knockout Rat Model of Carboxylesterase 2a Gene. Mol Pharmacol. 2021;100:480-490.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 12]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
37.  Li G, Li X, Yang L, Wang S, Dai Y, Fekry B, Veillon L, Tan L, Berdeaux R, Eckel-Mahan K, Lorenzi PL, Zhao Z, Lehner R, Sun K. Adipose tissue-specific ablation of Ces1d causes metabolic dysregulation in mice. Life Sci Alliance. 2022;5:e202101209.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 26]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
38.  Lian J, van der Veen JN, Watts R, Jacobs RL, Lehner R. Carboxylesterase 1d (Ces1d) does not contribute to cholesteryl ester hydrolysis in the liver. J Lipid Res. 2021;62:100093.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 10]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
39.  Jash S, Banerjee S, Lee MJ, Farmer SR, Puri V. CIDEA Transcriptionally Regulates UCP1 for Britening and Thermogenesis in Human Fat Cells. iScience. 2019;20:73-89.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 89]  [Cited by in RCA: 82]  [Article Influence: 11.7]  [Reference Citation Analysis (0)]
40.  Fischer AW, Shabalina IG, Mattsson CL, Abreu-Vieira G, Cannon B, Nedergaard J, Petrovic N. UCP1 inhibition in Cidea-overexpressing mice is physiologically counteracted by brown adipose tissue hyperrecruitment. Am J Physiol Endocrinol Metab. 2017;312:E72-E87.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 43]  [Article Influence: 4.8]  [Reference Citation Analysis (0)]
41.  Reynolds TH 4th, Banerjee S, Sharma VM, Donohue J, Couldwell S, Sosinsky A, Frulla A, Robinson A, Puri V. Effects of a High Fat Diet and Voluntary Wheel Running Exercise on Cidea and Cidec Expression in Liver and Adipose Tissue of Mice. PLoS One. 2015;10:e0130259.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 29]  [Cited by in RCA: 27]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
42.  Zhou L, Xu L, Ye J, Li D, Wang W, Li X, Wu L, Wang H, Guan F, Li P. Cidea promotes hepatic steatosis by sensing dietary fatty acids. Hepatology. 2012;56:95-107.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 169]  [Cited by in RCA: 156]  [Article Influence: 11.1]  [Reference Citation Analysis (1)]
43.  Prabata A, Ikeda K, Rahardini EP, Hirata KI, Emoto N. GPNMB plays a protective role against obesity-related metabolic disorders by reducing macrophage inflammatory capacity. J Biol Chem. 2021;297:101232.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 49]  [Cited by in RCA: 34]  [Article Influence: 6.8]  [Reference Citation Analysis (0)]
44.  Gong XM, Li YF, Luo J, Wang JQ, Wei J, Wang JQ, Xiao T, Xie C, Hong J, Ning G, Shi XJ, Li BL, Qi W, Song BL. Gpnmb secreted from liver promotes lipogenesis in white adipose tissue and aggravates obesity and insulin resistance. Nat Metab. 2019;1:570-583.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 86]  [Cited by in RCA: 80]  [Article Influence: 11.4]  [Reference Citation Analysis (1)]
45.  Soni A, Amisten S, Rorsman P, Salehi A. GPRC5B a putative glutamate-receptor candidate is negative modulator of insulin secretion. Biochem Biophys Res Commun. 2013;441:643-648.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 30]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
46.  Kim YJ, Sano T, Nabetani T, Asano Y, Hirabayashi Y. GPRC5B activates obesity-associated inflammatory signaling in adipocytes. Sci Signal. 2012;5:ra85.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 53]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
