BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Stem Cells. Mar 26, 2026; 18(3): 114929
Published online Mar 26, 2026. doi: 10.4252/wjsc.v18.i3.114929
Acupuncture improves transplanted neural stem cells in dementia mice by modulating hippocampal microenvironment via microRNA-124 mediated Notch and Wnt pathways
Yu-Jiao Li, Xi Chen, Yong-Yin Luo, Jun Chang, Shu-Zhen Liu, Xiao-Qian Shan, Jing-Jing Song, Nan Hao, Xu-He Yan, Wei-Li Gao, Lan Zhao, First Teaching Hospital of Tianjin University of Traditional Chinese Medicine, National Clinical Research Center for Chinese Medicine, Tianjin 300381, China
Jian-Wei Liu, School of Integrative Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin 301617, China
ORCID number: Yu-Jiao Li (0000-0003-4949-2942); Xi Chen (0000-0003-4179-0240); Yong-Yin Luo (0000-0002-4681-0127); Jun Chang (0000-0001-7800-7286); Shu-Zhen Liu (0009-0009-4735-3456); Xiao-Qian Shan (0000-0002-9473-0949); Jing-Jing Song (0000-0002-6992-1065); Nan Hao (0000-0003-0507-4589); Xu-He Yan (0000-0002-3178-0463); Wei-Li Gao (0009-0003-6290-1832); Jian-Wei Liu (0000-0001-7120-2951); Lan Zhao (0000-0002-7449-2947).
Co-first authors: Yu-Jiao Li and Xi Chen.
Co-corresponding authors: Jian-Wei Liu and Lan Zhao.
Author contributions: Zhao L contributed to the conceptualization, funding acquisition, project administration, and supervision; Liu JW contributed to the conceptualization, animal modeling and supervision; Li YJ, Chen X, Luo YY, Chang J, Shan XQ, and Song JJ contributed to investigation and methodology; Li YJ and Chen X contributed to writing original draft; Liu SZ, Hao N, Yan XH, and Gao WL contributed to writing-review and editing. All authors have read and agreed to the published version of the manuscript. We designated Zhao L and Liu JW as co-corresponding authors for three key reasons. First, the study’s collaborative nature warrants shared responsibility, ensuring effective post-submission communication and enhancing the paper’s quality. Second, both authors possess complementary expertise, enriching the research with diverse, in-depth perspectives for readers. Third, Zhao L and Liu JW contributed equally throughout the project. There are two main reasons for deciding to designate Li YJ and Chen X as co-first authors. First, this study was conducted as a collaborative effort, and it is reasonable to designate a co- author. Second, both authors contributed equally during the experimental implementation, data processing, plotting and writing of this manuscript. We believe that designating Zhao L and Liu JW as co-corresponding authors and Li YJ and Chen X as co-first authors are suitable for our manuscript as it accurately reflects our team’s spirit of cooperation, equal contribution and diversity.
Supported by National Natural Science Foundation of China, No. 82074533.
Institutional animal care and use committee statement: All procedures involving animals are reviewed and approved by the Tianjin University of Traditional Chinese Medicine, No. TCM-LAEC2022045.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: The original contributions presented in the study are included in the article. Further inquiries can be directed to the corresponding authors.
Corresponding author: Lan Zhao, PhD, Professor, First Teaching Hospital of Tianjin University of Traditional Chinese Medicine, National Clinical Research Center for Chinese Medicine, No. 88 Changling Road, Xiqing District, Tianjin 300381, China. lanzhao69@163.com
Received: October 11, 2025
Revised: November 5, 2025
Accepted: January 26, 2026
Published online: March 26, 2026
Processing time: 174 Days and 20 Hours

Abstract
BACKGROUND

Neural stem cells (NSCs) transplantation is a promising clinical therapy for Alzheimer’s disease (AD). The Notch and Wnt signaling pathways play important roles in the biological functions of NSCs, and microRNA-124 (miR-124) regulates these pathways through its regulatory effects.

AIM

To explore the mechanism of acupuncture in enhancing the function of transplanted NSCs and their therapeutic potential in AD.

METHODS

This study utilized enzyme-linked immunosorbent assay, western blotting, and real-time fluorescent quantitative polymerase chain reaction, to investigate the effects of acupuncture on the role of miR-124 in regulating the Notch and Wnt signaling pathways, in NSCs transplantation therapy in a mouse model of AD-senescence-accelerated mouse prone 8 mice. An in vitro coculture model of mouse hippocampal brain slices and NSCs was established, and flow cytometry was used to examine the effects of acupuncture on the regulation of cyclin D1, an interactive protein in the Notch and Wnt signaling pathways, and on NSCs proliferation and differentiation.

RESULTS

Acupuncture significantly improved cognitive impairment in AD mice after NSCs transplantation (P < 0.05); inhibited expression of characteristic pathological biomarkers of AD (P < 0.05); and upregulated expression of NSCs-specific neuroproliferation and differentiation biomarkers (P < 0.05). Upregulation of miR-124 modulated the key target genes Notch homolog 1, hairy and enhancer of split 5, and glycogen synthase kinase 3β in the Notch and Wnt signaling pathways (P < 0.05); regulated the Notch and Wnt dual signaling pathways and achieved interaction (P < 0.05); promoted NSCs proliferation and differentiation (P < 0.05); restored damaged cells; and slowed the progression of AD.

CONCLUSION

Acupuncture may improve the hippocampal microenvironment by upregulating miR-124 to regulate the Notch and Wnt dual signaling pathways, promote NSCs proliferation and differentiation, facilitate the repair of damaged neurons, integrate neural circuits, restore biological functions, and improve cognitive impairment in AD mice.

Key Words: Neural stem cells; Hippocampal microenvironment; Acupuncture; MicroRNA-124; Notch signaling pathway; Wnt signaling pathway; Alzheimer’s disease

Core Tip: Acupuncture improved hippocampal microenvironmental dysfunction in a mouse model of Alzheimer’s disease (AD), thereby enhancing the biological activity of transplanted neural stem cells (NSCs). Acupuncture reduced AD-related pathological biomarkers and upregulated microRNA-124, which concurrently targeted Notch homolog 1, hairy and enhancer of split 5, and glycogen synthase kinase 3β, modulating the Notch and Wnt signaling pathways. This dual pathway regulated cyclin D1-mediated NSCs proliferation and differentiation, and promoted neural circuit remodeling. Consequently, AD pathology was markedly suppressed. Our study identified microRNA-124/Notch-Wnt as a promising therapeutic target and suggests that sustained acupuncture is a viable strategy for mitigating irreversible neurofunctional deficits in AD.



INTRODUCTION

Alzheimer’s disease (AD) and other neurodegenerative diseases have become major global public health challenges. Their core pathological features include neuronal loss in the hippocampus and synaptic dysfunction, resulting in irreversible cognitive decline[1]. Although neural stem cells (NSCs) transplantation offers a potential therapeutic strategy for neuronal regeneration[2], the survival rate, directed differentiation efficiency, and functional integration of transplanted NSCs are hindered by the complex pathological microenvironment within the host brain[3]. Remodeling the microenvironment may be key to overcoming this bottleneck. In recent years, traditional Chinese medical approaches have demonstrated unique value in the field of neural regulation. Acupuncture, which modulates neural plasticity and metabolic homeostasis, has been shown to enhance cognitive function in AD animal models[4]. However, its role in remodeling the hippocampal microenvironment and its synergistic mechanisms with NSCs transplantation remain unclear. MicroRNAs (miRNAs), as core molecules in epigenetic regulation, play a pivotal role in neural development and degenerative diseases[5]. Among these, neuron-specific microRNA-124 (miR-124), regulates the Notch[6] and Wnt[7] dual signaling pathways, which respectively maintain stem cell quiescence (Notch)[8] and regulate cell proliferation and differentiation (Wnt)[9], thereby profoundly influencing the fate of NSCs. However, whether miR-124 mediates the dynamic regulation of the hippocampal microenvironment by acupuncture and optimizes the functional phenotype of transplanted NSCs remains to be elucidated.

This study proposed that acupuncture may upregulate miR-124 expression, inhibit abnormal activation of the Notch signaling pathway, and promote activation of the Wnt signaling pathway, thereby reshaping the hippocampal microenvironment of dementia mice and enhancing the proliferation, directed differentiation, and functional integration capabilities of transplanted NSCs. The aim was to provide innovative treatment strategies for neuroregenerative medicine that combine traditional medicine and modern molecular mechanisms (Figure 1).

Figure 1
Figure 1 Schematic diagram of the mechanism by which acupuncture regulates the downstream targets of microRNA-124. A: Notch signaling pathway; B: Wnt signaling pathway (canonical); C: Wnt signaling pathway (noncanonical); D: Notch and Wnt interaction; E: Cell cycle. AD: Alzheimer’s disease; NSCs: Neural stem cells; ADAM10: A disintegrin and metalloproteinase 10; Notch1: Notch homolog 1; HERP: Hairy/enhancer of split related protein; Hes1: Hairy and enhancer of split 1; Hes5: Hairy and enhancer of split 5; LRP5/6: Lipoprotein receptor-related protein 5/6; GSK3β: Glycogen synthase kinase 3β; TCF: T-cell factor; C-myc: Myc proto-oncogene; Cyclin D1: Cell cycle protein D1; Cylin D2: Cell cycle protein D2; PLC: Phospholipase C; PKC: Protein kinase C.
MATERIALS AND METHODS
Isolation, culture, expansion, and induction of differentiation of NSCs

We used 12-16-day-old pregnant senescence-accelerated mouse resistant 1 (SAMR1) mice. Hippocampal tissue was isolated from the placenta under sterile conditions, digested and centrifuged, added to NSCs culture medium, and incubated in a 5% CO2, 37 °C incubator. The cells were passaged and expanded at a 1:2 ratio. The cell count of NSCs was adjusted to 106/mL. NSCs were seeded onto 24-well plates with coverslips, cell smears were prepared, immunocytochemical staining was performed for identification, and nestin-positive cells were counted under a microscope. The MTS method was used to measure optical density at 490 nm, reflecting NSCs proliferation. Adjust the NSCs count to 1 × 106/mL, seed into a 24-well plate with coverslips, and replace the medium to induce NSCs differentiation. Prepare cell smears and perform immunocytochemical staining. We observed expression of neuronal nuclear antigen (NeuN) and glial fibrillary acidic protein (GFAP) under a microscope to assess the differentiation status of NSCs (Figure 2).

