MiR-451a targets mex-3 RNA binding family member C to regulate human hepatoblastoma G2 cell growth and metastasis

Abstract

BACKGROUND

Aberrant microRNAs expression and associated pathways have been proved participate in regulation vast various physiologic and pathologic processed of different human cancers including liver cancer. While, the function of miR-451a in liver cancer still indistinct.

AIM

To study the effect of miR-451a in liver cancer development.

METHODS

GeneChip microarray analysis performed to detect miR-451a expression in liver cancer tissues and normal liver tissues. Reverse transcription-polymerase chain reaction was used to validate the expression of miR-451a in liver cancer cell and other tumor cell lines. Construction of liver cancer cell lines that stably overexpressed miR-451a by transfecting Lentivirus produced by Genechem company. Methylthiazolyldiphenyl-tetrazolium (MTT) bromide assay and colony formation assay to determine the effect of miR-451a in liver cancer cell proliferation. Flow cytometry used to investigate whether miR-451a involved in liver cancer cell apoptosis. Cell migration ability was measured via wound scratch assay. Target gene was explored by bioinformatic analysis, and downstream molecule of miR-451a in liver cancer identified by rescue experiments.

RESULTS

MiR-451a expression significantly downregulation in liver cancer tissues compared with that in normal liver tissue. MiR-451a also obviously low-expressed in liver cancer cell, colorectal carcinoma cell and esophageal carcinoma cell lines. Human hepatoblastoma G2 (HepG2) and BEL-7404 cell lines that stably overexpressed miR-451a by transfecting lentivirus constructed successfully. MTT bromide assay and colony formation assay showed that the overexpressed miR-451a inhibit HepG2 cell proliferation viability, but not BEL-7404 cell. Flow cytometry determined that miR-451a regulating proliferation not through inducing apoptosis. Wound scratch assay revealed that miR-451a overexpression suppressed HepG2 cell migration. Furthermore, mex-3 RNA binding family member C was predicted as the target gene by bioinformatic analysis, and rescue experiments confirmed the hypothesis.

CONCLUSION

Therefore, miR-451a may be candidate miRNA for understanding molecular mechanisms of liver cancer development and novel target in liver cancer cell.

Key Words: Liver cancer; MiR-451a; Mex-3 RNA binding family member C; Proliferation; Migration

Core Tip: Aberrant microRNAs expression and associated pathways have been proved participate in regulation vast various physiologic and pathologic processed of different human cancers including liver cancer. In this study, we first provided evidence that miR-451a obviously down-regulated in hepatocellular carcinoma (HCC) tissues and tumor cell lines. Overexpression of miR-451a significantly inhibit human hepatoblastoma G2 (HepG2) cell proliferation, colony formation and migration. However, miR-451a were not participated in HCC cell apoptosis. Moreover, bioinformatic analysis showed that mex-3 RNA binding family member C (MEX3C) was target gene of miR-451a, which validated by reverse transcription-polymerase chain reaction and western blotting. Furthermore, rescue experiments confirmed that overexpression of MEX3C can inhibit the effect of miR-451a in HepG2.

INTRODUCTION

The common hallmark of the vast majority of liver cancer is a chronic inflammation caused by chronic hepatitis B virus (HBV) infection in China[1]. HBV infection can result in a cascade of complex reaction between oncogenes and tumor suppressor genes, owing to carcinogenesis and development of liver cancer[2].

MicroRNAs (miRNAs) are a class of small RNAs, which play as post-transcriptional gene silencers by decreasing or suppressing their target mRNA expression[3]. It has been reported that lots of miRNAs deregulation were related to many cancers’ progression including colorectal cancer[4], glioma[5], osteosarcoma[6], liver cancer[7], breast cancer[8], etc. Therefore, it is significant important to investigate the mechanism of miRNA behind the liver cancer development.

Our previous study found sheer number of dysregulated miRNAs in liver cancer tissues compared with that in normal liver tissues by GeneChip microarray analysis. The expression of miR-451a obviously decreased in liver cancer tissues, which indicated that miR-451a may play crucial role in liver cancer progression. The aim of our study was to further determine the effect of miR-451a in hepatocarcinogenesis.