47.  Ye T, Shaukat A, Yang L, Chen C, Zhou Y, Yang L. Evolutionary and Association Analysis of Buffalo FABP Family Genes Reveal Their Potential Role in Milk Performance. Genes (Basel). 2022;13:600.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 17]  [Cited by in RCA: 11]  [Article Influence: 2.8]  [Reference Citation Analysis (1)]
48.  Shinoda Y, Wang Y, Yamamoto T, Miyachi H, Fukunaga K. Analysis of binding affinity and docking of novel fatty acid-binding protein (FABP) ligands. J Pharmacol Sci. 2020;143:264-271.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 51]  [Cited by in RCA: 39]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
49.  Samulin J, Berget I, Lien S, Sundvold H. Differential gene expression of fatty acid binding proteins during porcine adipogenesis. Comp Biochem Physiol B Biochem Mol Biol. 2008;151:147-152.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 64]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
50.  Kusudo T, Kontani Y, Kataoka N, Ando F, Shimokata H, Yamashita H. Fatty acid-binding protein 3 stimulates glucose uptake by facilitating AS160 phosphorylation in mouse muscle cells. Genes Cells. 2011;16:681-691.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 25]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
51.  Yamashita H, Wang Z, Wang Y, Segawa M, Kusudo T, Kontani Y. Induction of fatty acid-binding protein 3 in brown adipose tissue correlates with increased demand for adaptive thermogenesis in rodents. Biochem Biophys Res Commun. 2008;377:632-635.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 31]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
52.  Furuhashi M, Hiramitsu S, Mita T, Omori A, Fuseya T, Ishimura S, Watanabe Y, Hoshina K, Matsumoto M, Tanaka M, Moniwa N, Yoshida H, Ishii J, Miura T. Reduction of circulating FABP4 level by treatment with omega-3 fatty acid ethyl esters. Lipids Health Dis. 2016;15:5.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 51]  [Cited by in RCA: 49]  [Article Influence: 4.9]  [Reference Citation Analysis (0)]
53.  Karakas SE, Almario RU, Kim K. Serum fatty acid binding protein 4, free fatty acids, and metabolic risk markers. Metabolism. 2009;58:1002-1007.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 38]  [Cited by in RCA: 34]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
54.  Ibarretxe D, Girona J, Amigó N, Plana N, Ferré R, Guaita S, Mallol R, Heras M, Masana L. Impact of epidermal fatty acid binding protein on 2D-NMR-assessed atherogenic dyslipidemia and related disorders. J Clin Lipidol. 2016;10:330-8.e2.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 12]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
55.  Djoussé L, Khawaja O, Bartz TM, Biggs ML, Ix JH, Zieman SJ, Kizer JR, Tracy RP, Siscovick DS, Mukamal KJ. Plasma fatty acid-binding protein 4, nonesterified fatty acids, and incident diabetes in older adults. Diabetes Care. 2012;35:1701-1707.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 34]  [Cited by in RCA: 33]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
56.  Chung JY, Hong J, Kim HJ, Song Y, Yong SB, Lee J, Kim YH. White adipocyte-targeted dual gene silencing of FABP4/5 for anti-obesity, anti-inflammation and reversal of insulin resistance: Efficacy and comparison of administration routes. Biomaterials. 2021;279:121209.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 37]  [Article Influence: 7.4]  [Reference Citation Analysis (0)]
57.  Kawai T, Matsumori N, Otsuka K. Recent advances in microscale separation techniques for lipidome analysis. Analyst. 2021;146:7418-7430.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 10]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
