BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
Copyright: ©Author(s) 2026. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution-NonCommercial (CC BY-NC 4.0) license. No commercial re-use. See permissions. Published by Baishideng Publishing Group Inc.
World J Hepatol. Jun 27, 2026; 18(6): 119561
Published online Jun 27, 2026. doi: 10.4254/wjh.119561
LECT2/Tie1/Src signaling regulates the oxidative stress response in endothelial cells and liver ischemia-reperfusion injury
Yu Yang, Shi-Li Wu, Zhi-Hao Huang, Meng-Qi Dong, Zhi-Min Liu, Meng Xu, Wei-Jie Zhou, Yuan Lin, Department of General Surgery, Guangdong Provincial Key Laboratory of Precision Medicine for Gastrointestinal Tumor, Nanfang Hospital, Southern Medical University, Guangzhou 510515, Guangdong Province, China
Yi Gao, General Surgery Center, Department of Hepatobiliary Surgery II, Guangdong Provincial Research Center for Artificial Organ and Tissue Engineering, Guangzhou Clinical Research and Transformation Center for Artificial Liver, Institute of Regenerative Medicine, Zhujiang Hospital, Southern Medical University, Guangzhou 510280, Guangdong Province, China
ORCID number: Meng Xu (0000-0001-7339-6403); Yi Gao (0000-0003-3525-0133); Wei-Jie Zhou (0000-0002-0021-9454); Yuan Lin (0000-0003-3283-9495).
Author contributions: Lin Y and Zhou WJ contributed to conceptualization, resources, supervision, and writing of original drafts; Yang Y, Wu SL, Huang ZH, Liu ZM, Dong MQ, and Xu M contributed to methodology and investigation; Yang Y, Huang ZH, and Dong MQ contributed to validation; Yang Y and Dong MQ contributed to formal analysis; Lin Y, Gao Y, and Zhou WJ contributed to data curation; Yang Y and Lin Y contributed to visualization; Lin Y contributed to project administration; Lin Y, Xu M, and Zhou WJ contributed to funding acquisition; and all authors reviewed and edited the manuscript, and approved the final version to publish.
Supported by National Key Research and Development Program, No. 2022YFA1106700; and National Natural Science Foundation of China, No. 82270645, No. 82570748, No. 82200633, and No. 92068206.
Institutional animal care and use committee statement: This study was approved by the Animal Ethics Committee of Nanfang Hospital, No. NFYY-2018-031.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: The data and materials of this study are available from Lin Y and Zhou WJ upon reasonable request.
Corresponding author: Yuan Lin, PhD, Professor, Department of General Surgery, Guangdong Provincial Key Laboratory of Precision Medicine for Gastrointestinal Tumor, Nanfang Hospital, Southern Medical University, No. 1838 Guangzhou Road, Guangzhou 510515, Guangdong Province, China. xiaoyuanlinz@163.com
Received: February 2, 2026
Revised: February 24, 2026
Accepted: April 17, 2026
Published online: June 27, 2026
Processing time: 147 Days and 6.7 Hours

Abstract
BACKGROUND

Hepatic ischemia-reperfusion injury (IRI) is a critical pathological process associated with trauma, sepsis, and liver surgeries, including transplantation. During reperfusion, oxidative stress in sinusoidal endothelial cells triggers cell death, however, the underlying regulatory mechanisms remain poorly defined. Previous studies have implicated leukocyte-derived chemotaxin-2 (LECT2) in various diseases and identified it as a ligand for the orphan receptor Tie1, yet its role in endothelial cell injury during liver IRI remains unclear.

AIM

To investigate whether LECT2 exacerbates liver IRI by regulating oxidative stress in endothelial cells through the Tie1/Src signaling pathway and to evaluate the therapeutic potential of targeting this axis.

METHODS

In vitro hypoxia-reoxygenation injury was modeled in EA.hy926 endothelial cells, followed by LECT2 knockdown or recombinant LECT2 treatment, Tie1 silencing, and Tie1-Ig3 segment protein treatment to block LECT2/Tie1 binding. Src kinase activity was inhibited using dasatinib. Cell viability, oxidative stress, cytotoxicity, and signaling pathway activation were assessed. In vivo, LECT2 knockout mice underwent hepatic ischemia-reperfusion, while injury markers, inflammatory cytokines, and endothelial damage were evaluated.

RESULTS

LECT2 knockdown reduced oxidative stress and endothelial cell damage following hypoxia-reoxygenation, whereas recombinant LECT2 exacerbated these effects. Disruption of LECT2/Tie1 binding, via either Tie1 knockdown or Tie1-Ig3 treatment mitigated injury. Mechanistically, LECT2 activated Src kinase phosphorylation in a Tie1-dependent manner, and Src inhibition reversed LECT2-induced cell damage. In mice, LECT2 deletion attenuated liver IRI, decreased apoptosis and inflammation, and better preserved sinusoidal endothelial integrity.

CONCLUSION

The LECT2/Tie1/Src signaling axis plays a critical role in regulating oxidative stress and endothelial cell injury during hepatic ischemia-reperfusion. Targeting the LECT2/Tie1/Src signaling pathway may offer a novel therapeutic strategy for mitigating liver IRI in clinical settings.