MATERIALS AND METHODS

Patients’ samples

A total of 100 Liver cancer samples and corresponding normal liver tissues collect from patients with liver cancer. The patients were pathological diagnosed clearly, having no preoperative adjuvant chemotherapy or radiotherapy, who underwent complete surgical resection at The Affiliated Hospital of Binzhou Medical University. Informed consent was provided by all patients, and the experiment approved by our Ethics Committee of The Affiliated Hospital of Binzhou Medical University.

Cell cultures and stable cell line construction

Human liver cancer cell lines [including SMMC-7721, Huh7, human hepatoblastoma G2 (HepG2), Hep3B, BEL-7402, BEL-7404], human colorectal carcinoma cell lines (HCT-116, RKO) and human esophageal carcinoma cell lines (ECA109, TE-1) were purchased from the American Type Culture Collection. All the cell lines were cultured in Dulbeccos’ Modified Eagle’s Medium (Hyclone, NJ, United States) containing 10% fetal bovine serum, 100 units/mL of penicillin and 100 μg/mL streptomycin. For transfection, lentivirus system for miR-451a stable overexpression and pcDNA-mex-3 RNA binding family member C (MEX3C) plasmid overexpressing MEX3C were created by the Genechem Company (Shanghai, China). All the cell lines in this study authenticated by STR profiling.

Reverse transcription-quantitative polymerase chain reaction analysis

Total RNA was purified from tissue and cell lines using Trizol reagent (Invitrogen, United States). The cDNA was synthesized with promega M-MLV Reverse Transcriptase kit. The quantitative polymerase chain reaction (qPCR) was performed using qPCR SYBR Green master mix (Takara, Dalian, Liaoning Province, China) on a Real-time PCR System (Applied Biosystems). MiR-451a expression was normalized to U6 mRNA level, and gene expression levels normalized to GAPDH. Each reaction was performed in duplicate. MiRNA-specific primers designed by RiboBio (Guangzhou, Guangdong Province, China). Primers used for amplification were as follows: (1) GAPDH: Forward primer: 5’-TG ACTTCAACAGCGACACCCA-3’, reverse primer: 5’-CACCCTGTTGCTGTAGCCAAA-3’; and (2) MEX3C: Forward primer: 5’-ATGAGGTTATTGCTGCCCTAG-3’, reverse primer: 5’-GTGAATTTGGATTGCCTGAGTA-3’. Detailed primers for target genes shown in Table 1.

Table 1 Primers for target genes of miR-451a.

Gene ID	Forward primer sequence	Reverse primer sequence	Amplification fragment (bp)
GAPDH	TGACTTCAACAGCGACACCCA	CACCCTGTTGCTGTAGCCAAA	121
TSC1	CAACAAGCAAATGTCGGGGAG	CATAGGGCCACGGTCAGAA	114
OSR1	CACAGTGCCTTCGGACCATCT	CTCGGGCTTGGGTTGAATGAC	211
EMSY	ATGACTTCCAAGCCCAACGTG	TTCCCTTGCTGCCCATAAACA	275
SAMD4B	TGGGCATTCGGCTCCAACTCG	CATTGGGAACTGCCGCTGGGT	84
MEX3C	ATGAGGTTATTGCTGCCCTAG	GTGAATTTGGATTGCCTGAGTA	134
PSMB8	CTGGGTCCTACATTAGTGCCT	CCATTTCGCAGATAGTACAGC	148
PMM2	ATCAAAATCGGAGTGGTAGGC	CAGCTTCTTCCAATAGGGGAC	293
CAB39	GACAAAAGTCGCAACATCCAG	TAAACTGCTCATCCTCCGTCC	166
TTN	GGGAGGAAAGGCTTACAGAG	ATGGATACCATCATAGCGAACT	261

Methylthiazolyldiphenyl-tetrazolium bromide assay for cell growth

HepG2 and BEL-7404 cells transfected with lentivirus-negative control (LV-NC) or lentivirus miR-451a (LV-miR-451a) were seeded at 2 × 10³ per well into 96-well culture plates and incubated in humidified incubators at 37 ºC with 5% CO₂. The Methylthiazolyldiphenyl-tetrazolium (MTT) bromide solution (Genechem, Shanghai, China) were added to cells, and then incubated for 4 hours. Following incubation, 150 μL DMSO (Sigma-Aldrich, St. Louis, MO, United States) was added into each well and shaken for 15 minutes. Optical density value was measured by a microplate reader at the wavelength of 490 nm. All experiments were independently repeated at least 3 times.

