Quercetin pretreated umbilical cord mesenchymal stem cells alleviate inflammatory bowel disease via IL-10 /Janus kinase 2/STAT3 signaling

Table 1 Disease Activity Index score

Score	Weight loss (%)	Stool consistency	Blood
0	None	Normal	Negative Hemocult
1	1%-5%	Soft but still formed	Negative Hemocult
2	5%-10%	Soft	Positive Hemocult
3	10%-15%	Very soft; wet	Blood traces in stool visible
4	> 15%	Watery diarrhea	Gross rectal bleeding

Disease Activity Index score = (body weight loss + stool consistency + blood)/3. Disease Activity Index score ranges from 0 to 4 points: 0 points: Normal; 4 points: Maximum inflammatory activity.

Table 2 Histological Activity Index score

Score	Organizational changes
0	No inflammatory changes
1	Mild inflammation with scattered infiltrating mononuclear cells (1-2 Lesions)
2	Moderate inflammation with multiple lesions visible
3	Significant inflammatory changes, increased vascular density, and thickening of intestinal wall
4	Severe inflammatory changes, lymphocyte transmural infiltration, and decreased goblet cells

Table 3 Primer sequence

Gene	Forward primer	Reverse primer
GAPDH	GGCAAATTCAACGGCACAGTCAAG	TCGCTCCTGGAAGATGGTGATGG
IL-10	GGTTGCCAAGCCTTATCGGA	CTTCTCACCCAGGGAATTCA
JAK2	TTGTGGTATTACGCCTGTGTATC	ATGCCTGGTTGACTCGTCTAT
STAT3	CACCTTGGATTGAGAGTCAAGAC	AGGAATCGGCTATATTGCTGGT

GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; IL: Interleukin; JAK2: Janus kinase 2; STAT3: Signal transducer and activator of transcription 3.

Table 4 Antibody list

Antibody	Cat. No.	Company	Dilution
β-actin	Bs-0061R	Bioss	1:1000
IL-10	WL03088	Wanleibio	1:1000
IL-6	21865-1-AP	Proteintech	1:1000
JAK2	ab108596	Abcam	1:1000
P-JAK2	ab32101	Abcam	1:1000
STAT3	10253-2-AP	Proteintech	1:2000
p-STAT3 (Ser727)	WLP2412	Wanleibio	1:1000
SOCS3	66797-1-Ig	Proteintech	1:1500

IL: Interleukin; JAK2: Janus kinase 2; p-STAT3: Phosphorylated signal transducer and activator of transcription 3; STAT3: Signal transducer and activator of transcription 3; SOCS3: Suppressor of cytokine signaling 3.