Figure 2
Figure 2 Experiment operational flowchart: Timing of cell culture and transplantation as well as acupuncture intervention. SAMR1: Senescence-accelerated mice resistant 1; SAMP8: Senescence-accelerated mouse prone 8; RC: Senescence-accelerated mice resistant 1 control group; PC: Senescence-accelerated mouse prone 8 control group; PT: Senescence-accelerated mouse prone 8-neural stem cells transplantation group; PS: Senescence-accelerated mouse prone 8-sham transplantation group; PTA: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint group; PTN: Senescence-accelerated mouse prone 8-neural stem cells transplantation with non-acupoint group; PTAH: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 high expression group; PTAL: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 low expression group; PTAC: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 control group.
Construction of miR-124 high expression and interference recombinant adenovirus expression vector and recombinant adenovirus

Polymerase chain reaction (PCR) primers were designed for the mmu-miR-124 precursor to amplify the precursor fragment, after which, the PCR product and pAdTrack-CMV vector underwent double restriction enzyme digestion. The restriction enzyme digestion products were subjected to gel electrophoresis, the linearized target fragment and pAdTrack-CMV vector fragment were recovered, and a ligation reaction was performed. The recombinant product was transformed into Escherichia coli; a single colony was selected for cultivation; the plasmid was extracted using alkaline lysis; restriction enzyme digestion and sequencing confirmed the plasmid; and the pAdTrack-CMV/miR-124 plasmid was constructed. The shuttle plasmid was linearized using PmeI, cultured and extracted, transformed into the Escherichia coli XL-blue clone strain, and purified using phenol-chloroform extraction to linearize the recombinant adenovirus vector. Using 293A cells, the PacI single-enzyme-digested linearized recombinant plasmid was transfected for viral packaging. After large-scale amplification, the recombinant adenovirus was concentrated, purified, and titer-tested, yielding miR-124 adenovirus and anti-miR-124 adenovirus (Figure 2).

Animal selection and grouping

The experimental animals were obtained from the First Teaching Hospital of Tianjin University of Traditional Chinese Medicine. Healthy male 8-month-old senescence-accelerated mouse prone 8 (SAMP8) and SAMR1 mice were selected. Randomization was performed using a random number table divided into the following nine groups, with 15 mice per group and five mice per cage. They were housed under identical conditions at 24 ± 2 °C and allowed free access to food.

Nine groups including: (1) SAMR1 control group (RC): Catching-grasping stimulation; (2) SAMP8 control group (PC): Catching-grapsing stimulation; (3) SAMP8-NSCs transplantation group (PT): SAMP8 mice underwent catching-grapsing stimulation for 15 days, followed by NSCs transplantation, and continued catching-grapsing stimulation for 15 days after 24 hours; (4) SAMP8-sham transplantation group (PS): SAMP8 mice underwent catching-grapsing stimulation for 15 days, followed by sham transplantation, and continued catching-grapsing stimulation for 15 days after 24 hours; (5) SAMP8-NSCs transplantation with acupoint group (PTA): SAMP8 mice underwent acupoint needling for 15 days, followed by NSCs transplantation, and continued acupoint needling for 15 days after 24 hours; (6) SAMP8-NSCs transplantation with non-acupoint group (PTN): SAMP8 mice underwent non-acupoint for 15 days, followed by NSCs transplantation, and continued non-acupoint for 15 days after 24 hours; (7) SAMP8-NSCs transplantation with acupoint and miR-124 high expression group (PTAH): SAMP8 mice underwent acupoint needling for 15 days, followed by transplantation of NSCs transfected with miR-124 adenovirus, and continued acupoint for 15 days after 24 hours; (8) SAMP8-NSCs transplantation with acupoint and miR-124 low expression group (PTAL): SAMP8 mice underwent acupoint needling for 15 days, followed by transplantation of NSCs transfected with anti-miR-124 adenovirus, followed by continued acupoint for 15 days after 24 hours; and (9) SAMP8-NSCs transplantation with acupoint and miR-124 control group (PTAC): SAMP8 mice underwent acupoint needling for 15 days, followed by transplantation of NSCs transfected with a recombinant adenovirus empty vector, followed by continued acupoint for 15 days after 24 hours (Figure 2).

Cell labeling and NSCs transplantation

Bromodeoxyuridine (BrdU) is a thymidine derivative that can replace thymidine in DNA synthesis and is often used to label exogenous cells. Healthy NSCs were labeled with 200 μmol/L BrdU in the culture medium before transplantation. Using a small animal stereotaxic instrument, NSCs were injected into the hippocampal region of mice in each transplantation group (PT, PTA, and PTN groups) at coordinates relative to the anterior fontanelle: (AP: -2.06, ML: ± 1.75, DV: -1.75). We injected 105 cells in 2 μL of NSCs suspension into the sparsely populated region of the dorsal dentate gyrus of the hippocampus. NSCs were transfected with miR-124 adenovirus, anti-miR-124 adenovirus, or recombinant adenovirus empty vector, followed by BrdU labeling. The PTAH, PTAL, and PTAC groups received hippocampal injection of mouse NSCs. In the PS group, 2 μL 0.9% saline solution was injected into the same region. After surgery, mice were transferred to cages for resuscitation 24 hours before intervention according to the prespecified protocol for each group (Figure 2).

Acupoint selection and needling techniques

The acupoint group was treated with Sanjiao acupuncture with the following acupoints selected: Danzhong (CV17), Zhongwan (CV12), Qihai (CV6), Xuehai (SP10), and Zusanli (ST36). The location of these acupoints was based on the Laboratory Acupuncture and Atlas of Animal Acupoints developed by Experimental Acupuncture-Moxibustion Research Association of the China Academy of Acupuncture and Moxibustion. Acupuncture techniques: Danzhong, Zhongwan, Qihai, and Zusanli were treated with the twisting tonification method for 30 seconds each, while Xuehai was treated with the twisting dispersion methods for 30 seconds. The PTN group selected two fixed non-acupoint locations below the ribs and applied the balanced tonification and dispersion method for 210 seconds. Acupuncture was performed once daily for 15 days, with a rest on day 7. RC and PC received the same duration and intensity of scratching stimulation (Figure 2).

Behavioral assessment

The hidden platform test was conducted using the Morris water maze for 5 days. The platform was located at the center of the northeast quadrant. The escape latency was observed and recorded, defined as the duration from falling into the water from two different quadrants to locating the hidden platform. If the mice could not locate the platform within 90 seconds, it was recorded as 90 seconds. The test was conducted twice daily for 5 consecutive days. Neurobehavioral changes in each group of mice were observed, and their learning and memory abilities were compared and analyzed (Figure 2).

Enzyme-linked immunosorbent assay to assess the impact of acupuncture on characteristic pathological markers of AD

Mice were killed by cervical dislocation, and hippocampal tissue was extracted. Cells were lysed using RIPA buffer to extract total protein, and protein concentration was determined using the BCA assay. Enzyme-linked immunosorbent assay was used to detect amyloid β (Aβ)40, Aβ42, amyloid precursor protein (APP), phosphorylated tau (P-tau) protein, β-secretase, and γ-secretase in the cell protein extracts from each sample.

Western blot analysis of the effects of acupuncture on the biological functions of exogenous NSCs

Western blotting was used to detect expression of nestin, NeuN, and GFAP proteins. Quantity One software of the gel imaging system was used for exposure and analysis of band optical density values, with the ratio of target protein gray value to β-actin gray value representing the relative expression of the protein.

Protein detection of molecules related to the Notch and Wnt signaling pathways in mouse hippocampal tissue

Western blotting was used to detect Notch homolog 1 (Notch1), Delta1, hairy and enhancer of split 1 (Hes1), Hes5, hairy/enhancer of split related protein (HERP), and other molecules in the Notch signaling pathway, as well as Wnt1, Wnt3a, β-catenin, glycogen synthase kinase 3β (GSK3β), c-myc, cyclin D1, and cyclin D2 in the Wnt classical signaling pathway, and Wnt5a, phospholipase C (PLC), protein kinase C (PKC), calcium/calmodulin-dependent protein kinase II (CAMKII) in the Wnt nonclassical signaling pathway. A gel imaging system and Quantity One software were used for exposure and analysis of band optical density values, with the target protein gray value/β-actin gray value ratio serving as the relative expression abundance of the protein.

Detection of mRNA levels of molecules related to the Notch and Wnt signaling pathways in mouse hippocampal tissue

Hippocampal tissue RNA was extracted, and real-time quantitative PCR reactions were performed using the absolute quantification 2-∆∆Ct method to detect the expression of multiple genes in the Notch and Wnt signaling pathways. The initial copy number (C0) of each sample was calculated using a standard curve, and the expression differences of each gene were directly reflected by the ratio of target gene C0 to β-actin C0 (Table 1).

Table 1 Information of primers used in this study.
Target
Primer sequence (5’-3’)
Notch1 (mouse)Forward: CAACTGCCAGAACCTTGTGC
Reverse: AGAGTGACGTCAATGCCTCG
Deltal1 (mouse)Forward: TGCTGGCTCAGGGAATACAC
Reverse: TGGTTTTGTCTTAAGCTTCTCTGG
Hes1 (mouse)Forward: CAACACGACACCGGACAAAC
Reverse: GGAATGCCGGGAGCTATCTT
Hes5 (mouse)Forward: AGAGCTCCAGCTGCGGAA
Reverse: GCGAAGGCTTTGCTGTGTTT
HERP (mouse)Forward: TGGATCACCAGTGTCTCCAAG
Reverse: GGATTCAGCACCCTTTGTGC
Gsk3β (mouse)Forward: GGAGTGCGGGTCTTCCG
Reverse: AGGTGTGTCTCGCCCATTTG
Wnt1 (mouse)Forward: CAGCAACCACAGTCGTCAGA
Reverse: TTCACGATGCCCCACCATC
Wnt3a (mouse)Forward: GCTACCCGATCTGGTGGTCC
Reverse: CAGAGAATGGGCTGAGTGCT
β-catenin (mouse)Forward: GTCAGTGCAGGAGGCCGA
Reverse: CTCCATCAGGTCAGCTTGAGT
C-myc (mouse)Forward: GTTGGAAACCCCGCAGACA
Reverse: CCAGATATCCTCACTGGGCG
Cyclin D1 (mouse)Forward: CAGCCCCAACAACTTCCTCT
Reverse: CAGGGCCTTGACCGGG
Cyclin D2 (mouse)Forward: AGTCCCGACTCCTAAGACCC
Reverse: CTACCAGTTCCCACTCCAGC
Wnt5a (mouse)Forward: CTCCGGCCCAGAAGCC
Reverse: TTGGAAGACATGGCACCTCC
PLC (mouse)Forward: CCTGAGGGCAAAAACAACCG
Reverse: CTTTCCCTCAGTGAGCCTGG
PKC (mouse)Forward: AAGGAGCATGCGTTTTTCCG
Reverse: GTCTCGCTTGTCTCTAGCTT
CAMKII (mouse)Forward: AAGCAGATGGAGTCAAGCCC
Reverse: TGCTGTCGGAAGATTCCAGG
β-actin (mouse)Forward: CACTGTCGAGTCGCGTCC
Reverse: TCATCCATGGCGAACTGGTG
miR-124 (mouse)Forward: ACACTCCAGCTGGGTAAGGCACGCGGTG
Reverse: TGGTGTCGTGGAGTCG
U6 (mouse)Forward: CTCGCTTCGGCAGCACA
Reverse: AACGCTTCACGAATTTGCGT
Effect of acupuncture on expression of miR-124 in the hippocampal tissue of SAMP8 mice after NSCs transplantation

RNA was extracted from the hippocampal tissue of mice in each experimental group. Stem-loop primers were used, and real-time quantitative PCR was performed using the absolute quantification 2-∆∆Ct method to detect miR-124 gene expression. C0 of the sample was calculated using a standard curve, and the ratio of the target gene C0 to U6 snRNA C0 directly reflected the difference in gene expression (Table 1).