Key Words: Leukocyte-derived chemotaxin-2; Tie1; Src kinase; Endothelial cells; Oxidative stress; Ischemia-reperfusion injury; Liver injury

Core Tip: This study elucidates a novel signaling mechanism in which leukocyte-derived chemotaxin-2 exacerbates hepatic ischemia-reperfusion injury by binding to Tie1 and activating Src kinase, thereby amplifying oxidative stress and endothelial cell damage. Targeting the leukocyte-derived chemotaxin-2/Tie1/Src axis represents a promising therapeutic strategy for mitigating liver ischemia-reperfusion injury, offering potential translational applications in liver surgery and transplantation.



INTRODUCTION

Ischemia-reperfusion-induced liver injury (IRI) is a significant clinical problem following liver resection or transplantation. Key clinical features of hepatic ischemia-reperfusion injury include the failure of sinusoidal perfusion, leukocyte-endothelial cell interactions, loss of cellular integrity, and edema formation leading to microvascular dysfunction, characterized by imbalances in vasodilation and contraction, increased vascular permeability, endothelial cell inflammation, and activation of the coagulation and complement systems[1,2].

Endothelial cells secrete various signaling factors that induce inflammatory cell infiltration and cytokine production and play critical regulatory roles in ischemia-reperfusion injury. Liver sinusoidal endothelial cells (LSECs) are particularly vulnerable to ischemia-reperfusion injury, which disrupts their plasma membranes, causes nuclear vacuolation, and changes cell shape. During ischemia, LSECs and Kupffer cells exhibit edema, decreased nitric oxide bioavailability, and increased endothelin and thromboxane A2 production, leading to sinusoidal narrowing and microcirculatory dysfunction. During reperfusion, decreased nitric oxide levels, caused by reduced reactive oxygen species (ROS) production and clearance, regulate the extent of ischemia-reperfusion injury by modulating neutrophil adhesion, platelet aggregation, and hepatic stellate cell contraction. Dysfunctional LSECs activate Kupffer cells, promoting the release of ROS and proinflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-1 (IL-1), interferon-gamma, and IL-12. TNF-α stimulates intracellular adhesion molecule-1 expression on LSECs, facilitating neutrophil rolling, binding, and extravasation. It also induces P-selectin expression, further promoting neutrophil recruitment and adhesion to liver sinusoids. Extensive evidence indicates that endothelial cell damage is the initial factor leading to hepatic IRI, resulting in poor microcirculation, platelet activation, persistent vasoconstriction, upregulation of adhesion molecules, oxidative stress, Kupffer cell activation, neutrophil infiltration, and hepatocyte death[3-5].

The regulatory mechanisms underlying endothelial cell hypoxia-reoxygenation injury remain unclear. Leukocyte-derived chemotaxin-2 (LECT2) has been implicated in multiple physiological and pathological processes, including sepsis, diabetes, liver cancer, nonalcoholic fatty liver disease, and hematopoietic stem cell homeostasis. Previous work from our group identified LECT2 as a functional ligand for the orphan receptor Tie1 in endothelial cells, revealing a novel LECT2/Tie1 signaling axis that regulates liver fibrosis by modulating hepatic vascular function and remodeling[6,7]. Recently, we reported that LECT2 exacerbates liver IRI; however, the precise mechanism remains elusive. This study revealed that LECT2 binds to Tie1 and activates Src kinase, thereby regulating oxidative stress responses in endothelial cells under hypoxic conditions and play a critical role in liver IRI. Targeting the LECT2/Tie1 signaling pathway may have therapeutic potential for treating clinical liver IRI.

MATERIALS AND METHODS
Cell line

EA.hy926 cells (ATCC number: CRL-2922, RRID) were sourced from the American Type Culture Collection. These cells were maintained in DMEM (GIBCO, NY, United States) supplemented with 10% foetal bovine serum and incubated at 37 °C in a humidified environment containing 5% CO2. The identity of the cell lines has been verified.

Reagents

His tagged recombinant LECT2 (rLECT2) protein and GST tagged recombinant Tie1-Ig3 protein were prepared as previous[6]. Src inhibitor dasatinib (BMS-354825) was purchased from Selleck, TX, United States (Cat. No. S1021). The following primary antibodies were used for western blotting: Anti-mTOR (7C10) (Cell Signaling Technology, MA, United States; Cat. No. 2983T), anti-Phospho-mTOR (Ser2448) (D9C2) (Cell Signaling Technology, MA, United States; Cat. No. 5536T), anti-Src (Cell Signaling Technology, MA, United States; Cat. No. 2109), anti-Phospho-Src (Y416) (Cell Signaling Technology, MA, United States; Cat. No. 2101), anti-LECT2 (SantaCruz, TX, United States; Cat. No. sc-398071), anti-β-actin (Proteintech, IL, United States; Cat. No. 20536).

Second antibodies: Goat Anti-Rabbit IgG (H + L) Secondary Antibody, HRP Conjugate, (Boster, China; BA1054); Goat Anti-Mouse IgG (H + L) Secondary Antibody, HRP Conjugate (Boster, China; BA1050).