Colony formation analysis

Cells transfected with LV-NC or LV-miR-451a treatment for 3 days, and then seeded into 60 mm culture plates at a concentration of 800 cells per well. The medium changed every 3 days and colonies were fixed in methanol and stained with crystal violet solution (Beyotime) 10 days later and quantified. The experiment was repeated three times.

Apoptosis assay

After 72 hours, LV-NC or LV-miR-451a transfection, HepG2 or BEL-7404 cells were harvested, washed and resuspended in the binding buffer. The apoptosis assay kit (eBioscience, Inc.) was used to examine the cells according to the instruction, and stained cells detected by flow cytometry (FACS Guava easyCyte HT, Millipore, MA, United States). Each experiment was performed three times.

Wound scratch assay

HepG2 and BEL-7404 cells were seeded into 6-well plates and transfected with LV-NC or LV-miR-451a for 24 hours. A sterile pipette tip used to make the wounds in the cell monolayer as beginning gap length at 0 hour, while the residual gap length at 48 hours were detected using the Image Analysis and Detection System (Leica Microsystems GmbH, Wetzlar, Germany). The experiments repeated at least three times.

Western blot analysis

Transfected HepG2 or BEL-7404 cells were ground and lysed in RIPA buffer on ice and then subjected to Western blot analysis. Equal amounts of proteins were loaded onto sodium dodecyl sulfate-polyacrylamide gels, and the resulting bands were transferred to a polyvinylidene difluoride membranes (Millipore, MA, United States). The membrane was blocked and then incubated with primary antibodies of MEX3C and β-actin overnight. Next day, the membranes were washed and incubated with corresponding secondary antibodies. Signals were detected on X-ray film using an electrochemiluminescence detection system (Pierce, Rockford, IL, United States).

Statistics analysis

Data are presented as mean ± SD. The student^’s t-test was used to compare the difference between two groups. P < 0.05 was considered to be significant. All analyses were performed using Statistical Package for the Social Sciences version 24.0 (SPSS, Inc., Chicago, IL, United States).

RESULTS

MiR-451a low-expressed significantly in liver cancer samples

GeneChip microarray analysis performed between 10 Liver cancer tissues and paired normal liver tissues. It was found that miR-451a down-regulated more than 12-fold compared with that in normal liver tissues (Figure 1A). And the result confirmed by real-time quantitative reverse transcription-PCR (RT-PCR) analysis in liver cancer cell lines (including SMMC-7721, Huh7, HepG2, Hep3B, BEL-7402, BEL-7404) (Table 2). The data indicated that miR-451a expression decreased significantly in liver cancer cell lines and tissues. In order to confirm this result, some other tumor cell lines (HCT-116, RKO, ECA109, TE-1) also examined (Table 3). Consistent with the expression of miR-451a in liver cancer tissues and cell lines, miR-451a expression also hard to detect in colorectal cancer cell and esophageal squamous cancer cells. It was indicated that down-regulation of miR-451a in liver cancer may contribute to liver cancer carcinogenesis and progression.

Figure 1 MiR-451a expression in liver cancer tissues and construction of miR-451a stable up-expression cell lines. A: MiR-451a expression down-regulated in liver cancer tissues; B: Human hepatoblastoma G2 (HepG2) cells transfect with lentivirus-negative control (LV-NC) virus and lentivirus miR-451a (LV-miR-451a) virus, respectively (magnification 100 ×). Figures from left to right are HepG2 cells under bright field, green fluorescence produced by the expressed green fluorescence protein (GFP) fused with the GV369 vector; C: BEL-7404 cells transfect with LV-NC virus and LV-miR-451a virus, respectively (magnification 100 ×). Figures from left to right are BEL-7404 cells under bright field, green fluorescence produced by the expressed GFP fused with the GV369 vector; D: Quantitative real-time quantitative polymerase chain reaction result showed that miR-451a significantly up-regulated in HepG2 and BEL-7404 cells after transfecting with LV-miR-451a virus compared with LV-NC group (^aP < 0.05). HCC: Hepatocellular carcinoma; HepG2: Human hepatoblastoma G2; LV-miR-451a: Lentivirus miR-451a; LV-NC: Lentivirus-negative control.

Table 2 Expression of miR-451a in hepatocellular carcinoma cell lines.