Effects of acupuncture on interaction between Notch and Wnt signaling pathways and key molecule cyclin D1, cell cycle, and apoptosis

Mice in each experimental group were killed by cervical dislocation, and their whole brains were immediately removed and placed in ACSF (NaCl 124 mmol/L, KCl 3.5 mmol/L, NaH2PO4·2H2O 1.2 mmol/L, MgCl2·6H2O 1.3 mmol/L, CaCl2 2 mmol/L, NaHCO3 25 mmol/L, D-glucose 10 mmol/L). After cooling, the hippocampus was rapidly dissected, and 400-μm thick hippocampal slices were cut parallel to the hippocampal sulcal fibers. The hippocampal slices were placed in the upper chamber of the Transwell coculture system. BrdU-labeled NSCs (2 × 105/well) were seeded in good growth conditions in the lower chamber of the Transwell coculture system. BrdU-positive labeled NSCs were collected on day 7 and flow cytometry was used to detect expression of cyclin D1 protein, cell cycle status, and apoptosis.

Statistical analysis

Experimental data were expressed as mean ± SD and analyzed using SPSS 21.0 software. One-way ANOVA was used for multiple groups comparisons, and Student-Newman-Keuls test was used for pairwise comparisons. P < 0.05 was considered statistically significant.

RESULTS
Acupuncture regulation of NSCs effectively improves cognitive behavior in AD

After > 40 years of development, the Morris water maze has become a widely used tool for assessing spatial learning and memory. Decades of research have confirmed its effectiveness in evaluating hippocampus-dependent learning and memory[10]. This study used a 5-day Morris water maze training protocol to assess the spatial learning and memory abilities of SAMP8 mice. There were no significant differences in escape latency among the groups during the first 3 days (P > 0.05). From day 4 onwards, all intervention groups showed a significant reduction in escape latency compared to day 1 (P < 0.05), suggesting that the spatial memory effects of different interventions began to manifest from day 4 onwards. Compared to the RC group, the escape latency in the PC and PS groups significantly increased (P < 0.05). The NSCs transplantation groups (PT, PTA, and PTAH) showed a significant decrease in escape latency compared to the PC or PS groups (P < 0.05). There was a significant difference between the PTA and PTN groups (P < 0.05). Significant differences were observed between the PTA and PTAH groups and the PTAL group (P < 0.05). The NSCs transplantation groups showed significant behavioral improvements. The PTA group demonstrated superior cognitive enhancement. The PTAH group exhibited the optimal learning and memory capacity (Figure 3A-C).

Figure 3
Figure 3 Results of the water maze hidden platform test, Alzheimer’s disease pathological marker expression, and microRNA-124 gene expression. A-C: Water maze test results. The time from entering the water to finding the platform was recorded as the escape latency. If the mice did not find the platform within 90 seconds, the escape latency was recorded as 90 seconds; D-G: Alzheimer’s disease pathological marker expression; H: MicroRNA-124 gene expression. aP < 0.05, compared with the senescence-accelerated mice resistant 1 control group; bP < 0.05, compared with the senescence-accelerated mouse prone 8 control group; cP < 0.05, compared with the senescence-accelerated mouse prone 8-sham transplantation group; dP < 0.05, compared with the senescence-accelerated mouse prone 8-neural stem cells transplantation with non-acupoint group; eP < 0.05, compared with the senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 low expression group. RC: Senescence-accelerated mice resistant 1 control group; PC: Senescence-accelerated mouse prone 8 control group; PT: Senescence-accelerated mouse prone 8-neural stem cells transplantation group; PS: Senescence-accelerated mouse prone 8-sham transplantation group; PTA: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint group; PTN: Senescence-accelerated mouse prone 8-neural stem cells transplantation with non-acupoint group; PTAH: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 high expression group; PTAL: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 low expression group; PTAC: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 control group; Aβ: Amyloid β; APP: Amyloid precursor protein; P-Tau: Phosphorylated tau.

The study indicates that transplanting NSCs can improve cognitive function in AD mice; acupuncture can regulate exogenous NSCs to promote cognitive improvement in AD; and miR-124 can serve as a target for acupuncture to improve cognitive deficits in SAMP8 mice caused by hippocampal-dependent learning and spatial orientation impairments.

Acupuncture regulation of NSCs inhibits expression of AD pathological biomarkers

One characteristic feature of AD is the presence of neuritic plaques containing Aβ peptide. Aβ is produced through sequential proteolytic cleavage of APP by β- and γ-secretases. Aggregation of Aβ into amyloid plaques is considered a key pathogenic mechanism in AD[11]. In AD, the level of APP is closely related to pathogenesis. Overexpression of APP increases the risk of developing AD in the general population[12]; conversely, missense mutations in APP reduce β-secretase cleavage of APP, which may prevent cognitive decline associated with AD[13]. γ-secretase cleaves APP through two pathways, and its sustained synthesis capacity or cleavage activity determines the type of Aβ peptide, with the longest peptide being most prone to aggregation[14]. In the RC group, the activity of β- and γ-secretases, as well as protein expression of APP, Aβ40, and Aβ42, were lower than those in the PC and PS groups (P < 0.05). This indicated that low levels of APP protein and low activity of β- and γ-secretases in normal brain tissue lead to low levels of Aβ40 and Aβ42 protein expression. The NSCs transplantation groups (PT, PTA, PTN, PTAH, PTAL, and PTAC) also showed similar results to the PS or PC groups (P < 0.05). Compared to the PTN group, the β- and γ-secretase activities, as well as protein expression of APP, Aβ40, and Aβ42, were lower in the PTA group (P < 0.05). This indicates that exogenous NSCs can be regulated by acupuncture to inhibit APP protein production and β- and γ-secretase activity, thereby reducing Aβ40 and Aβ42 protein expression. Previous studies have shown that overexpression of miR-124 downregulates β-secretase expression[15], thereby inhibiting Aβ-induced neuronal toxicity[16]. In this study, compared with the PTAL group, the PTA, PTAH, and PTAC groups exhibited lower activity of β- and γ-secretases, as well as lower protein expression of APP, Aβ40, and Aβ42 (P < 0.05). This suggests that acupuncture upregulates miR-124 expression to inhibit APP protein expression and activity of β- and γ-secretases, thereby suppressing production of pathogenic Aβ and inhibiting Aβ-induced neuronal toxicity (Figure 3D-F).

Neuritic plaques are a hallmark pathological feature of AD. Aggregation of P-tau protein around Aβ deposits leads to neuronal swelling and nutritional deficiency, which are key characteristics of neuritic plaques[17]. Studies have shown that P-tau protein, as one of the pathological biomarkers of AD, maintains a low level in normal brain tissue[18], which is consistent with our findings. In this study, protein expression of P-tau in the RC group was lower than in the PC and PS groups (P < 0.05). In the NSCs transplantation groups (PT, PTA, PTN, PTAH, PTAL, and PTAC), P-tau protein expression was lower than in the PS or PC groups (P < 0.05), consistent with previous research findings[19]. P-tau protein expression in the PTA group was lower than in the PTN group (P < 0.05). The PTA, PTAH, and PTAC groups had lower P-tau protein expression than the PTAL group (P < 0.05). This indicated that exogenous NSCs were upregulated by acupuncture to increase miR-124 expression levels, thereby inhibiting P-tau production (Figure 3G).

This study confirms that acupuncture exerts its biological effects by upregulating miR-124 expression to inhibit APP protein expression and the activity of its cleavage enzymes (β- and γ-secretases) following exogenous NSCs transplantation, further suppressing generation of AD-characteristic pathological products (Aβ and P-Tau).

Acupuncture promotes expression of miR-124 in NSCs

miRNAs are noncoding small RNA molecules that play a crucial role in post-transcriptional gene regulation. They are involved in various biological processes, including synaptic development, maturation, and plasticity[20]. miRNAs regulate synaptic function by modulating expression of target genes involved in synaptic signaling, morphology, and plasticity[21]. Dysregulation of miRNA expression is associated with various neurodegenerative diseases, including AD, Parkinson’s disease, and ataxia[22]. In this study, adenovirus was used as a vector to transplant miR-124 into the hippocampus of AD mice. PCR-based detection of miR-124 gene expression showed significant differences between the PC and PS groups compared with the RC group (P < 0.05), indicating that miR-124 expression was elevated in normal brain tissue. The NSCs transplantation groups (RC, PT, PTA, PTN, PTAH, and PTAC) showed differences compared to the PC and PS groups (P < 0.05). This indicated that NSCs transplantation increased miR-124 expression in the brains of AD mice. Compared to PTN, PTA showed differences (P < 0.05); compared to PTAL, PTA, PTAH, and PTAC showed differences (P < 0.05). In normal brain tissue, expression of miR-124 was elevated; in AD brain tissue, miR-124 expression was suppressed. After NSCs transplantation, miR-124 expression showed an upward trend; acupuncture promoted miR-124 expression in NSCs (Figure 3H).

miR-124 targets expression of Notch and Wnt signaling pathway target genes

miR-124 plays a critical role in the nervous system by regulating synaptic morphology, neurotransmission, and neuronal development[23]. Through a search of the public data platform starBase database, it was found that through binding to the 3’ untranslated regions of target genes such as Notch1, Hes5, and GSK3β via its 5’ seed sequence, miR-124 induces transcriptional repression or mRNA degradation, thereby modulating the Notch and Wnt signaling pathways. Additionally, it exerts neuroprotective effects in conditions like AD and ischemic stroke by influencing autophagy, neuroinflammation, oxidative stress, neuronal excitability, neurogenesis, Aβ deposition, and tau phosphorylation[24,25]. In this study, expression patterns of Notch1, Hes5, and GSK3β showed consistent trends. Their expression levels were significantly higher in the PC and PS groups compared to the RC group (P < 0.05). By contrast, all NSCs transplantation groups (PT, PTA, PTN, PTAH, and PTAC) exhibited lower expression levels of these genes relative to that in the PC and PS groups (P < 0.05). The PTA group showed further reduction compared to the PTN group (P < 0.05), and PTAH and PTAC groups had significantly lower expression than the PTAL group (P < 0.05) (Figure 4A-C). These results suggest that miR-124 regulates the Notch and Wnt signaling pathways through targeting Notch1, Hes5, and GSK3β.