Mice

LECT2 knockout mice (Lect2-/-) were produced using the CRISPR/Cas9 technique, with the genotype previously verified[6]. Genomic DNA was extracted and amplified using specific primers (forward: 5’-GTGAGACTTAGATGTGGGAAGTTCCTG-3’, reverse: 5’-CACCCTGAGGTATTCAGGCCATTAT-3’). All experiments utilized male mice, housed under specific-pathogen-free conditions with a 12-hour light-dark cycle and unlimited access to food and water. Animal protocols adhered to the United States Public Health Service Policy on Laboratory Animal Use and were approved by the Animal Ethics Committee of Nanfang Hospital, No. NFYY-2018-031.

For the hepatic ischemia-reperfusion model, male mice aged 6-8 weeks were fasted for 12 hours and anesthetized with isoflurane. A midline abdominal incision (3-5 cm) exposed the portal vein. The hepatic portal was separated from surrounding tissues, and a microvascular clamp blocked the portal triad structures (hepatic artery, portal vein, and bile duct) of the left and median lobes, confirmed by the lobes turning white. After 60 minutes of ischemia, reperfusion was initiated by removing the clamp, leading to an immediate color change in the median and left lateral lobes. The incision was closed with a two-layer suture technique, and disinfectant was applied to reduce infection risk. Mice were placed in heated, clean cages, and samples were collected at reperfusion times of 0.5, 6 and 24 hours.

Immunohistochemistry

Mouse liver tissues were fixed and sectioned into 2.5 mm thick slices. The sections were incubated in a citrate buffer (pH 6.0) at 120 °C for 5 minutes. Endogenous peroxidase activity was blocked by treating the sections with 0.3% H2O2 for 10 minutes. To block non-specific binding, the slides were incubated with 5% bovine serum albumin in phosphate buffered saline at 37 °C for 30 minutes. The sections were then incubated overnight at 4 °C with the primary antibody, anti-lymphatic vessel endothelial hyaluronic acid receptor 1 (anti-LYVE1, Abcam, United Kingdom; Cat. No. ab14917). Following this, the sections were incubated for 1 hour with an HRP-conjugated anti-rabbit IgG secondary antibody. Detection was performed using a DAB substrate kit (ORIGENE, United States; ZLI-9019).

Quantitative reverse transcription-polymerase chain reaction

Total RNA from EA.hy926 cells or mouse livers was extracted and reverse transcribed. The resulting complementary DNAs were used for polymerase chain reaction (PCR) with the SYBR-Green Master PCR Mix (Accurate Biology, Hunan Province, China). All PCR reactions were conducted in triplicate using the Quant Studio 3 qPCR System (Thermo Scientific, MA, United States; Quant Studio 3). The data for each sample were normalized to the endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) controls. Primers for quantitative PCR were as following. Human LECT2, forward: GCTGGTCTGATTTCTACCGCA, reverse: CCAGCAGAGCACAAGATGTC; human Tie1, forward: AATGCCGCGTATCGACTTCT, reverse: AATGCCGCGTATCGACTTCT; human GAPDH, forward: ACATGTTCCAATATGATTCCACC, reverse: TACTCCTTGGAGGCCATGTG; human TNF-α forward: CTCTTCTGCCTGCTGCACTTTG, reverse: ATGGGCTACAGGCTTGTCACTC; mouse IL-6, forward: 5’-GCTACCAAACTGGATATAATCAGGA-3’, reverse: 5’-CCAGGTAGCTATGGTACTCCAGAA-3’; mouse TNF-α, forward: 5’-AGCCCACGTAGCAAACCACCAA-3’, reverse: 5’-ACACCCATTCCCTTCACAGAGCAAT-3’; mouse IL-1β, forward: 5’-TGACCTGGGCTGTCCAGATG-3’, reverse: 5’-CTGTCCATTGAGGTGGAGAG-3’; mouse GAPDH, forward: AGAAGGTGGTGAAGCAGGCATC, reverse: CGAAGGTGGAAGAGTGGGAGTTG.

Hypoxia-reoxygenation cell experiment

EA.hy926 cells were cultured until they reached 80%-90% confluency. The complete medium in the culture dishes was then replaced with serum-free medium. These dishes were placed in an anaerobic jar, and an anaerobic gas-generating packet was added, along with an oxygen indicator. The jar was sealed tightly to ensure an anaerobic environment. After 8 hours of hypoxia, the samples were removed, the medium was replaced with complete medium, and the dishes were returned to the incubator. Cell samples were collected at 0, 1, 4, 8, 16, 32, 40, and 48 hours post-reoxygenation for further analysis.

Cell counting kit-8 cell viability assay

Post-reoxygenation, the culture medium was discarded, and cell counting kit-8 reagent (Promega, WI, United States; Cat. No. G7570) diluted 1:9 with serum-free medium was added, 100 μL per well. Blank and control wells were included. Plates were incubated at 37 °C in a humidified incubator for 1 hour, protected from light. Absorbance at 450 nm was measured using a microplate reader to assess cell viability.

LDH-Glo™ cytotoxicity assay

The LDH-Glo™ cytotoxicity assay (Promega, WI, United States; Cat. No. J2380) was performed to measure lactate dehydrogenase release due to cell membrane damage. Cells were collected into 1.5 mL Eppendorf tubes and centrifuged at 4 °C, 250 g for 5 minutes. Supernatants were used as test samples, with positive and blank controls set up. 50 μL of the sample and 50 μL of the reaction substrate were added to each well and incubated on a shaker in the dark for 25 minutes. Subsequently, 50 μL of stop solution was added to each well and incubated for an additional minute on a shaker in the dark. Absorbance at 490 nm was measured using a microplate reader to evaluate cytotoxicity.