Cell type	U6	hsa-miR-451a, Ct value	∆Ct
Human hepatoblastoma G2	10.84	35	24.16
	10.72	35	24.28
	10.77	35	24.23
BEL-7402	13.19	35	21.81
	13.09	35	21.91
	13.2	35	21.8
BEL-7404	11.67	35	23.33
	11.61	35	23.39
	11.53	35	23.47
Huh-7	10.82	35	24.18
	10.84	35	24.16
	10.74	35	24.26
SMMC-7721	12.56	35	22.44
	12.58	35	22.42
	12.66	35	22.34
Hep3B	13.55	35	21.45
	13.53	35	21.47
	13.51	35	21.49

Table 3 Expression of miR-451a in colorectal cancer cell and esophageal squamous cancer cell.

Cell type	U6	hsa-miR-451a, Ct value	∆Ct
HCT116	11.74	35	23.26
	11.56	35	23.44
	11.68	35	23.32
RKO	11.77	35	23.23
	11.7	35	23.3
	11.79	35	23.21
ECA109	11.04	35	23.96
	11.07	35	23.93
	11.06	35	23.94
TE-1	11.79	35	23.21
	11.81	35	23.19
	11.79	35	23.21

Construction of miR-451a stable up-expression cell lines

To determine potential function of miR-451a, lentivirus system (LV-NC or LV-miR-451a) produced by Genechem Company transfecting HepG2 and BEL-7404 cell line (Figure 1B and C). The transfection efficiency was evaluated using RT-qPCR, as shown in Figure 1D, the miR-451a expression in HepG2 and BEL-7404 up-regulated 5.886-fold and 5.994- fold, respectively. Subsequently, HepG2 and BEL-7404 with stable up-expression of miR-451a were used to explore role of miR-451a in liver cancer progression.

Overexpression of miR-451a decreased HepG2 cell growth

Having found decreased expression of miR-451a in liver cancer, we then explored whether miR-451a functions as a tumor suppressor. The effect of miR-451a on liver cancer cell growth was observed. The absorptivity of liver cancer cells was determined by MTT bromide assay, after transfection for 0 day, 1 day, 2 days, 3 days, 4 days and 5 days. The absorptivity of the HepG2 cell decreased at the 490 nm from 48 hours. It was indicated that the growth of HepG2 cell transfected with LV-miR-451a significantly decreased as compared with that of LV-NC group (P < 0.05) (Figure 2A). By contrast, there was no difference in BEL-7404 cell line between LV-NC group and LV-miR-451a group (Figure 2B). Figure 2C showed that lentivirus transfection efficiency of colony formation assay for HepG2 cell and BEL-7404 cell line. Meanwhile, the number of colonies in LV-miR-451a group for HepG2 cell line was obviously less than those in LV-NC group (Figure 2D). Consistent with the MTT bromide assay result, in BEL-7404 cell line, the number of colonies have no significant difference between LV-miR-451a group and LV-NC group (Figure 2E).

Figure 2 Effects of MiR-451a overexpression on human hepatoblastoma G2 cells and BEL-7404 cells. A and B: MiR-451a overexpression decreased human hepatoblastoma G2 (HepG2) cell growth but not BEL-7404 cell; C: Green fluorescence indicated the transfection efficiency of HepG2 and BEL-7404 cells in colony formation assay; D and E: Colony formation assay was performed to determine the growth of HepG2 and BEL-7404 cells transfected with lentivirus-negative control or lentivirus miR-451a, respectively (^aP < 0.05). HepG2: Human hepatoblastoma G2; LV-miR-451a: Lentivirus miR-451a; LV-NC: Lentivirus-negative control; MTT: Methylthiazolyldiphenyl-tetrazolium.

MiR-451a have no effect on liver cancer cells apoptosis

Because overexpression of miR-451a can prohibit HepG2 cell proliferation, it was then investigated whether the role of miR-451a is related to the cell apoptosis by flow cytometry. However, for both HepG2 cell and BEL-7404 cell line, up-regulation of miR-451a had no influence on liver cancer cell apoptosis (Figure 3). This result indicated that miR-451a was not via induction of apoptosis to suppress liver cancer cell proliferation.

