Copyright
©The Author(s) 2023.
World J Clin Cases. Oct 26, 2023; 11(30): 7284-7293
Published online Oct 26, 2023. doi: 10.12998/wjcc.v11.i30.7284
Published online Oct 26, 2023. doi: 10.12998/wjcc.v11.i30.7284
Table 1 Primer sequences
| Forward (5’-3’) | Reverse (5-3’) | |
| FOXM1 | CAGTCCGATTAGTCAGCTCCT | GTCATTTAGCTCCTTGTGCTG |
| COX-2 | CCGGGTACAATCGCACTTAT | GGCGCTCAGCCATACAG |
| GRP78 | GTTACAATCAAGGTAT | CATTCACATCTATCTCAA |
| β-actin | CTGATATAGCCGCGCTCG | CACTCGGTGCCGGATCATCA |
Table 2 Comparison of baseline clinical data
| Control group (n = 70) | Research group (n = 65) | t/χ2 | P value | |
| Age (yr) | 60.37 ± 5.25 | 60.26 ± 7.26 | 0.101 | 0.920 |
| Family history of BC | 0.457 | 0.499 | ||
| Yes | 8 (11.43) | 10 (15.38) | ||
| No | 62 (88.57) | 55 (84.62) | ||
| Long-term smoking | 0.099 | 0.753 | ||
| Yes | 20 (28.57) | 17 (26.15) | ||
| No | 50 (71.43) | 48 (73.85) | ||
| Long-term drinking | 0.182 | 0.669 | ||
| Yes | 12 (17.14) | 13 (20.00) | ||
| No | 58 (82.86) | 52 (80.00) | ||
| History of breast disease | 0.223 | 0.637 | ||
| Yes | 20 (28.57) | 21 (32.31) | ||
| No | 50 (71.43) | 44 (67.69) |
Table 3 Correlation of forkhead box M1, cyclooxygenase-2, and glucose-regulated protein 78 with clinicopathological features of breast infiltrating ductal carcinoma
| n | FOXM1 | COX-2 | GRP78 | |
| Age (yr) | ||||
| ≤ 60 | 33 | 4.51 ± 0.69 | 3.22 ± 0.61 | 3.85 ± 0.71 |
| > 60 | 32 | 4.75 ± 0.83 | 3.60 ± 0.87 | 3.12 ± 0.69 |
| Family history of BC | ||||
| Yes | 10 | 4.66 ± 0.61 | 3.42 ± 0.65 | 3.05 ± 0.64 |
| No | 55 | 4.43 ± 1.37 | 3.31 ± 1.28 | 2.62 ± 0.95 |
| Long-term smoking | ||||
| Yes | 17 | 4.65 ± 0.49 | 3.59 ± 0.54 | 2.96 ± 0.49 |
| No | 48 | 4.62 ± 0.84 | 3.34 ± 0.83 | 2.99 ± 0.77 |
| Long-term drinking | ||||
| Yes | 13 | 4.36 ± 0.80 | 3.36 ± 0.91 | 2.81 ± 0.58 |
| No | 52 | 4.69 ± 0.75 | 3.41 ± 0.74 | 3.03 ± 0.73 |
| History of breast disease | ||||
| Yes | 21 | 4.49 ± 0.63 | 3.42 ± 0.61 | 2.77 ± 0.59 |
| No | 44 | 4.69 ± 0.82 | 3.40 ± 0.84 | 3.08 ± 0.74 |
| Histological grade | ||||
| Grade I | 35 | 4.39 ± 0.76 | 3.21 ± 0.72 | 2.75 ± 0.66 |
| Grade II | 19 | 4.57 ± 0.47 | 3.29 ± 0.61 | 2.91 ± 0.49 |
| Grade III | 11 | 5.48 ± 0.611,2 | 4.22 ± 0.701,2 | 3.83 ± 0.521,2 |
| Tumor metastasis | ||||
| Yes | 21 | 5.03 ± 0.75 | 3.7 ± 0.78 | 3.41 ± 0.69 |
| No | 44 | 4.43 ± 0.703 | 3.24 ± 0.713 | 2.78 ± 0.623 |
Table 4 Univariate analysis of prognostic mortality in breast infiltrating ductal carcinoma
| Surviving patients (n = 53) | Dead patients (n = 12) | t/χ2 | P value | |
| Age (yr) | 9.849 | 0.002b | ||
| ≤ 60 | 31 (58.49) | 1 (8.33) | ||
| > 60 | 22 (41.51) | 11 (91.67) | ||
| Family disease history of BC | 0.562 | 0.453 | ||
| Yes | 9 (16.98) | 1 (8.33) | ||
| No | 44 (83.02) | 11 (91.67) | ||
| Long-term smoking | 0.686 | 0.408 | ||
| Yes | 15 (28.30) | 12 (16.67) | ||
| No | 38 (71.70) | 10 (83.33) | ||
| Long-term drinking | 0.102 | 0.749 | ||
| Yes | 11 (20.75) | 12 (16.67) | ||
| No | 42 (79.25) | 10 (83.33) | ||
| History of breast disease | 1.646 | 0.200 | ||
| Yes | 19 (35.85) | 12 (16.67) | ||
| No | 34 (64.15) | 10 (83.33) | ||
| Histological grade | 37.350 | < 0.001b | ||
| Grade I | 35 (66.04) | 0 (0.0) | ||
| Grade II | 16 (30.19) | 3 (25.00) | ||
| Grade III | 2 (3.77) | 9 (75.00) | ||
| Tumor metastasis | 30.840 | < 0.001b | ||
| Yes | 9 (16.98) | 12 (100.0) | ||
| No | 44 (83.02) | 0 (0.0) | ||
| FOXM1 | 4.49 ± 0.69 | 5.22 ± 0.80 | 3.214 | 0.002b |
| COX-2 | 3.28 ± 0.70 | 3.96 ± 0.84 | 2.928 | 0.005b |
| GRP78 | 2.83 ± 0.62 | 3.66 ± 0.66 | 4.140 | < 0.001b |
Table 5 Multivariate analysis of prognostic mortality in breast infiltrating ductal carcinoma
| β | S.E. | Wald χ2 | P value | OR | 95%CI | |
| Age (yr) | -0.426 | 2.623 | 3.621 | 0.527 | 1.642 | 0.842-3.513 |
| Histological grade | 1.124 | 0.342 | 10.624 | < 0.001 | 3.068 | 1.512-6.084 |
| Tumor metastasis | 1.824 | 0.493 | 20.184 | < 0.001 | 6.521 | 2.164-14.813 |
| FOXM1 | 1.109 | 0.384 | 8.147 | 0.004 | 3.024 | 1.541-6.038 |
| COX-2 | 0.674 | 0.281 | 5.264 | 0.021 | 1.871 | 1.064-3.257 |
| GRP78 | 1.084 | 0.573 | 11.806 | < 0.001 | 1.583 | 0.962-4.823 |
- Citation: Bai J, Li Y, Cai L. Clinical implications of forkhead box M1, cyclooxygenase-2, and glucose-regulated protein 78 in breast invasive ductal carcinoma. World J Clin Cases 2023; 11(30): 7284-7293
- URL: https://www.wjgnet.com/2307-8960/full/v11/i30/7284.htm
- DOI: https://dx.doi.org/10.12998/wjcc.v11.i30.7284