Total superoxide dismutase detection

Total superoxide dismutase (SOD) activity was measured using the Total SOD Activity Detection Kit (Beyotime, China; Cat. No. S0101M). Cells were washed once with 4 °C phosphate buffered saline buffer and lysed with 200 μL of protein lysis buffer. The lysate was transferred to a 1.5 mL Eppendorf tube with two steel beads, agitated in a tissue grinder at 4 °C for 10 seconds, and centrifuged at 4 °C, 12000 rpm for 5 minutes. The supernatant was used for the SOD activity assay.

ROS detection

Intracellular ROS levels were measured using an ROS assay kit (Beyotime, China; S0033S) according to the manufacturer’s instructions. The nonfluorescent probe DCFH-DA passively enters cells and is hydrolyzed by intracellular esterases to form DCFH, which is subsequently oxidized by ROS to generate fluorescent DCF. Fluorescence intensity was measured at excitation and emission wavelengths of 488 nm and 525 nm, respectively. Values were normalized to the control group (set as 1), and relative fluorescence intensities were compared between groups.

TUNEL assay for cell apoptosis detection

Cell apoptosis was detected using the TUNEL Cell Apoptosis Detection Kit (Beyotime, China; Cat. No. C1098). This kit labels the terminal end of nucleic acids to detect DNA fragmentation, a hallmark of apoptosis. The assay was performed according to the manufacturer’s instructions to ensure accurate and reliable results.

Statistical analysis

Data were analyzed using GraphPad Prism 8 software. Comparisons between two groups were performed using unpaired or paired Student’s t-test, as appropriate. For comparisons involving multiple treatment groups against a control group, one-way or two-way ANOVA was used, followed by Dunnett’s multiple comparison test. All data are presented as mean ± SEM. A P value < 0.05 was considered statistically significant.

RESULTS
LECT2 knockdown mitigates hypoxia-reoxygenation injury in EA.hy926 cells

Small interfering RNA was employed to silence LECT2 expression in EA.hy926 cells (Figure 1A and B). Following 8 hours of hypoxia, cell proliferation, oxidative stress, and cytotoxicity markers were assessed at various reoxygenation time points. Compared with the control group, LECT2 knockdown in EA.hy926 cells resulted in significantly increased proliferation at 1 hour post-reoxygenation (Figure 1C). Furthermore, LECT2 knockdown cells exhibited a markedly reduced oxidative stress response compared to control cells during the reoxygenation phase (Figure 1D and E). Cytotoxicity, measured by lactate dehydrogenase release, was significantly lower in LECT2 knockdown cells compared to controls (Figure 1F). These results suggest that silencing the LECT2 gene enhances the resilience of EA.hy926 cells to hypoxia-reoxygenation injury.

Figure 1
Figure 1 Knockdown of leukocyte-derived chemotaxin-2 mitigates and recombinant-leukocyte-derived chemotaxin-2 aggravates hypoxia-reoxygenation injury in EA.hy926 cells. A: MRNA expression of leukocyte-derived chemotaxin-2 (LECT2) decreased after transfection with LECT2-small interfering RNA (siRNA) into EA.hy926 cells. Student’s t-test; B: Protein level of the LECT2 decreased after transfection with LECT2-siRNA into EA.hy926 cells; C: A cell counting kit 8 assay was used to assess cell proliferation capacity at different time points during reoxygenation after 8 hours of hypoxia. Student’s t-test; D: Superoxide dismutase activity was measured at different time points during reoxygenation after 8 hours of hypoxia to assess the level of cellular oxidative stress. Student’s t-test; E: Reactive oxygen species levels were measured in EA.hy926 cells at 8 hours post-reoxygenation following treatment with LECT2-siRNA or control siRNA. Student’s t-test; F: Lactate dehydrogenase levels were measured at different time points during reoxygenation after 8 hours of hypoxia to assess cellular cytotoxicity. Student’s t-test; G: A cell counting kit assay was used to assess cell proliferation capacity at different time points during reoxygenation after 8 hours of hypoxia. Two-way ANOVA; H: Superoxide dismutase activity was measured at different time points during reoxygenation after 8 hours of hypoxia to assess the level of cellular oxidative stress. Two-way ANOVA; I: Reactive oxygen species levels were measured in EA.hy926 cells at 8 hours post-reoxygenation following treatment with recombinant LECT2 or phosphate buffered saline. Student’s t-test; J: Lactate dehydrogenase levels were measured at different time points during reoxygenation after 8 hours of hypoxia to assess cellular cytotoxicity. Two-way ANOVA. Data are representative of three independent experiments. All data are presented as the mean ± SEM. aP < 0.05, bP < 0.01, cP < 0.0001, and dP < 0.05 vs phosphate buffered saline. LECT2: Leukocyte-derived chemotaxin-2; siRNA: Small interfering RNA; PBS: Phosphate buffered saline; ROS: Reactive oxygen species; SOD: Superoxide dismutase; H/R: Hypoxia/reoxygenation.
rLECT2 aggravates hypoxia-reoxygenation injury in EA.hy926 cells

Human rLECT2 was used at three concentration gradients, which were added to the cell culture medium immediately after hypoxia-reoxygenation. Various indicators were measured at specific timepoints. The results demonstrated that the addition of rLECT2 protein led to decreased proliferation capacity in EA.hy926 cells (Figure 1G), exacerbated oxidative stress response (Figure 1H and I), and increased expression of cytotoxicity markers (Figure 1J).