Figure 4
Figure 4 Expression of nestin, neuronal nuclear antigen, glial fibrillary acidic protein, Notch and Wnt signaling pathway proteins and genes. A: Notch homolog 1 and Delta-like 1 gene expression; B: Hairy and enhancer of split 1 and hairy and enhancer of split 5 gene expression; C: Glycogen synthase kinase 3β, Wingless-related integration site 1 (Wnt1), Wnt3a and β-catenin gene expression; D: Notch homolog 1 and Delta-like 1 protein expression; E: Hairy and enhancer of split 1 and hairy and enhancer of split 5 protein expression; F: Hairy/enhancer of split related protein expression; G: Hairy/enhancer of split related protein gene expression; H: Glycogen synthase kinase 3β, Wnt1, Wnt3a and β-catenin protein expression; I: Myc proto-oncogene, cell cycle protein D1 and cell cycle protein D2 protein expression; J: Myc proto-oncogene, cell cycle protein D1 and cell cycle protein D2 gene expression; K: Wnt5a, phospholipase C, protein kinase C and calmodulin-dependent protein kinase II protein expression; L: Wnt5a, phospholipase C, protein kinase C and calmodulin-dependent protein kinase II gene expression; M: Nestin, neuronal nuclear antigen, glial fibrillary acidic protein, Notch and Wnt signaling pathway protein expression; N: Nestin, neuronal nuclear antigen and glial fibrillary acidic protein expression. aP < 0.05, compared with the senescence-accelerated mice resistant 1 control group; bP < 0.05, compared with the senescence-accelerated mouse prone 8 control group; cP < 0.05, compared with the senescence-accelerated mouse prone 8-sham transplantation group; dP < 0.05, compared with the senescence-accelerated mouse prone 8-neural stem cells transplantation with non-acupoint group; eP < 0.05, compared with the senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 low expression group. RC: Senescence-accelerated mice resistant 1 control group; PC: Senescence-accelerated mouse prone 8 control group; PT: Senescence-accelerated mouse prone 8-neural stem cells transplantation group; PS: Senescence-accelerated mouse prone 8-sham transplantation group; PTA: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint group; PTN: Senescence-accelerated mouse prone 8-neural stem cells transplantation with non-acupoint group; PTAH: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 high expression group; PTAL: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 low expression group; PTAC: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 control group; Notch1: Notch homolog 1; Delta1: Delta-like 1; Hes1: Hairy and enhancer of split 1; Hes5: Hairy and enhancer of split 5; GSK3β: Glycogen synthase kinase 3β; Wnt1: Wingless-related integration site 1; Wnt3a: Wingless-related integration site 3a; HERP: Hairy/enhancer of split related protein; C-myc: Myc proto-oncogene; Cyclin D1: Cell cycle protein D1; Cyclin D2: Cell cycle protein D2; Wnt5a: Wingless-type integration site family member 5a; PLC: Phospholipase C; PKC: Protein kinase C; CamkII: Calcium/calmodulin-dependent protein kinase II; NeuN: Neuronal nuclear antigen; GFAP: Glial fibrillary acidic protein.
Acupuncture inhibits abnormal activation of the Notch signaling pathway in NSCs

miR-124 plays a key role in promoting the differentiation of NSCs into mature neurons and in neural system development[26]. Previous studies have shown that miR-124 promotes NSCs differentiation through the AAK1/Notch signaling pathway[27]. Activation of the Notch signaling pathway begins with binding of the receptor to the Delta ligand, followed by the release of NICD through γ-secretase-mediated proteolytic cleavage. Upon entering the nucleus, NICD binds to the CSL transcription factor, activating target genes such as the Hes/Hey family, thereby regulating the proliferation, differentiation, and apoptosis of NSCs[28]. In AD, the expression of Notch1 is upregulated[29], leading to abnormal activation of the Notch pathway[30]. We found that this pathway was abnormally activated under AD pathological conditions, and NSCs transplantation could be modulated by acupuncture intervention to upregulate miR-124 and regulate activation of the Notch pathway.

Notch1 protein levels were significantly higher in the PC and PS groups than in the RC group (P < 0.05). Notch1 expression levels were lower in the NSCs transplantation groups (PT, PTA, PTN, PTAH, and PTAC) than in the PC and PS groups. Notch1 expression levels were lower in the PTA group than in the PTN group. Notch1 expression levels in the PTA and PTAH groups were significantly lower than those in the PTAL group (P < 0.05), with the PTAH group showing the most significant regulatory effect. Delta1 ligand expression was abnormally elevated in the AD model, and we obtained similar results for Notch1, with the PTAH group effectively maintaining its physiological level (P < 0.05). These results suggest that the abnormal activation of the Notch-Delta signaling axis is an important mechanism underlying AD-related neural regeneration impairment (Figure 4D).

The expression patterns of downstream effector factors Hes1/5[31] and HERP[32] validated the above findings. Compared with the RC group, the protein and gene expression of Hes1, Hes5, and HERP were significantly upregulated in the PC and PS groups (P < 0.05), indicating that neurogenesis was inhibited. Compared with the PS or PC groups, the aforementioned indicators were significantly decreased in the NSCs transplantation groups (PT, PTA, PTN, PTAH, and PTAC) (P < 0.05). Compared with the PTN group, expression of Hes1 and Hes5 was lower in the PTA group (P < 0.05). There was no difference in HERP protein expression in the PTA group. Compared with the PTAL group, the PTA and PTAH groups exhibited the most significant regulatory effects (P < 0.05) (Figure 4B and E-G).

The results indicate that exogenous NSCs transplantation may directly reduce Notch signaling activity through a cell replacement effect. Acupuncture modulates the epigenetic regulation of NSCs by upregulating miR-124, inhibiting NICD nuclear translocation and target gene transcription, thereby effectively maintaining Notch pathway homeostasis. This dual regulatory mechanism promotes the differentiation of NSCs into functional neurons and glial cells, improving cognitive function in AD models.

This study demonstrates that miR-124 is a key molecular node linking acupuncture with Notch signaling regulation. Upregulation of miR-124 by acupuncture to inhibit Notch pathway homeostasis in NSCs may serve as an important target for reversing neural regeneration deficits in AD.

Acupuncture effectively activates classic and non-classic Wnt signaling pathways

Previous studies have shown that miR-124 activates the Wnt/β-catenin pathway by targeting DACT1, promoting proliferation and inducing NSCs to differentiate into neurons[33]. When the Wnt signaling pathway is activated, Wnt proteins bind to Fz receptors and lipoprotein receptor-related protein 5/6, leading to activation of Dvl proteins. Activated Dvl proteins inhibit the activity of GSK3β, thereby preventing the phosphorylation and degradation of β-catenin. β-catenin accumulates in the cytoplasm and enters the nucleus. In the nucleus, β-catenin binds to transcription factors of the T-cell factor/Lymphoid enhancer factor family, activating the transcription of downstream target genes (e.g., c-myc, cyclin D1, cyclin D2, etc.). These target genes include those related to cell proliferation, differentiation, and the maintenance of stem cell properties. In this study, protein and gene expression of GSK3β, c-Myc, Wnt1, Wnt3a, β-catenin, cyclin D1, and cyclin D2 in the PC and PS groups differed from those in the RC group (P < 0.05), indicating that Wnt/β-catenin pathway activation is inhibited in the AD model, consistent with previous findings[34]. Wnt/β-catenin signaling is essential for NSCs homeostasis, and stimulating Wnt/β-catenin signaling exerts dose-dependent and state-specific effects on NSCs, which may aid in regulating adult hippocampal neurogenesis in response to external stimuli[35]. This study obtained similar results, with NSCs transplantation groups (PT, PTA, PTAH, and PTAC) activating Wnt/β-catenin signaling (P < 0.05). The PTA group enhanced Wnt/β-catenin signaling activation compared to the PTN group (P < 0.05), promoting NSCs proliferation and differentiation. Studies have shown that miR-124 exerts neuroprotective effects by inhibiting Axin1 and activating the Wnt/β-catenin signaling pathway[36]. Further studies have indicated that miR-124 overexpression enhances expression of β-catenin and cyclin D1 while reducing the binding of DACT1 and GSK3β antagonists at both the mRNA and protein levels[37]. These changes promote NSCs proliferation and induce their neuronal-specific differentiation. In our study, PCR and western blotting showed that compared with the PTAL group, the PTAH group inhibited GSK3β and activated Wnt/β-catenin signaling (P < 0.05). The results indicate that acupuncture upregulates miR-124 expression, inhibits GSK3β production, releases β-catenin, activates the Wnt/β-catenin pathway, and promotes NSCs proliferation and neural differentiation (Figure 4C and H-J).

Members of the Wnt family, such as Wnt5a, regulate cell cycle proteins through the Ca2+ pathway in an autonomous manner, modulating neuronal cell cycle activation[38] and influencing synaptic function and the outcome of neuroinflammation[39]. When the Wnt/Ca2+ pathway is activated, Wnt5a binds to Frizzled on the cell membrane, activating PLC. PLC promotes calcium ion generation, which further activates CAMKII, CaN, and PKC. CaN dephosphorylates NFAT, and NFAT influences DNA transcription. The Wnt/Ca2+ signaling pathway plays an important role in cell adhesion and movement[40]. In this study, the protein and gene expression levels of Wnt5a, PLC, PKC, and CAMKII in the PC and PS groups were lower than those in the RC group (P < 0.05). Protein and gene expression levels of Wnt5a, PLC, PKC, and CAMKII in the NSCs transplantation groups (PT, PTA, PTAH, and PTAC) were higher than those in the PS and PC groups (P < 0.05). Compared with the PTN group, the gene expression levels of Wnt5a, PLC, PKC, and CAMKII were higher in the PTA group (P < 0.05), while there was no difference in protein expression levels. Compared with PTAL, the gene expression of Wnt5a was higher in the PTA, PTAH, and PTAC groups (P < 0.05), and protein levels of Wnt5a were higher in the PTAH group (P < 0.05). Protein expression of PLC was significantly higher in the PTA, PTAH, and PTAC groups (P < 0.05). Gene expression of PLC was significantly higher in the PTA and PTAH groups (P < 0.05). Protein and gene expression of PKC and CAMKII was significantly higher in the PTA, PTAH, and PTAC groups (P < 0.05). The results indicate that the Wnt/Ca2+ pathway is inhibited in AD; after NSCs transplantation, the Wnt/Ca2+ pathway is activated; acupuncture upregulates miR-124 expression to activate the Wnt/Ca2+ pathway in NSCs, thereby regulating their proliferation and differentiation (Figure 4K and L).