58.  Gu Y, Zhang Y, Shi X, Li X, Hong J, Chen J, Gu W, Lu X, Xu G, Ning G. Effect of traditional Chinese medicine berberine on type 2 diabetes based on comprehensive metabonomics. Talanta. 2010;81:766-772.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 159]  [Cited by in RCA: 129]  [Article Influence: 8.1]  [Reference Citation Analysis (0)]
59.  Yamamoto Y, Sakurai T, Chen Z, Inoue N, Chiba H, Hui SP. Lysophosphatidylethanolamine Affects Lipid Accumulation and Metabolism in a Human Liver-Derived Cell Line. Nutrients. 2022;14:579.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 89]  [Cited by in RCA: 76]  [Article Influence: 19.0]  [Reference Citation Analysis (0)]
60.  Kumar A, Sundaram K, Mu J, Dryden GW, Sriwastva MK, Lei C, Zhang L, Qiu X, Xu F, Yan J, Zhang X, Park JW, Merchant ML, Bohler HCL, Wang B, Zhang S, Qin C, Xu Z, Han X, McClain CJ, Teng Y, Zhang HG. High-fat diet-induced upregulation of exosomal phosphatidylcholine contributes to insulin resistance. Nat Commun. 2021;12:213.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 225]  [Cited by in RCA: 213]  [Article Influence: 42.6]  [Reference Citation Analysis (1)]
61.  Drogan D, Dunn WB, Lin W, Buijsse B, Schulze MB, Langenberg C, Brown M, Floegel A, Dietrich S, Rolandsson O, Wedge DC, Goodacre R, Forouhi NG, Sharp SJ, Spranger J, Wareham NJ, Boeing H. Untargeted metabolic profiling identifies altered serum metabolites of type 2 diabetes mellitus in a prospective, nested case control study. Clin Chem. 2015;61:487-497.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 116]  [Cited by in RCA: 104]  [Article Influence: 9.5]  [Reference Citation Analysis (1)]
62.  Sun L, Liang L, Gao X, Zhang H, Yao P, Hu Y, Ma Y, Wang F, Jin Q, Li H, Li R, Liu Y, Hu FB, Zeng R, Lin X, Wu J. Early Prediction of Developing Type 2 Diabetes by Plasma Acylcarnitines: A Population-Based Study. Diabetes Care. 2016;39:1563-1570.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 148]  [Cited by in RCA: 135]  [Article Influence: 13.5]  [Reference Citation Analysis (0)]
63.  McGarry JD. Banting lecture 2001: dysregulation of fatty acid metabolism in the etiology of type 2 diabetes. Diabetes. 2002;51:7-18.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1138]  [Cited by in RCA: 1032]  [Article Influence: 43.0]  [Reference Citation Analysis (2)]
64.  Prentki M, Matschinsky FM, Madiraju SR. Metabolic signaling in fuel-induced insulin secretion. Cell Metab. 2013;18:162-185.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 514]  [Cited by in RCA: 449]  [Article Influence: 34.5]  [Reference Citation Analysis (0)]
65.  Saponaro C, Gaggini M, Carli F, Gastaldelli A. The Subtle Balance between Lipolysis and Lipogenesis: A Critical Point in Metabolic Homeostasis. Nutrients. 2015;7:9453-9474.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 455]  [Cited by in RCA: 392]  [Article Influence: 35.6]  [Reference Citation Analysis (1)]
66.  Aichler M, Borgmann D, Krumsiek J, Buck A, MacDonald PE, Fox JEM, Lyon J, Light PE, Keipert S, Jastroch M, Feuchtinger A, Mueller NS, Sun N, Palmer A, Alexandrov T, Hrabe de Angelis M, Neschen S, Tschöp MH, Walch A. N-acyl Taurines and Acylcarnitines Cause an Imbalance in Insulin Synthesis and Secretion Provoking β Cell Dysfunction in Type 2 Diabetes. Cell Metab. 2017;25:1334-1347.e4.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 107]  [Cited by in RCA: 92]  [Article Influence: 10.2]  [Reference Citation Analysis (0)]
67.  Strand E, Rebnord EW, Flygel MR, Lysne V, Svingen GFT, Tell GS, Løland KH, Berge RK, Svardal A, Nygård O, Pedersen ER. Serum Carnitine Metabolites and Incident Type 2 Diabetes Mellitus in Patients With Suspected Stable Angina Pectoris. J Clin Endocrinol Metab. 2018;103:1033-1041.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 32]  [Cited by in RCA: 28]  [Article Influence: 3.5]  [Reference Citation Analysis (0)]