Tie1 knockdown reduces LECT2-induced hypoxia-reoxygenation injury in EA.hy926 cells

Our previous studies identified LECT2 as a functional ligand of the receptor Tie1. To investigate whether LECT2 exerts its effects through Tie1[6], we used small interfering RNA to knockdown Tie1 expression in EA.hy926 cells (Figure 2A and B). The results showed that Tie1 knockdown alone did not affect hypoxia-reoxygenation injury in EA.hy926 cells. However, rLECT2 significantly increased hypoxia-reoxygenation injury in control EA.hy926 cells but did not exacerbate injury in Tie1 knockdown EA.hy926 cells (Figure 2C-E).

Figure 2
Figure 2 Tie1 knockdown or Tie1-Ig3 treatment reduces leukocyte-derived chemotaxin-2-induced hypoxia-reoxygenation injury in EA.hy926 cells. A: MRNA expression of the Tie1 decreased after transfection with siTie1 RNA into EA.hy926 cells. Student’s t-test; B: Protein expression of the Tie1 decreased after transfection with Tie1-small interfering RNA (siRNA) into EA.hy926 cells; C: A cell counting kit-8 assay was used to measure cell proliferation capacity in the siTie1 group and Tie1-siRNA + recombinant leukocyte-derived chemotaxin-2 (rLECT2) group at different time points during reoxygenation after 8 hours of hypoxia. Two-way ANOVA; D: Superoxide dismutase activity was measured in the siTie1 group and Tie1-siRNA + rLECT2 group at different time points during reoxygenation after 8 hours of hypoxia to determine the level of cellular oxidative stress. Two-way ANOVA; E: Lactate dehydrogenase release was measured in the siTie1 group and Tie1-siRNA + rLECT2 group at different time points during reoxygenation after 8 hours of hypoxia to assess cellular cytotoxicity. Two-way ANOVA; F: A cell counting kit 8 assay was used to assess cell proliferation capacity at different time points during reoxygenation after 8 hours of hypoxia. Two-way ANOVA; G: Superoxide dismutase activity was measured at different time points during reoxygenation after 8 hours of hypoxia to assess the level of cellular oxidative stress. Two-way ANOVA; H: Lactate dehydrogenase levels were measured at different time points during reoxygenation after 8 hours of hypoxia to assess cellular cytotoxicity. Two-way ANOVA. Data are representative of three independent experiments. All data are presented as the mean ± SEM. aP < 0.05, bP < 0.01, and cP < 0.001. rLECT2: Recombinant leukocyte-derived chemotaxin-2; siRNA: Small interfering RNA; H/R: Hypoxia/reoxygenation.
Tie1-Ig3 blocks rLECT2-induced hypoxia-reoxygenation injury in EA.hy926 cells

Our previous research demonstrated that LECT2 directly binds to the Tie1-Ig3 segment. The recombinant Tie1-Ig3 segment protein (Tie1-Ig3) can block the LECT2/Tie1 interaction, thereby inhibiting downstream signal transduction[6]. We used the Tie1-Ig3 to observe changes in various indicators at specific timepoints. The results showed that the addition of the Tie1-Ig3 reduced the hypoxia-reoxygenation injury caused by rLECT2 in EA.hy926 cells (Figure 2F-H).

LECT2/Tie1 signaling promotes Src phosphorylation

Src family kinases are key mediators of endothelial barrier dysfunction and inflammatory responses, and have been implicated in various models of IRI. The mTOR pathway, a downstream effector of PI3K/Akt signaling, is also known to intersect with Src in regulating endothelial cell survival and oxidative stress responses[8,9]. However, whether these kinases are involved in LECT2/Tie1-mediated endothelial injury during hepatic IRI remains unknown. To investigate this, we examined the activation of mTOR and Src in EA.hy926 cells subjected to hypoxia-reoxygenation. The results showed that in the hypoxia-reoxygenation injury model of EA.hy926 cells, LECT2 knockdown did not alter the protein levels and phosphorylation levels of mTOR, but reduced the phosphorylation levels of Src without affecting its protein levels (Figure 3A). Conversely, rLECT2 treatment did not affect mTOR protein or phosphorylation levels but did increase Src phosphorylation levels (Figure 3B). Tie1-Ig3 treatment similarly reduced Src phosphorylation levels (Figure 3C).