In AD, the Wnt/β-catenin and Wnt/Ca2+ pathways are suppressed and activated. Exogenous NSCs transplantation can activate the Wnt/β-catenin and Wnt/Ca2+ pathways, further demonstrating that: Acupuncture upregulates expression of miR-124; activating the Wnt/β-catenin and Wnt/Ca2+ pathways in NSCs, regulating their cell cycle and apoptosis, promoting their proliferation, differentiation, and migration; repairing damaged tissue cells in the hippocampus; alleviating neuronal damage in AD; and improving cognition.

Acupuncture regulates expression of the interacting protein cyclin D1 and cell proliferation in NSCs

The Notch signaling pathway primarily maintains NSCs in a quiescent/selfrenewing state by inhibiting the differentiation of neural progenitors through Hes1/5. In contrast, the Wnt pathway, especially the canonical branch, tends to promote proliferation and neuronal differentiation, sustaining active neurogenesis in the adult hippocampus and subventricular zone. These two pathways intertwine spatially and temporally to shape the NSCs niche, thereby determining whether cells retain stemness, enter the cell cycle, or differentiate into specific neuronal or glial lineages. Cyclin D1 plays a pivotal role in Notch and Wnt signal transduction. NICD and β-catenin in the Wnt signaling pathway share common regions, enabling the Notch signaling pathway to activate the downstream cyclin D1-mediated cell-cycle-related proliferation and apoptosis in the Wnt/β-catenin signaling pathway[41], thereby influencing the biological functions of NSCs. To investigate the interaction between the Notch and Wnt signaling pathways, we used a Transwell coculture system to cultivate cells from different groups and flow cytometry to detect expression of the key molecule cyclin D1. Cyclin D1 expression was lower in the PC and PS groups than in the RC group (P < 0.05). NSCs transplantation groups (PT, PTA, PTN, PTAH, PTAL, and PTAC) exhibited higher cyclin D1 expression than the PC and PS groups (P < 0.05). Compared with the PTN group, the PTA group showed higher cyclin D1 protein expression (P < 0.05). Compared with the PTAL group, expression of cyclin D1 was higher in the PTA, PTAH, and PTAC groups (P < 0.05). The results indicate that NSCs transplantation regulates the interaction between the Notch and Wnt dual signaling pathways to modulate expression of cyclin D1. Acupuncture may regulate the dual signaling pathways of NSCs to promote cyclin D1 protein expression, with miR-124 acting as a target of the dual signaling pathways in NSCs to promote cyclin D1 protein expression. In summary, acupuncture may upregulate miR-124 to regulate the Notch and Wnt dual signaling pathways in NSCs, achieving interaction between the two pathways and promoting cyclin D1 protein expression (Figure 5A and B).

Figure 5
Figure 5 Expression of the interacted protein cyclin D1 and cell proliferation results. A: Cell cycle protein D1 flow cytometry results; B: Cell cycle protein D1 expression; C: Cell cycle flow cytometry results; D: Cell cycle proliferation index; E: G0/G1 results; F: G2/M results; G: S results; H: Nucleotides percentage; I: Cell apoptosis flow cytometry results; J: Apoptosis rate. aP < 0.05, compared with the senescence-accelerated mice resistant 1 control group; bP < 0.05, compared with the senescence-accelerated mouse prone 8 control group; cP < 0.05, compared with the senescence-accelerated mouse prone 8-sham transplantation group; dP < 0.05, compared with the senescence-accelerated mouse prone 8-neural stem cells transplantation with non-acupoint group; eP < 0.05, compared with the senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 low expression group. RC: Senescence-accelerated mice resistant 1 control group; PC: Senescence-accelerated mouse prone 8 control group; PT: Senescence-accelerated mouse prone 8-neural stem cells transplantation group; PS: Senescence-accelerated mouse prone 8-sham transplantation group; PTA: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint group; PTN: Senescence-accelerated mouse prone 8-neural stem cells transplantation with non-acupoint group; PTAH: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 high expression group; PTAL: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 low expression group; PTAC: Senescence-accelerated mouse prone 8-neural stem cells transplantation with acupoint and microRNA-124 control group.

Cyclin D1 is a key mediator of cell cycle progression and the primary cyclin involved in the transition from G1 to S phase[42]. The interphase of cell division is divided into the resting phase (G0), pre-DNA synthesis phase (G1), DNA synthesis phase (S), and post-DNA synthesis phase (G2). Generally, the stronger the cell proliferative capacity, the smaller the G1 phase and the larger the G2/(M + S) phases[43]. To investigate the proliferation and apoptosis of NSCs, we used a Transwell coculture system to cultivate cells from different groups and flow cytometry to detect the cell cycle and apoptosis. The proportion of cells in the G0/G1 phase was higher in the PC and PS groups than in the RC group (P < 0.05). The proportion of cells in the G2/(M + S) phase was lower in the PC and PS groups than in the RC group (P < 0.05). In the NSCs transplantation groups (PT, PTA, PTN, PTAH, PTAL, and PTAC), the proportion of cells in the G0/G1 phase was lower than that in the PC and PS groups (P < 0.05). The proportion of cells in the G2/(M + S) phases was higher than that in the PC and PS groups (P < 0.05). Compared with the PTN group, the PTA group had a higher proportion of cells in the G2/(M + S) phases (P < 0.05), with no difference in the proportion of cells in the G0/G1 phase. Compared with the PTAL group, the PTA, PTAH, and PTAC groups had a lower proportion of cells in the G0/G1 phase (P < 0.05) and a higher proportion of cells in the G2/(M + S) phases (P < 0.05). The results indicate that in AD brains, the cell cycle is in a silenced state; exogenous NSCs transplantation can activate the cell cycle; and acupuncture upregulates miR-124 to regulate the cell cycle of exogenous NSCs (Figure 5C-H). In summary, in AD brains, most neurons are in a state of silence, do not proliferate, and undergo massive apoptosis. After NSCs transplantation, the cell cycle is active, cell proliferation is increased, and apoptosis is reduced. Acupuncture upregulates miR-124, which activates the cell cycle of NSCs, promotes NSCs proliferation, and inhibits cell apoptosis (Figure 5I and J).

Acupuncture promotes NSCs differentiation

We investigated the differentiation of exogenous NSCs. Hippocampal tissue was collected from mice, and western blotting was performed to detect expression of Nestin, NeuN, and GFAP. Protein expression of nestin, NeuN, and GFAP in the PC and PS groups was lower than in the RC group (P < 0.05). In the NSCs transplantation groups (PT, PTA, PTAH, and PTAC), protein expression of nestin, NeuN, and GFAP was higher than in the PS and PC groups (P < 0.05). Compared with the PTN group, the PTA group had higher protein expression of nestin and NeuN (P < 0.05), while there was no difference in GFAP protein expression. Compared with the PTAL group, the PTA, PTAH, and PTAC groups had higher protein expression of nestin, NeuN, and GFAP (P < 0.05) (Figure 4M and N). The results indicate that exogenous NSCs transplanted into the brain can proliferate and differentiate into neurons and glial cells. Acupuncture can regulate and promote neuronal differentiation, and upregulation of miR-124 has a positive effect on the proliferation and differentiation of NSCs into neurons and glial cells.

The results of NSCs proliferation and differentiation indicate that exogenous NSCs transplantation can initiate neurogenesis/differentiation cascades; acupuncture upregulates miR-124 to regulate neurogenesis and differentiation of NSCs; and miR-124 has a positive regulatory effect on neurogenesis, neuronal differentiation, and glial differentiation.

DISCUSSION

SAMP8 mice exhibit significant deterioration in learning and memory abilities, as their pathological features, including Aβ deposition, tau protein hyperphosphorylation, and neurotransmitter alterations, are similar to those observed in human AD, making SAMP8 an ideal model for AD research[44]. SAMP8 mice exhibit cognitive impairment, such as prolonged escape latency and reduced platform recognition ability in the Morris water maze test[45], which is consistent with our results. In addition to serving as an animal model for neurodegenerative diseases, studies have shown that knee joint tissues in SAMP8 mice begin to exhibit spontaneous osteoarthritis-like changes at 14 weeks of age, such as loss of cartilage proteoglycans and cartilage fibrosis, with the severity of spontaneous osteoarthritis being significantly higher than in SAMR1 mice[46]. Both SAMP8 and SAMP6 mice exhibit reduced skeletal muscle mass and strength, but the typical features of muscle aging in SAMP8 mice appear at twice the rate as those in SAMP6 mice. Therefore, SAMP8 mice are a better animal model for sarcopenia than SAMP6 mice[47]. SAMP8 mice have broader application prospects beyond the nervous system.

The pathological process of AD leads to neuronal loss in the brain, particularly in the hippocampus and basal forebrain cholinergic neurons. Enhancing hippocampal neurogenesis can prevent AD pathology and improve memory deficit[48]. Neurogenesis in the adult hippocampus persists throughout the mammalian lifespans. Neurogenesis is primarily concentrated in the subgranular zone of the hippocampus and the subventricular zone of the lateral ventricles[49]. Exogenous NSCs can directly replace damaged or deceased neurons or other cells in the brains of AD patients and integrate into the host neuronal network[50]. They can inhibit amyloid plaque formation, prevent neurotoxicity, and help prevent further tissue damage, thereby enhancing the endogenous repair mechanisms of AD. Studies have shown that exogenous NSCs not only increase neuronal numbers but also promote synaptic recovery to reconstruct functional neuronal circuits[51]. Our results show that, after NSCs are transplanted into specific regions of the hippocampus, the production of AD-specific pathological products is inhibited, while proliferation and differentiation of functional neurons are promoted, suppressing neurotoxicity and inflammation, and improving AD progression. The results of the water maze test also indicate that, after NSCs transplantation, the spatial recognition and cognitive behavior of AD mice are significantly improved. Although NSCs exhibit promising therapeutic potential, limitations such as insufficient differentiation of transplanted NSCs, unsuccessful integration of transplanted cells with endogenous neurons[52], immune rejection effects of exogenous transplanted cells, and the “one-time” effect[53] of NSCs pose challenges to their clinical application. However, extracellular vesicles derived from NSCs are gaining increasing attention as an alternative therapy to NSCs[54-56]. Extracellular vesicles have low immunogenicity[57] and can more easily cross the blood-brain barrier; they promote neurogenesis and neuroprotection while enhancing the therapeutic efficacy of NSCs transplantation[58]; they are easy to store and transport, exhibit good stability in vitro and in vivo, and are unlikely to cause tumorigenesis or malignant transformation[59]; promote cerebral angiogenesis; regulate inflammation; and target specific cell types and tissues to enhance therapeutic effects[60]. Therefore, NSCs-derived extracellular vesicles hold promising application prospects.