Figure 3 Effects of miR-451a overexpression on apoptosis. A: Human hepatoblastoma G2 (HepG2); B: BEL-7404. MiR-451a overexpression have no influence in HepG2 and BEL-7404 cell apoptosis. HepG2: Human hepatoblastoma G2; LV-miR-451a: Lentivirus miR-451a; LV-NC: Lentivirus-negative control.

Up-regulation of miR-451a inhibited HepG2 cell metastasis

Wound scratch assay was used to evaluate migration ability of HepG2 and BEL-7404 cell lines transfected with LV-miR-451a or LV-NC virus. The distance of cell migration in HepG2 cells transfected with LV-miR-451a was obviously shorter compared with cells treated with LV-NC virus (P < 0.05; Figure 4A). However, the distance of cell migration of BEL-7404 cell showed no significant difference treated with LV-miR-451a/LV-NC groups (Figure 4B).

Figure 4 Effect of miR-451a overexpression on cell migration. A: Human hepatoblastoma G2 (HepG2); B: BEL-7404. MiR-451a overexpression inhibited HepG2 cell migration but not BEL-7404 cell (^aP < 0.05). HepG2: Human hepatoblastoma G2; LV-miR-451a: Lentivirus miR-451a; LV-NC: Lentivirus-negative control.

MiR-451a inhibited proliferation and metastasis of HepG2 cell by targeting MEX3C

To investigate the underlying molecular mechanisms of miR-451a in proliferation and migration, potential target genes for miR-451a explored using the Targetscan, microRNA. ORG and miRDB database. As a result, MEX3C was predicted as potential target for miR-451a. Subsequently, RT-PCR and western blotting performed to confirm MEX3C expression level (Figure 5A and B). After co-transfection with LV-miR-451a and pcDNA-MEX3C, the protein level of MEX3C increased. Moreover, rescue experiments were designed by over-expression MEX3C in HepG2 cells via using pcDNA-MEX3C. The cell proliferation and invasion ability of HepG2 cell compared between LV-NC group and LV-miR-451a+pcDNA-MEX3C group. MTT bromide assay found that HepG2 cell growth inhibited by LV-miR-451a was rescued by MEX3C recovery (P < 0.05; Figure 5C). Meanwhile, cell migration capability was also restored by pcDNA-MEX3C (P < 0.05; Figure 5D). These results demonstrated that miR-451a inhibited HepG2 cell proliferation and migration via suppressing MEX3C expression.

Figure 5 Mex-3 RNA binding family member C overexpression rescued the effects of miR-451a in human hepatoblastoma G2 cell. A: Reverse transcription-polymerase chain reaction analyses of mex-3 RNA binding family member C ( MEX3C); B: Western blotting analyses of MEX3C; C: Analysis of human hepatoblastoma G2 (HepG2) cell proliferation ability by Methylthiazolyldiphenyl-tetrazolium bromide assay in lentivirus-negative control (LV-NC) group and lentivirus miR-451a (LV-miR-451a)+pcDNA-MEX3C group; D: HepG2 cell invasion ability was measured by wound scratch assay between LV-NC group and LV-miR-451a+pcDNA-MEX3C group (^aP < 0.05). HepG2: Human hepatoblastoma G2; LV-miR-451a: Lentivirus miR-451a; LV-NC: Lentivirus-negative control; MEX3C: Mex-3 RNA binding family member C; MTT: Methylthiazolyldiphenyl-tetrazolium.

DISCUSSION

Our present study mainly to determine the miR-451a expression in liver cancer cell lines, by contrast, miR-451a expression in colorectal cancer cell and esophageal squamous cancer cell were also detected. In order to investigate the function of miR-451a, HepG2 and BEL-7404 cell transfected with LV-miR-451a to construct stably overexpressed miR-451a liver cancer cell line. MTT bromide assay, colony formation assay and wound scratch assay showed that miR-451a overexpression can inhibit HepG2 cell proliferation and migration, but not for BEL-7404 cell line. This discrepancy is likely attributable to inherent differences between the two cell types in their molecular profiling, target gene expression, and compensatory capacity within signaling networks. Resolving this issue necessitates further elucidation of the specific signal-dependent mechanisms unique to BEL-7404 cells.

Concurrently, our findings demonstrate that miR-451a does not influence apoptosis in this system. This is likely because, in HepG2 cells, miR-451a suppresses proliferation by inhibiting its target(s), thereby downregulating associated signaling pathways and ultimately inducing cell cycle arrest at the G1 phase. In contrast, in BEL-7404 cells, this G1 arrest mechanism cannot be effectively activated, potentially due to the absence of key target pathways, p53 mutation, and/or the presence of compensatory signaling pathways. Elucidating the precise growth inhibitory mechanisms involved will also constitute one of the key foci of our future investigations.