Figure 3
Figure 3 Leukocyte-derived chemotaxin-2/Tie1 signaling promotes Src phosphorylation. A: EA.hy926 cells were subjected to hypoxia-reoxygenation injury after transfection with leukocyte-derived chemotaxin-2 (LECT2)-small interfering RNA. Cell lysates were immunoblotted with indicated antibodies; B: Recombinant LECT2 was added to EA.hy926 cells, and the cell lysates were immunoblotted with the indicated antibodies; C: Recombinant LECT2 and rTie1-Ig3 were simultaneously added to EA.hy926 cells. Cell lysates were immunoblotted with the indicated antibodies; D: Dasatinib and recombinant LECT2 were simultaneously added to EA.hy926 cells. Cell lysates were immunoblotted with the indicated antibodies; E: A cell counting kit-8 assay was used to assess cell proliferation capacity at different time points during reoxygenation after 8 hours of hypoxia. Two-way ANOVA; F: Superoxide dismutase activity was measured at different time points during reoxygenation after 8 hours of hypoxia to assess the level of cellular oxidative stress. Two-way ANOVA; G: Lactate dehydrogenase levels were measured at different time points during reoxygenation after 8 hours of hypoxia to assess cellular cytotoxicity. Data are representative of three independent experiments. One-way ANOVA; H: EA.hy926 cells were subjected to hypoxia-reoxygenation injury and treated with recombinant LECT2 in the presence or absence of dasatinib. After 24 hours, tumor necrosis factor-α mRNA levels were measured. One-way ANOVA. All data are presented as the mean ± SEM. aP < 0.05, bP < 0.01. rLECT2: Recombinant leukocyte-derived chemotaxin-2; siRNA: Small interfering RNA; PBS: Phosphate buffered saline; H/R: Hypoxia/reoxygenation; TNF-α: Tumor necrosis factor-α; SOD: Superoxide dismutase.
Src inhibitor alleviates hypoxia-reoxygenation injury in EA.hy926 cells

To determine the role of Src kinase activation in LECT2/Tie1-mediated regulation of hypoxia-reoxygenation injury in EA.hy926 cells, the Src inhibitor dasatinib was applied. Dasatinib significantly inhibited rLECT2-induced Src phosphorylation (Figure 3D). Furthermore, dasatinib blocked the effects of rLECT2 on cell proliferation, oxidative stress, and cytotoxicity (Figure 3E-G) and reduced rLECT2-induced expression of the inflammatory marker TNF-α (Figure 3H). These results indicate that LECT2 regulates hypoxia-reoxygenation injury in EA.hy926 cells by activating Src.

LECT2 knockout mice exhibit reduced hepatic ischemia-reperfusion injury and sinusoidal endothelial cell damage

Src-mediated endothelial dysfunction is a critical initiator of vascular inflammation in vivo. Upon activation, Src promotes endothelial hyperpermeability and upregulation of adhesion molecules, facilitating leukocyte recruitment and transendothelial migration. Infiltrating leukocytes then amplify local inflammation through release of ROS and pro-inflammatory cytokines, which in turn can further activate Src signaling in endothelial cells via direct cell-cell interactions, creating a positive feedback loop that perpetuates tissue injury[10-12].

To investigate the role of LECT2 in vivo, we subjected Lect2-/- mice to a hepatic IRI model. Compared with wild-type control mice, Lect2-/- mice exhibited reduced apoptosis and decreased expression of IL-1b, IL-6, and TNF-α, indicating lower levels of liver injury and inflammatory factors (Figure 4A-F). Normal hepatic sinusoidal endothelial cells highly express LYVE1, whereas damaged cells have reduced or absent LYVE1 expression. Lect2-/- mice exhibited significantly higher LYVE1 expression after ischemia-reperfusion compared to wild-type control mice (Figure 4G and H), indicating that endothelial cells in Lect2-/- mice are less damaged during ischemia-reperfusion.

Figure 4
Figure 4 Lect2-/- mice exhibit reduced hepatic ischemia-reperfusion injury and sinusoidal endothelial cell damage. Livers from Lect2-/- mice and their littermate controls were clamped with the hepatic pedicle for 1 hour followed by reperfusion. Serum and liver tissue samples were collected at the indicated time points. A: TUNEL staining of livers showed apoptosis. Bar, 100 mm; B: Quantification of apoptosis. Student’s t-test; C: Liver tissue lysates from Lect2-/- mice and littermate wild type controls were collected 6 hours after hepatic ischemia-reperfusion injury (1 hour clamping/6 hours reperfusion) and immunoblotted with indicated antibodies; D-F: MRNA levels of interleukin-1β, interleukin-6, and tumor necrosis factor-α in liver tissues. Student’s t-test; G: Lymphatic vessel endothelial hyaluronic acid receptor 1 staining of livers showed apoptosis. Bar, 100 mm; H: Quantification of cell lymphatic vessel endothelial hyaluronic acid receptor 1 staining. Data are representative of three independent experiments. Student’s t-test. n = 6/group. All data are presented as the mean ± SEM. aP < 0.05, bP < 0.01. Lect2: Leukocyte-derived chemotaxin-2; WT: Wild type; H/R: Hypoxia/reoxygenation; IL: Interleukin; TNF-α: Tumor necrosis factor-α; LYVE1: Lymphatic vessel endothelial hyaluronic acid receptor 1.
DISCUSSION

In this study, we demonstrate that LECT2 exacerbates hypoxia-reoxygenation injury in endothelial cells by binding to Tie1 and activating Src kinase, thereby aggravating hepatic IRI. LECT2 knockdown reduced endothelial cell damage, whereas recombinant LECT2 exacerbated it. Tie1 knockdown, blockade of LECT2/Tie1 binding using recombinant Tie1-Ig3 protein, and Src inhibitors all mitigated hypoxia-reoxygenation injury in endothelial cells. LECT2 gene knockout mice exhibited reduced liver IRI and endothelial cell injury. The results of this study revealed a novel mechanism by which the LECT2/Tie1/Src signaling pathway regulates hypoxia-reoxygenation injury in endothelial cells, providing new targets and strategies for treating hepatic IRI.