Previous findings from our research team have confirmed that the number and density of synapses in the brain microenvironment of SAMP8 mice are reduced. Although exogenous NSCs can promote the proliferation and differentiation of NSCs, facilitating the recovery of damaged neurons and achieving neural regeneration and synaptogenesis, the proliferation of NSCs is limited by the brain microenvironment[61]. Research indicates that acupuncture may promote the proliferation and differentiation of NSCs by improving the brain microenvironment; however, the specific mechanisms through which acupuncture acts on the brain microenvironment remain unclear. Extracellular fluid constitutes the direct environment for the survival of neurons and glial cells, primarily composed of cerebrospinal fluid (CSF) and brain interstitial fluid. Brain interstitial fluid promotes the regeneration and repair of neural cells by providing growth factors and nutrients. Neurotrophic factors, such as nerve growth factor, brain-derived neurotrophic factor, and vascular endothelial growth factor in CSF can stimulate the repair and reconstruction of damaged neurons[62]. These factors promote neuronal survival and differentiation and activate endogenous stem cells, thereby enhancing neural plasticity and the formation of neural circuits. CSF comes into contact with immature neurons that possess NSCs characteristics, which can proliferate and differentiate into various types of neurons, thereby significantly promoting the repair of neuronal damage[63]. Additionally, directly injecting young CSF into an aged brain can improve memory function[64]. Therefore, further exploring the mechanisms underlying the role of the brain microenvironment in AD represents an intriguing research direction.

In the brain microenvironment, miRNAs exist in various forms. miRNAs are primarily found in the cytoplasm, where they bind to the RISC complex to regulate expression of target genes. miR-9-3p regulates synaptic plasticity and memory by downregulating the genes Dmd and SAP97, which are associated with long-term potentiation[65]. miRNAs enter the extracellular environment via extracellular vesicles or active release. In CSF, miRNAs often exist in complex forms with proteins, resisting RNAse degradation, and exhibit high stability and conservation[66]. miRNA expression exhibits significant differences across various brain regions and developmental stages. miR-9 regulates the proliferation and differentiation of neural progenitor cells during embryonic development, while miR-124, one of the most abundant miRNAs in the brain[67], plays a key role in neuronal maturation and serves as a critical participant in brain development and function. Overexpression of miR-124 improves neurological deficits and motor dysfunction in model rats[68], and inhibition of miR-124 expression leads to impaired hippocampal neurogenesis and metabolic dysfunction in developing neurons[69]. These are consistent with the results of our study. During embryonic development and NSCs differentiation, miRNAs influence neuronal generation and differentiation by regulating transcription factors and signaling pathways. For example, miR-486-5p influences neurogenesis by regulating transcription factors such as SOX2 and SOX9; miR-137 influences neuronal fate determination by regulating the Notch signaling pathway; and miR-17 influences neuronal proliferation and differentiation by regulating the Wnt signaling pathway[70]. Therefore, the diverse forms and complex mechanisms of action of miRNAs are of importance for elucidating the underlying mechanisms of AD.

miRNA can simultaneously regulate the Notch and Wnt signaling pathways[71]. The interaction between the Notch and Wnt signaling pathways is both synergistic[72] and antagonistic[73], as demonstrated in our study. For example, the group receiving NSCs transplantation regulated the Notch and Wnt signaling pathways. We also showed that acupuncture upregulated miR-124, inhibiting the abnormal activation of Notch in NSCs, and activated the Wnt signaling pathway, promoting the differentiation of NSCs into neurons and glial cells, thereby performing their respective functions and slowing the progression of AD, demonstrating a synergistic effect. However, compared to the normal group, the model group exhibited abnormal activation of the Notch signaling pathway and inhibition of the Wnt pathway, with no significant proliferation or differentiation of NSCs, accumulation of pathological products, severe neuronal damage, and rapid progression of AD, reflecting an antagonistic effect. This suggests that acupuncture upregulates miR-124 to promote the beneficial development of the Notch and Wnt signaling pathways in NSCs.

Our study provides key data supporting combined acupuncture and NSCs transplantation for AD therapy. Future work will translate mouse acupuncture protocols to humans and explore immunological aspects of NSCs grafts. We will also assess clinical limitations of miRNA-based regulation. Acupuncture stimulates meridians, modulating the neuro-endocrine-immune network to create a favorable microenvironment that enhances NSCs survival, migration, and differentiation. Refining the dose-effect relationship (intensity, frequency, and duration) will enable standardized, reproducible acupuncture protocols for trials. Although NSCs have low immunogenicity, allogeneic sources and delivery routes may still trigger rejection; thus, selecting optimal cell sources (embryonic/fetal, induced pluripotent stem cell-derived, or immortalized lines), optimizing administration (intrathecal and intranasal) and implementing comprehensive immune monitoring are essential for safety and efficacy[74]. miRNA offers multitarget regulation but faces challenges in delivery, stability, off-target effects, immunogenicity, clinical validation, assay standardization, and regulatory approval[75,76]. Advancing novel delivery platforms (targeted nanoparticles and exosome carriers), precise target prediction, rigorous trial designs, and clear regulatory pathways will be critical for translating miRNA-based strategies into safe, effective clinical therapies.

CONCLUSION

Acupuncture may upregulate expression of miR-124 in NSCs to regulate the Notch and Wnt signaling pathways; promote the proliferation and differentiation of exogenous NSCs; increase the number of neurons and glial cells; repair or clear damaged cells; reduce neuroinflammation; prevent neurotoxicity; integrate neural circuits; restore neural function; improve cognition; and slow the onset and progression of AD.