68.  Qiu G, Zheng Y, Wang H, Sun J, Ma H, Xiao Y, Li Y, Yuan Y, Yang H, Li X, Min X, Zhang C, Xu C, Jiang Y, Zhang X, He M, Yang M, Hu Z, Tang H, Shen H, Hu FB, Pan A, Wu T. Plasma metabolomics identified novel metabolites associated with risk of type 2 diabetes in two prospective cohorts of Chinese adults. Int J Epidemiol. 2016;45:1507-1516.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 85]  [Cited by in RCA: 77]  [Article Influence: 7.7]  [Reference Citation Analysis (3)]
69.  Zhang CS, Hawley SA, Zong Y, Li M, Wang Z, Gray A, Ma T, Cui J, Feng JW, Zhu M, Wu YQ, Li TY, Ye Z, Lin SY, Yin H, Piao HL, Hardie DG, Lin SC. Fructose-1,6-bisphosphate and aldolase mediate glucose sensing by AMPK. Nature. 2017;548:112-116.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 669]  [Cited by in RCA: 579]  [Article Influence: 64.3]  [Reference Citation Analysis (4)]
70.  Ardiansyah, Inagawa Y, Koseki T, Agista AZ, Ikeda I, Goto T, Komai M, Shirakawa H. Adenosine and adenosine-5'-monophosphate ingestion ameliorates abnormal glucose metabolism in mice fed a high-fat diet. BMC Complement Altern Med. 2018;18:304.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 11]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
71.  Ardiansyah, Shirakawa H, Koseki T, Hiwatashi K, Takahasi S, Akiyama Y, Komai M. Novel effect of adenosine 5'-monophosphate on ameliorating hypertension and the metabolism of lipids and glucose in stroke-prone spontaneously hypertensive rats. J Agric Food Chem. 2011;59:13238-13245.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 8]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
72.  Pan L, Li Z, Wang Y, Zhang B, Liu G, Liu J. Network pharmacology and metabolomics study on the intervention of traditional Chinese medicine Huanglian Decoction in rats with type 2 diabetes mellitus. J Ethnopharmacol. 2020;258:112842.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 137]  [Cited by in RCA: 114]  [Article Influence: 19.0]  [Reference Citation Analysis (2)]
73.  Friedrich N, Budde K, Wolf T, Jungnickel A, Grotevendt A, Dressler M, Völzke H, Blüher M, Nauck M, Lohmann T, Wallaschofksi H. Short-term changes of the urine metabolome after bariatric surgery. OMICS. 2012;16:612-620.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 28]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
74.  de Mello VD, Lankinen MA, Lindström J, Puupponen-Pimiä R, Laaksonen DE, Pihlajamäki J, Lehtonen M, Uusitupa M, Tuomilehto J, Kolehmainen M, Törrönen R, Hanhineva K. Fasting serum hippuric acid is elevated after bilberry (Vaccinium myrtillus) consumption and associates with improvement of fasting glucose levels and insulin secretion in persons at high risk of developing type 2 diabetes. Mol Nutr Food Res. 2017;61.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 80]  [Cited by in RCA: 63]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
75.  Su T, He R. D-ribose, an overlooked player in type 2 diabetes mellitus? Sci China Life Sci. 2014;57:361.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 20]  [Cited by in RCA: 18]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
76.  Chen X, Su T, Chen Y, He Y, Liu Y, Xu Y, Wei Y, Li J, He R. d-Ribose as a Contributor to Glycated Haemoglobin. EBioMedicine. 2017;25:143-153.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 39]  [Cited by in RCA: 38]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
77.  Zhang Q, Ford LA, Goodman KD, Freed TA, Hauser DM, Conner JK, Vroom KE, Toal DR. LC-MS/MS method for quantitation of seven biomarkers in human plasma for the assessment of insulin resistance and impaired glucose tolerance. J Chromatogr B Analyt Technol Biomed Life Sci. 2016;S1570-0232(16)30598.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 11]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