Hepatic IRI progresses through four stages: The ischemia-hypoxia stage, early reperfusion stage, reperfusion injury stage, and repair stage. Initially, the liver is exposed to a hypoxic environment, with LSECs as the primary cells to suffer initial damage. Their barrier function is compromised, vascular permeability increases, and hepatocytes are immediately damaged, with cellular activities gradually becoming disordered. During the early reperfusion stage, oxidative stress intensifies, with massive ROS production further aggravating LSEC and hepatocyte damage, even leading to cell death. In the subsequent injury stage, macrophages are activated, neutrophils accumulate in large numbers, and a cascade of inflammatory responses occurs, exacerbating hepatocyte damage and death. Finally, during the repair stage, hepatic stellate cells and immune cells jointly promote liver recovery[13-18]. In this study, hematoxylin and eosin staining was used to assess and quantify necrotic areas, and TUNEL staining was performed to label apoptotic cells, demonstrating that deletion of the LECT2 gene significantly reduced necrosis and apoptosis during hepatic IRI.

Endothelial cells are the first to be damaged after ischemia-reperfusion or cellular hypoxia-reoxygenation. LSEC dysfunction following IRI is the initial factor leading to hepatic IRI, determining subsequent vascular contraction, oxidative stress, inflammatory responses, and hepatocyte death[3,4]. Our previous studies demonstrated that LECT2/Tie1 signaling regulates endothelial cell migration and tubule formation. Here, we further show that LECT2/Tie1 signaling activates Src kinase, regulating hypoxia-reoxygenation injury in endothelial cells. Src, encoded by the SRC gene, is a nonreceptor tyrosine kinase specific to tyrosine residues in the cytoplasm. Tyrosine kinases are usually regulated, with low basal activity, and are transiently activated by specific stimuli[19]. The major phosphorylation sites of Src include tyrosine 416, which leads to autophosphorylation activation, and tyrosine 527, which inhibits C-terminal Src kinase phosphorylation. Src phosphorylation at tyrosine 416 enhances kinase activity[10]. Src plays a crucial role in regulating cell proliferation, differentiation, survival, metabolism, and other essential cellular functions. It is vital for barrier regulation and endothelial cell angiogenesis. During hepatic IRI and cellular hypoxia-reoxygenation injury, the balance between Src phosphorylation and dephosphorylation affects inflammatory responses and apoptosis. ROS levels can activate Src protein tyrosine kinases, dephosphorylate tyrosine phosphatases, inhibit their activity, and prolong Src protein tyrosine kinase activity[11,12]. Src family kinases are regulated by multiple receptors, including protein tyrosine kinase receptors. Tie1 is a tyrosine kinase that plays an essential role in angiogenesis and homeostasis[6,20-23]. Further research is required to determine how Tie1 regulates Src kinase activation.

Our previous work identified LECT2 as a functional Tie1 Ligand that disrupts Tie1/Tie2 heterodimerization and promotes Tie2 homodimerization[6]. This raises the possibility that Tie2 may also contribute to LECT2-mediated signaling in hepatic IRI. Systematic evaluation of Tie2 expression and activation in response to LECT2 stimulation represents an important direction for future studies to fully delineate the angiopoietin-Tie interplay in this context.

The translational potential of targeting the LECT2/Tie1/Src axis in hepatic IRI is supported by several factors: LECT2 is a secreted hepatokine amenable to antibody neutralization, Tie1 exhibits endothelial-specific expression, and Food and Drug Administration-approved Src inhibitors (e.g., dasatinib) are clinically available for potential repurposing. However, several limitations warrant consideration. First, species-specific differences in LECT2/Tie1 signaling between rodents and humans require validation in human tissues and large-animal models. Second, systemic Src inhibition carries off-target risks given Src’s pleiotropic roles in cell proliferation, survival, and metabolism across multiple cell types. Third, our use of the EA.hy926 cell line, while useful for mechanistic studies, may not fully recapitulate primary LSEC phenotypes, necessitating future validation in primary cells.

Our proof-of-concept study demonstrates that Tie1-Ig3 recombinant protein effectively blocks LECT2/Tie1 binding and alleviates endothelial injury. While these findings suggest that disrupting this interaction may represent a therapeutic strategy, we acknowledge that this approach requires extensive further validation. Future efforts should focus on optimizing Tie1-Ig3, evaluating its efficacy and safety in vivo, and assessing potential off-target effects. Concurrent screening for small-molecule inhibitors targeting the LECT2/Tie1 interface may provide alternative therapeutic avenues. Until such rigorous preclinical validation, including assessment of specificity, bioavailability, and long-term safety, is completed, conclusions regarding clinical applicability remain speculative.

CONCLUSION

In conclusion, this study demonstrates that the LECT2/Tie1/Src signaling axis plays a critical role in regulating oxidative stress response in endothelial cell and liver hepatic ischemia-reperfusion injury. Using a combination of in vitro and in vivo models, we establish that LECT2 exacerbates hypoxic damage by binding to Tie1 and activating Src. In contrast, disruption of this pathway, through genetic knockout, receptor blockade, or kinase inhibition, effectively mitigates cellular and organ injury. These findings not only reveal a previously unrecognized mechanism underlying endothelial dysfunction in liver IRI but also highlight the therapeutic potential of targeting the LECT2/Tie1 interface. Further development of specific inhibitors or biologics directed against this pathway may offer a promising strategy for clinical intervention in liver transplantation, resection, and other ischemia-associated hepatic conditions.