References
1.  2024 Alzheimer's disease facts and figures. Alzheimers Dement. 2024;20:3708-3821.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 20]  [Cited by in RCA: 1454]  [Article Influence: 727.0]  [Reference Citation Analysis (0)]
2.  Boese AC, Hamblin MH, Lee JP. Neural stem cell therapy for neurovascular injury in Alzheimer's disease. Exp Neurol. 2020;324:113112.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 68]  [Article Influence: 9.7]  [Reference Citation Analysis (0)]
3.  Deng W, Aimone JB, Gage FH. New neurons and new memories: how does adult hippocampal neurogenesis affect learning and memory? Nat Rev Neurosci. 2010;11:339-350.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1633]  [Cited by in RCA: 1598]  [Article Influence: 99.9]  [Reference Citation Analysis (0)]
4.  Zhao L, Liu JW, Kan BH, Shi HY, Yang LP, Liu XY. Acupuncture accelerates neural regeneration and synaptophysin production after neural stem cells transplantation in mice. World J Stem Cells. 2020;12:1576-1590.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 21]  [Article Influence: 3.5]  [Reference Citation Analysis (1)]
5.  Xu J, Zheng Y, Wang L, Liu Y, Wang X, Li Y, Chi G. miR-124: A Promising Therapeutic Target for Central Nervous System Injuries and Diseases. Cell Mol Neurobiol. 2022;42:2031-2053.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 30]  [Article Influence: 7.5]  [Reference Citation Analysis (0)]
6.  Konrad KD, Song JL. microRNA-124 regulates Notch and NeuroD1 to mediate transition states of neuronal development. Dev Neurobiol. 2023;83:3-27.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 9]  [Reference Citation Analysis (0)]
7.  Zhang F, Yao Y, Miao N, Wang N, Xu X, Yang C. Neuroprotective effects of microRNA 124 in Parkinson's disease mice. Arch Gerontol Geriatr. 2022;99:104588.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 20]  [Article Influence: 5.0]  [Reference Citation Analysis (0)]
8.  Channakkar AS, D'Souza L, Kumar A, Kalia K, Prabhu S, Phalnikar K, Reddy PC, Muralidharan B. LSD1 Regulates Neurogenesis in Human Neural Stem Cells Through the Repression of Human-Enriched Extracellular Matrix and Cell Adhesion Genes. Stem Cells. 2024;42:128-145.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 2]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
9.  Aghaizu ND, Jin H, Whiting PJ. Dysregulated Wnt Signalling in the Alzheimer's Brain. Brain Sci. 2020;10:902.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 29]  [Cited by in RCA: 46]  [Article Influence: 7.7]  [Reference Citation Analysis (0)]
10.  Othman MZ, Hassan Z, Che Has AT. Morris water maze: a versatile and pertinent tool for assessing spatial learning and memory. Exp Anim. 2022;71:264-280.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 241]  [Article Influence: 60.3]  [Reference Citation Analysis (0)]
11.  Hur JY. γ-Secretase in Alzheimer's disease. Exp Mol Med. 2022;54:433-446.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 200]  [Article Influence: 50.0]  [Reference Citation Analysis (0)]
12.  Rahmati M, Chebli J, Kumar Banote R, Roselli S, Agholme L, Zetterberg H, Abramsson A. Fine-Tuning Amyloid Precursor Protein Expression through Nonsense-Mediated mRNA Decay. eNeuro. 2024;11:ENEURO.0034-ENEU24.2024.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
13.  Hung C, Fertan E, Livesey FJ, Klenerman D, Patani R. APP antisense oligonucleotides reduce amyloid-β aggregation and rescue endolysosomal dysfunction in Alzheimer's disease. Brain. 2024;147:2325-2333.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 19]  [Article Influence: 9.5]  [Reference Citation Analysis (0)]
14.  Potier MC, Steiner H, Chávez-Gutiérrez L. Amyloid β, γ-secretase, and familial Alzheimer's disease. Lancet Neurol. 2024;23:852-853.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 3]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
15.  Ouyang Q, Liu K, Zhu Q, Deng H, Le Y, Ouyang W, Yan X, Zhou W, Tong J. Brain-Penetration and Neuron-Targeting DNA Nanoflowers Co-Delivering miR-124 and Rutin for Synergistic Therapy of Alzheimer's Disease. Small. 2022;18:e2107534.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 64]  [Article Influence: 16.0]  [Reference Citation Analysis (0)]
16.  Al-Sawasany AS, Fayed HM, Mahmoud BF, Elblehi SS, Ghazal NA. Evaluation of the Neurotherapeutic Effect of Quercetin on Neuronal miR-124 and β-Site Amyloid Precursor Protein Cleaving Enzyme 1 (BACE1) in an Experimental Alzheimer's Disease Model. J Biochem Mol Toxicol. 2025;39:e70290.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
17.  Leyns CEG, Gratuze M, Narasimhan S, Jain N, Koscal LJ, Jiang H, Manis M, Colonna M, Lee VMY, Ulrich JD, Holtzman DM. TREM2 function impedes tau seeding in neuritic plaques. Nat Neurosci. 2019;22:1217-1222.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 200]  [Cited by in RCA: 230]  [Article Influence: 32.9]  [Reference Citation Analysis (0)]
18.  Jia J, Ning Y, Chen M, Wang S, Yang H, Li F, Ding J, Li Y, Zhao B, Lyu J, Yang S, Yan X, Wang Y, Qin W, Wang Q, Li Y, Zhang J, Liang F, Liao Z, Wang S. Biomarker Changes during 20 Years Preceding Alzheimer's Disease. N Engl J Med. 2024;390:712-722.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 147]  [Cited by in RCA: 263]  [Article Influence: 131.5]  [Reference Citation Analysis (1)]
19.  Lin L, Li J, Yu Z, He J, Li Y, Jiang J, Xia Y. Nrf2 activator tertiary butylhydroquinone enhances neural stem cell differentiation and implantation in Alzheimer's disease by boosting mitochondrial function. Brain Res. 2025;1849:149341.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 8]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
20.  Dalal S, Ramirez-Gomez J, Sharma B, Devara D, Kumar S. MicroRNAs and synapse turnover in Alzheimer's disease. Ageing Res Rev. 2024;99:102377.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 16]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
21.  Kumar S, Reddy PH. The role of synaptic microRNAs in Alzheimer's disease. Biochim Biophys Acta Mol Basis Dis. 2020;1866:165937.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 54]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
22.  Juźwik CA, S Drake S, Zhang Y, Paradis-Isler N, Sylvester A, Amar-Zifkin A, Douglas C, Morquette B, Moore CS, Fournier AE. microRNA dysregulation in neurodegenerative diseases: A systematic review. Prog Neurobiol. 2019;182:101664.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 169]  [Cited by in RCA: 342]  [Article Influence: 48.9]  [Reference Citation Analysis (0)]
23.  Ghafouri-Fard S, Shoorei H, Bahroudi Z, Abak A, Majidpoor J, Taheri M. An update on the role of miR-124 in the pathogenesis of human disorders. Biomed Pharmacother. 2021;135:111198.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 57]  [Article Influence: 11.4]  [Reference Citation Analysis (0)]
24.  Wang Q, Huang X, Su Y, Yin G, Wang S, Yu B, Li H, Qi J, Chen H, Zeng W, Zhang K, Verkhratsky A, Niu J, Yi C. Activation of Wnt/β-catenin pathway mitigates blood-brain barrier dysfunction in Alzheimer's disease. Brain. 2022;145:4474-4488.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 146]  [Reference Citation Analysis (0)]
25.  Liu X, Feng Z, Du L, Huang Y, Ge J, Deng Y, Mei Z. The Potential Role of MicroRNA-124 in Cerebral Ischemia Injury. Int J Mol Sci. 2019;21:120.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 30]  [Cited by in RCA: 76]  [Article Influence: 10.9]  [Reference Citation Analysis (0)]
26.  Hou Y, Chen M, Yang L, Lee KB. Real-Time Intracellular Monitoring of miRNA Dynamics during Induced Pluripotent Stem Cell Neuronal Differentiation via Plasmon-Enhanced Nanobiosensing. Nano Lett. 2025;25:10402-10411.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 2]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
27.  Song Y, Shi R, Liu Y, Cui F, Han L, Wang C, Chen T, Li Z, Zhang Z, Tang Y, Yang GY, Guan Y. M2 Microglia Extracellular Vesicle miR-124 Regulates Neural Stem Cell Differentiation in Ischemic Stroke via AAK1/NOTCH. Stroke. 2023;54:2629-2639.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 43]  [Reference Citation Analysis (0)]
28.  Jha NK, Chen WC, Kumar S, Dubey R, Tsai LW, Kar R, Jha SK, Gupta PK, Sharma A, Gundamaraju R, Pant K, Mani S, Singh SK, Maccioni RB, Datta T, Singh SK, Gupta G, Prasher P, Dua K, Dey A, Sharma C, Mughal YH, Ruokolainen J, Kesari KK, Ojha S. Molecular mechanisms of developmental pathways in neurological disorders: a pharmacological and therapeutic review. Open Biol. 2022;12:210289.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 32]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
29.  Qiao Y, Mei Y, Xia M, Luo D, Gao L. The role of m6A modification in the risk prediction and Notch1 pathway of Alzheimer's disease. iScience. 2024;27:110235.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 9]  [Reference Citation Analysis (0)]
30.  Hurley EM, Mozolewski P, Dobrowolski R, Hsieh J. Familial Alzheimer's disease-associated PSEN1 mutations affect neurodevelopment through increased Notch signaling. Stem Cell Reports. 2023;18:1516-1533.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 24]  [Article Influence: 8.0]  [Reference Citation Analysis (0)]
31.  Hu N, Zou L. Multiple functions of Hes genes in the proliferation and differentiation of neural stem cells. Ann Anat. 2022;239:151848.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 18]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
32.  Iso T, Kedes L, Hamamori Y. HES and HERP families: multiple effectors of the Notch signaling pathway. J Cell Physiol. 2003;194:237-255.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 942]  [Cited by in RCA: 962]  [Article Influence: 41.8]  [Reference Citation Analysis (0)]
33.  Gizak A, Duda P, Pielka E, McCubrey JA, Rakus D. GSK3 and miRNA in neural tissue: From brain development to neurodegenerative diseases. Biochim Biophys Acta Mol Cell Res. 2020;1867:118696.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 22]  [Article Influence: 3.7]  [Reference Citation Analysis (0)]
34.  Liu J, Wei AH, Liu TT, Ji XH, Zhang Y, Yan F, Chen MX, Hu JB, Zhou SY, Shi JS, Jin H, Jin F. Icariin ameliorates glycolytic dysfunction in Alzheimer's disease models by activating the Wnt/β-catenin signaling pathway. FEBS J. 2024;291:2221-2241.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 18]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
35.  Austin SHL, Gabarró-Solanas R, Rigo P, Paun O, Harris L, Guillemot F, Urbán N. Wnt/β-catenin signalling is dispensable for adult neural stem cell homeostasis and activation. Development. 2021;148:dev199629.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 31]  [Article Influence: 6.2]  [Reference Citation Analysis (0)]
36.  Azam HMH, Rößling RI, Geithe C, Khan MM, Dinter F, Hanack K, Prüß H, Husse B, Roggenbuck D, Schierack P, Rödiger S. MicroRNA biomarkers as next-generation diagnostic tools for neurodegenerative diseases: a comprehensive review. Front Mol Neurosci. 2024;17:1386735.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 22]  [Reference Citation Analysis (0)]
37.  Zheng Y, Huang Z, Xu J, Hou K, Yu Y, Lv S, Chen L, Li Y, Quan C, Chi G. MiR-124 and Small Molecules Synergistically Regulate the Generation of Neuronal Cells from Rat Cortical Reactive Astrocytes. Mol Neurobiol. 2021;58:2447-2464.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 18]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
38.  Zhou L, Chen D, Huang XM, Long F, Cai H, Yao WX, Chen ZC, Liao ZJ, Deng ZZ, Tan S, Shan YL, Cai W, Wang YG, Yang RH, Jiang N, Peng T, Hong MF, Lu ZQ. Wnt5a Promotes Cortical Neuron Survival by Inhibiting Cell-Cycle Activation. Front Cell Neurosci. 2017;11:281.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 13]  [Cited by in RCA: 16]  [Article Influence: 1.8]  [Reference Citation Analysis (0)]
39.  Arredondo SB, Valenzuela-Bezanilla D, Mardones MD, Varela-Nallar L. Role of Wnt Signaling in Adult Hippocampal Neurogenesis in Health and Disease. Front Cell Dev Biol. 2020;8:860.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 66]  [Cited by in RCA: 118]  [Article Influence: 19.7]  [Reference Citation Analysis (0)]
40.  Bengoa-Vergniory N, Kypta RM. Canonical and noncanonical Wnt signaling in neural stem/progenitor cells. Cell Mol Life Sci. 2015;72:4157-4172.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 122]  [Cited by in RCA: 124]  [Article Influence: 11.3]  [Reference Citation Analysis (0)]