78.  Qin F, Li J, Mao T, Feng S, Li J, Lai M. 2 Hydroxybutyric Acid-Producing Bacteria in Gut Microbiome and Fusobacterium nucleatum Regulates 2 Hydroxybutyric Acid Level In Vivo. Metabolites. 2023;13:451.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 18]  [Cited by in RCA: 16]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
79.  Burzynska-Pedziwiatr I, Dudzik D, Sansone A, Malachowska B, Zieleniak A, Zurawska-Klis M, Ferreri C, Chatgilialoglu C, Cypryk K, Wozniak LA, Markuszewski MJ, Bukowiecka-Matusiak M. Targeted and untargeted metabolomic approach for GDM diagnosis. Front Mol Biosci. 2022;9:997436.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 10]  [Article Influence: 3.3]  [Reference Citation Analysis (1)]
80.  Feng B, Wang L, Wei D, Huo W, Jing T, Wang C, Mao Z. Combined Effects of ESRα DNA Methylation and Progesterone on Glucose Metabolic Disorders: The Henan Rural Cohort Study. Nutrients. 2023;15:1659.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 3]  [Article Influence: 1.0]  [Reference Citation Analysis (1)]
81.  Hofmann A, Peitzsch M, Brunssen C, Mittag J, Jannasch A, Frenzel A, Brown N, Weldon SM, Eisenhofer G, Bornstein SR, Morawietz H. Elevated Steroid Hormone Production in the db/db Mouse Model of Obesity and Type 2 Diabetes. Horm Metab Res. 2017;49:43-49.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 13]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
82.  Wang L, Mao Z, Liu X, Wei D, Liu P, Nie L, Fan K, Kang N, Song Y, Xu Q, Wang J, Wang M, Liao W, Jing T, Li W, Wang C, Huo W. Combined effects of progesterone and SOCS3 DNA methylation on T2DM: a case-control study. Clin Epigenetics. 2021;13:181.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 9]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
83.  Nunes VA, Portioli-Sanches EP, Rosim MP, Araujo MS, Praxedes-Garcia P, Valle MM, Roma LP, Hahn C, Gurgul-Convey E, Lenzen S, Azevedo-Martins AK. Progesterone induces apoptosis of insulin-secreting cells: insights into the molecular mechanism. J Endocrinol. 2014;221:273-284.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 36]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
84.  Shao J, Qiao L, Friedman JE. Prolactin, progesterone, and dexamethasone coordinately and adversely regulate glucokinase and cAMP/PDE cascades in MIN6 beta-cells. Am J Physiol Endocrinol Metab. 2004;286:E304-E310.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 32]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
85.  Lee SR, Choi WY, Heo JH, Huh J, Kim G, Lee KP, Kwun HJ, Shin HJ, Baek IJ, Hong EJ. Progesterone increases blood glucose via hepatic progesterone receptor membrane component 1 under limited or impaired action of insulin. Sci Rep. 2020;10:16316.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 40]  [Cited by in RCA: 40]  [Article Influence: 6.7]  [Reference Citation Analysis (0)]
86.  Brănişteanu DD, Mathieu C. Progesterone in gestational diabetes mellitus: guilty or not guilty? Trends Endocrinol Metab. 2003;14:54-56.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 60]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Endocrinology and metabolism

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade A, Grade B, Grade B, Grade B

Novelty: Grade A, Grade B, Grade C

Creativity or Innovation: Grade B, Grade B, Grade B

Scientific Significance: Grade B, Grade B, Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Horowitz M, PhD, Professor, Australia; Sun XH, MD, China; Vargas-Beltran AM, MD, Mexico S-Editor: Fan M L-Editor: A P-Editor: Zhang YL

Write to the Help Desk