Meanwhile, 9 target gene for miR-451a explored by bioinformatics analysis and validated through RT-PCR and western blotting. Our preliminary literature review identified MEX3C as a frequently dysregulated target gene across multiple cancer types. Critically, its direct regulatory role in cell cycle control exhibits high mechanistic plausibility and logical coherence with the miR-451a-induced proliferation suppression phenotype. Hence, MEX3C was prioritized as a candidate target for further investigation. Moreover, rescue experiments were designed to confirm the predicted target gene MEX3C. Therefore, the results of our study suggested the importance of miR-451a in HepG2 cells by prohibiting cell proliferation and migration.

It has been reported that miR-451a act as various aspect role in several kinds of cancers. For example, it is proved that miR-451a upregulated in whole blood samples collected from luminal A breast cancer patients. While, up-regulation of miR-451a can suppress the resistance to tamoxifen through regulating autophagy, 14-3-3ζ expression and Erα[9]. It was also found that miR-451a was preferentially expressed in the extracellular vesicles (EVs) of T lymphocytes, which indicated that miR-451a interact with the tumor immune environment[10]. Moreover, EVs-encapsulated miR-451a can be performed as circulating biomarker of breast cancer[11]. In non-small cell lung cancer (NSCLC), miR-451 was low-expression in NSCLC tissues and A549 and NCI-H460 cell lines. Moreover, miR-451a/activating transcription factor 2 (ATF2) axis through ATF2 regulation to inhibited NSCLC cells migration and invasive ability[12]. Interestingly, the expression of miR-451a significantly different in NSCLC cell lysates from NSCLC EVs[13], furthermore, plasma exosomal miR-451a can act as biomarker for early prediction of recurrence and prognosis of NSCLC[14]. GeneChip microarray analysis was used for colorectal cancer showed that miR-451a had decreased expression with more advanced tumors[15]. And miR-451a can inhibit proliferation and increase apoptosis of colorectal cancer cell through inducing endoplasmic reticulum stress by binding to the 5’-UTR of BAP31[16]. In addition, radiation may induce miR-451a up-regulation and may influence colorectal carcinoma proliferation via CAB39 and EMSY pathways[17]. MiR-451a expression both in papillary thyroid carcinoma (PTC) tissues and plasma significantly higher than in those with control group, which suggested the valuable of miR-451a for the diagnosis of PTC[18]. The mechanism study showed that miR-451a can suppress PTC cell growth, epithelial-mesenchymal transition and induces apoptosis via targeting PSMB8[19]. In osteosarcoma, miR-451a was found to be downregulated and inhibited the growth and invasion of osteosarcoma cell by targeting TRIM66[20]. MiR-451a expression also significantly low-expression in renal cell carcinoma (RCC), which closely related to poor prognosis of RCC patients[21]. In our study, 9 possible target genes were found by bioinformatic analysis. Except for PSMB8, the other 8 target genes downregulated significantly, which indicated possible mechanism underlying the function of miR-451a.

However, this study has several limitations. These include the lack of patient demographic characteristics, clinical staging, treatment modalities, and prognostic outcome details for the source specimens. Additionally, the downstream pathways through which MEX3C influences proliferation and migration remain unexplored. Consequently, conducting further follow-up studies and delineating the downstream pathways involved will constitute the primary focus of our subsequent work. We plan to perform a comprehensive analysis and mechanistic dissection of these aspects in future investigations.

CONCLUSION

In summary, this study found that miR-451a obviously down-regulated in liver cancer tissues and tumor cell lines. Overexpression of miR-451a significantly inhibit HepG2 cell proliferation, colony formation and migration. However, miR-451a were not participated in liver cancer cell apoptosis. Moreover, bioinformatic analysis showed that MEX3C was target gene of miR-451a, which validated by RT-PCR and western blotting. Furthermore, rescue experiments confirmed that overexpression of MEX3C can inhibit the effect of miR-451a in HepG2 cell. Therefore, our research provides new insight for understanding molecular mechanisms of liver cancer development and progression to support diagnostic and therapeutic strategies.