41.  Aguirre A, Rubio ME, Gallo V. Notch and EGFR pathway interaction regulates neural stem cell number and self-renewal. Nature. 2010;467:323-327.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 385]  [Cited by in RCA: 370]  [Article Influence: 23.1]  [Reference Citation Analysis (0)]
42.  Wang J, Su W, Zhang T, Zhang S, Lei H, Ma F, Shi M, Shi W, Xie X, Di C. Aberrant Cyclin D1 splicing in cancer: from molecular mechanism to therapeutic modulation. Cell Death Dis. 2023;14:244.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 69]  [Reference Citation Analysis (0)]
43.  Yao Y, Liu C, Wang B, Guan X, Fang L, Zhan F, Sun H, Li H, Lou C, Yan F, Lu X, Cui L, Liao Y, Han S, Yao Y, Zhang Y. HOXB9 blocks cell cycle progression to inhibit pancreatic cancer cell proliferation through the DNMT1/RBL2/c-Myc axis. Cancer Lett. 2022;533:215595.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 35]  [Article Influence: 8.8]  [Reference Citation Analysis (0)]
44.  Ong J, Sasaki K, Ferdousi F, Suresh M, Isoda H, Szele FG. Senescence accelerated mouse-prone 8: a model of neuroinflammation and aging with features of sporadic Alzheimer's disease. Stem Cells. 2025;43:sxae091.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 9]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
45.  Liu S, Song X, Sun Y, Sun A, Li Y, Li Y, Chen J. Kai-Xin-San ameliorates mild cognitive impairment in SAMP8 mice by inhibiting neuroinflammation and pyroptosis via NLRP3/Caspase-1 pathway modulation. Front Pharmacol. 2025;16:1528011.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
46.  Sanada Y, Ikuta Y, Ding C, Shinohara M, Yimiti D, Ishitobi H, Nagira K, Lee M, Akimoto T, Shibata S, Ishikawa M, Nakasa T, Matsubara K, Lotz MK, Adachi N, Miyaki S. Senescence-accelerated mice prone 8 (SAMP8) in male as a spontaneous osteoarthritis model. Arthritis Res Ther. 2022;24:235.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 11]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
47.  Derave W, Eijnde BO, Ramaekers M, Hespel P. Soleus muscles of SAMP8 mice provide an accelerated model of skeletal muscle senescence. Exp Gerontol. 2005;40:562-572.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 60]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
48.  Geigenmüller JN, Tari AR, Wisloff U, Walker TL. The relationship between adult hippocampal neurogenesis and cognitive impairment in Alzheimer's disease. Alzheimers Dement. 2024;20:7369-7383.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 37]  [Cited by in RCA: 28]  [Article Influence: 14.0]  [Reference Citation Analysis (0)]
49.  Kim TA, Syty MD, Wu K, Ge S. Adult hippocampal neurogenesis and its impairment in Alzheimer's disease. Zool Res. 2022;43:481-496.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 22]  [Cited by in RCA: 68]  [Article Influence: 17.0]  [Reference Citation Analysis (0)]
50.  Genchi A, Brambilla E, Sangalli F, Radaelli M, Bacigaluppi M, Furlan R, Andolfo A, Drago D, Magagnotti C, Scotti GM, Greco R, Vezzulli P, Ottoboni L, Bonopane M, Capilupo D, Ruffini F, Belotti D, Cabiati B, Cesana S, Matera G, Leocani L, Martinelli V, Moiola L, Vago L, Panina-Bordignon P, Falini A, Ciceri F, Uglietti A, Sormani MP, Comi G, Battaglia MA, Rocca MA, Storelli L, Pagani E, Gaipa G, Martino G. Neural stem cell transplantation in patients with progressive multiple sclerosis: an open-label, phase 1 study. Nat Med. 2023;29:75-85.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 76]  [Article Influence: 25.3]  [Reference Citation Analysis (0)]
51.  Chang J, Li Y, Shan X, Chen X, Yan X, Liu J, Zhao L. Neural stem cells promote neuroplasticity: a promising therapeutic strategy for the treatment of Alzheimer's disease. Neural Regen Res. 2024;19:619-628.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 25]  [Cited by in RCA: 31]  [Article Influence: 15.5]  [Reference Citation Analysis (0)]
52.  Liu C, Fan L, Xing J, Wang Q, Lin C, Liu C, Deng X, Ning C, Zhou L, Rong L, Liu B. Inhibition of astrocytic differentiation of transplanted neural stem cells by chondroitin sulfate methacrylate hydrogels for the repair of injured spinal cord. Biomater Sci. 2019;7:1995-2008.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 41]  [Article Influence: 5.9]  [Reference Citation Analysis (0)]
53.  Rhee YH, Kim TH, Jo AY, Chang MY, Park CH, Kim SM, Song JJ, Oh SM, Yi SH, Kim HH, You BH, Nam JW, Lee SH. LIN28A enhances the therapeutic potential of cultured neural stem cells in a Parkinson's disease model. Brain. 2016;139:2722-2739.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 32]  [Cited by in RCA: 32]  [Article Influence: 3.2]  [Reference Citation Analysis (0)]
54.  Gao G, Li C, Ma Y, Liang Z, Li Y, Li X, Fu S, Wang Y, Xia X, Zheng JC. Neural stem cell-derived extracellular vesicles mitigate Alzheimer's disease-like phenotypes in a preclinical mouse model. Signal Transduct Target Ther. 2023;8:228.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 29]  [Reference Citation Analysis (0)]
55.  Li X, Zhu Y, Wang Y, Xia X, Zheng JC. Neural stem/progenitor cell-derived extracellular vesicles: A novel therapy for neurological diseases and beyond. MedComm (2020). 2023;4:e214.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 26]  [Article Influence: 8.7]  [Reference Citation Analysis (0)]
56.  Wang Z, Bi H, Li D, Zhang W, Wang C, Yang J, Shen X, Yan R, He F, Duan H. Bibliometric Analysis of Exosome Research in Spinal Cord Injury (2000-May 2024). Trends, Collaborations, and Emerging Insights. Drug Des Devel Ther. 2025;19:6829-6848.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
57.  Huang R, Jia B, Su D, Li M, Xu Z, He C, Huang Y, Fan H, Chen H, Cheng F. Plant exosomes fused with engineered mesenchymal stem cell-derived nanovesicles for synergistic therapy of autoimmune skin disorders. J Extracell Vesicles. 2023;12:e12361.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 73]  [Reference Citation Analysis (0)]
58.  Zhang R, Mao W, Niu L, Bao W, Wang Y, Wang Y, Zhu Y, Yang Z, Chen J, Dong J, Cai M, Yuan Z, Song H, Li G, Zhang M, Xiong N, Wei J, Dong Z. NSC-derived exosomes enhance therapeutic effects of NSC transplantation on cerebral ischemia in mice. Elife. 2023;12:e84493.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 69]  [Reference Citation Analysis (0)]
59.  Vogel AD, Upadhya R, Shetty AK. Neural stem cell derived extracellular vesicles: Attributes and prospects for treating neurodegenerative disorders. EBioMedicine. 2018;38:273-282.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 76]  [Cited by in RCA: 145]  [Article Influence: 18.1]  [Reference Citation Analysis (0)]
60.  Zhong L, Wang J, Wang P, Liu X, Liu P, Cheng X, Cao L, Wu H, Chen J, Zhou L. Neural stem cell-derived exosomes and regeneration: cell-free therapeutic strategies for traumatic brain injury. Stem Cell Res Ther. 2023;14:198.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 84]  [Cited by in RCA: 71]  [Article Influence: 23.7]  [Reference Citation Analysis (0)]
61.  Wang T, Han Q, Lv S, Zhang LP, Li H, Liu J, Kuang J, Sun BL, Sun JY. Research progress on the mechanisms of endogenous neural stem cell differentiation in spinal cord injury repair. Front Cell Neurosci. 2025;19:1592297.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
62.  Kanazawa M, Takahashi T, Ishikawa M, Onodera O, Shimohata T, Del Zoppo GJ. Angiogenesis in the ischemic core: A potential treatment target? J Cereb Blood Flow Metab. 2019;39:753-769.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 65]  [Cited by in RCA: 126]  [Article Influence: 18.0]  [Reference Citation Analysis (0)]
63.  Xiong Y, Pi W, Zhao W, Shi W, Yan W, Yang H, Zhou Y, Li Q, Yang L. Roles of cerebrospinal fluid-contacting neurons as potential neural stem cells in the repair and regeneration of spinal cord injuries. Front Cell Dev Biol. 2024;12:1426395.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
64.  Iram T, Kern F, Kaur A, Myneni S, Morningstar AR, Shin H, Garcia MA, Yerra L, Palovics R, Yang AC, Hahn O, Lu N, Shuken SR, Haney MS, Lehallier B, Iyer M, Luo J, Zetterberg H, Keller A, Zuchero JB, Wyss-Coray T. Young CSF restores oligodendrogenesis and memory in aged mice via Fgf17. Nature. 2022;605:509-515.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 156]  [Article Influence: 39.0]  [Reference Citation Analysis (0)]
65.  Ma Q, Zhang L, Pearce WJ. MicroRNAs in brain development and cerebrovascular pathophysiology. Am J Physiol Cell Physiol. 2019;317:C3-C19.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 50]  [Article Influence: 7.1]  [Reference Citation Analysis (0)]
66.  Stoicea N, Du A, Lakis DC, Tipton C, Arias-Morales CE, Bergese SD. The MiRNA Journey from Theory to Practice as a CNS Biomarker. Front Genet. 2016;7:11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 56]  [Cited by in RCA: 76]  [Article Influence: 7.6]  [Reference Citation Analysis (0)]
67.  Prieto-Colomina A, Fernández V, Chinnappa K, Borrell V. MiRNAs in early brain development and pediatric cancer: At the intersection between healthy and diseased embryonic development. Bioessays. 2021;43:e2100073.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 13]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
68.  Guo X, Jiang P, Pan M, Ding Y, Lin Y, Jiang T, Li R, Wang W, Dai Y, Wang S, Cao Y, Lin H, Yang M, Liu W, Tao J. Overexpression of miR-124 in astrocyte improves neurological deficits in rat with ischemic stroke via DLL4 modulation. Exp Neurol. 2023;370:114571.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
69.  Son G, Na Y, Kim Y, Son JH, Clemenson GD, Schafer ST, Yoo JY, Parylak SL, Paquola A, Do H, Kim D, Ahn I, Ju M, Kang CS, Ju Y, Jung E, McDonald AH, Park Y, Kim G, Paik SB, Hur J, Kim J, Han YM, Lee SH, Gage FH, Kim JS, Han J. miR-124 coordinates metabolic regulators acting at early stages of human neurogenesis. Commun Biol. 2024;7:1393.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 12]  [Article Influence: 6.0]  [Reference Citation Analysis (0)]
70.  Todorov H, Weißbach S, Schlichtholz L, Mueller H, Hartwich D, Gerber S, Winter J. Stage-specific expression patterns and co-targeting relationships among miRNAs in the developing mouse cerebral cortex. Commun Biol. 2024;7:1366.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 8]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
71.  Jiang N, Zou C, Zhu Y, Luo Y, Chen L, Lei Y, Tang K, Sun Y, Zhang W, Li S, He Q, Zhou J, Chen Y, Luo J, Jiang W, Ke Z. HIF-1ɑ-regulated miR-1275 maintains stem cell-like phenotypes and promotes the progression of LUAD by simultaneously activating Wnt/β-catenin and Notch signaling. Theranostics. 2020;10:2553-2570.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 36]  [Cited by in RCA: 119]  [Article Influence: 19.8]  [Reference Citation Analysis (0)]
72.  Lee S, Remark LH, Josephson AM, Leclerc K, Lopez EM, Kirby DJ, Mehta D, Litwa HP, Wong MZ, Shin SY, Leucht P. Notch-Wnt signal crosstalk regulates proliferation and differentiation of osteoprogenitor cells during intramembranous bone healing. NPJ Regen Med. 2021;6:29.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 37]  [Article Influence: 7.4]  [Reference Citation Analysis (0)]
73.  Acar A, Hidalgo-Sastre A, Leverentz MK, Mills CG, Woodcock S, Baron M, Collu GM, Brennan K. Inhibition of Wnt signalling by Notch via two distinct mechanisms. Sci Rep. 2021;11:9096.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 29]  [Cited by in RCA: 49]  [Article Influence: 9.8]  [Reference Citation Analysis (0)]
74.  Bayleyegn Derso T, Mengistu BA, Demessie Y, Fenta MD, Getnet K. Neural stem cells in adult neurogenesis and their therapeutic applications in neurodegenerative disorders: a concise review. Front Mol Med. 2025;5:1569717.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 4]  [Reference Citation Analysis (0)]
75.  Pal S, Mandal S. Therapeutic potential of microRNAs in neurological disorders: mechanisms, biomarkers, and emerging therapeutic strategies. Explor Neuroprot Ther. 2025;5:1004111.  [PubMed]  [DOI]  [Full Text]
76.  Niazi SK, Magoola M. MicroRNA Nobel Prize: Timely Recognition and High Anticipation of Future Products-A Prospective Analysis. Int J Mol Sci. 2024;25:12883.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 11]  [Reference Citation Analysis (0)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Cell and tissue engineering

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B, Grade B

Novelty: Grade B, Grade B, Grade B

Creativity or innovation: Grade B, Grade B, Grade B

Scientific significance: Grade B, Grade B, Grade B

P-Reviewer: Mohamed DA, PhD, Professor, Egypt; Wu F, MD, PhD, Postdoctoral Fellow, China S-Editor: Wang JJ L-Editor: A P-Editor: Wang CH