ACKNOWLEDGEMENTS

We thank Central Laboratory, Southern Medical University for providing facilities and technical support.

References
1.  Montalvo-Jave EE, Escalante-Tattersfield T, Ortega-Salgado JA, Piña E, Geller DA. Factors in the pathophysiology of the liver ischemia-reperfusion injury. J Surg Res. 2008;147:153-159.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 304]  [Cited by in RCA: 298]  [Article Influence: 16.6]  [Reference Citation Analysis (4)]
2.  Bilzer M, Gerbes AL. Preservation injury of the liver: mechanisms and novel therapeutic strategies. J Hepatol. 2000;32:508-515.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 148]  [Cited by in RCA: 127]  [Article Influence: 4.9]  [Reference Citation Analysis (0)]
3.  Peralta C, Jiménez-Castro MB, Gracia-Sancho J. Hepatic ischemia and reperfusion injury: effects on the liver sinusoidal milieu. J Hepatol. 2013;59:1094-1106.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 537]  [Cited by in RCA: 520]  [Article Influence: 40.0]  [Reference Citation Analysis (2)]
4.  McConnell MJ, Kostallari E, Ibrahim SH, Iwakiri Y. The evolving role of liver sinusoidal endothelial cells in liver health and disease. Hepatology. 2023;78:649-669.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 34]  [Cited by in RCA: 141]  [Article Influence: 47.0]  [Reference Citation Analysis (0)]
5.  Kalogeris T, Baines CP, Krenz M, Korthuis RJ. Ischemia/Reperfusion. Compr Physiol. 2017;7:113-170.  [PubMed]  [DOI]  [Full Text]
6.  Xu M, Xu HH, Lin Y, Sun X, Wang LJ, Fang ZP, Su XH, Liang XJ, Hu Y, Liu ZM, Cheng Y, Wei Y, Li J, Li L, Liu HJ, Cheng Z, Tang N, Peng C, Li T, Liu T, Qiao L, Wu D, Ding YQ, Zhou WJ. LECT2, a Ligand for Tie1, Plays a Crucial Role in Liver Fibrogenesis. Cell. 2019;178:1478-1492.e20.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 203]  [Cited by in RCA: 190]  [Article Influence: 27.1]  [Reference Citation Analysis (0)]
7.  Dong MQ, Xie Y, Tang ZL, Zhao XW, Lin FZ, Zhang GY, Huang ZH, Liu ZM, Lin Y, Liu FY, Zhou WJ. Leukocyte cell-derived chemotaxin 2 (LECT2) regulates liver ischemia-reperfusion injury. Liver Res. 2024;8:165-171.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
8.  Okutani D, Lodyga M, Han B, Liu M. Src protein tyrosine kinase family and acute inflammatory responses. Am J Physiol Lung Cell Mol Physiol. 2006;291:L129-L141.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 119]  [Cited by in RCA: 142]  [Article Influence: 7.1]  [Reference Citation Analysis (0)]
9.  Pal R, Palmieri M, Loehr JA, Li S, Abo-Zahrah R, Monroe TO, Thakur PB, Sardiello M, Rodney GG. Src-dependent impairment of autophagy by oxidative stress in a mouse model of Duchenne muscular dystrophy. Nat Commun. 2014;5:4425.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 122]  [Cited by in RCA: 159]  [Article Influence: 13.3]  [Reference Citation Analysis (0)]
10.  Roskoski R Jr. Src protein-tyrosine kinase structure and regulation. Biochem Biophys Res Commun. 2004;324:1155-1164.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 377]  [Cited by in RCA: 432]  [Article Influence: 19.6]  [Reference Citation Analysis (0)]
11.  Zhang WJ, Li PX, Guo XH, Huang QB. Role of moesin, Src, and ROS in advanced glycation end product-induced vascular endothelial dysfunction. Microcirculation. 2017;24.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 33]  [Article Influence: 3.7]  [Reference Citation Analysis (0)]
12.  Zhang YW, Morita I, Shao G, Yao XS, Murota S. Screening of anti-hypoxia/reoxygenation agents by an in vitro model. Part 1: Natural inhibitors for protein tyrosine kinase activated by hypoxia/reoxygenation in cultured human umbilical vein endothelial cells. Planta Med. 2000;66:114-118.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 32]  [Article Influence: 1.2]  [Reference Citation Analysis (0)]
13.  Carden DL, Granger DN. Pathophysiology of ischaemia-reperfusion injury. J Pathol. 2000;190:255-266.  [PubMed]  [DOI]  [Full Text]
14.  Chen GY, Nuñez G. Sterile inflammation: sensing and reacting to damage. Nat Rev Immunol. 2010;10:826-837.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2542]  [Cited by in RCA: 2367]  [Article Influence: 147.9]  [Reference Citation Analysis (4)]
15.  Kolaczkowska E, Kubes P. Neutrophil recruitment and function in health and inflammation. Nat Rev Immunol. 2013;13:159-175.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4621]  [Cited by in RCA: 4162]  [Article Influence: 320.2]  [Reference Citation Analysis (4)]
16.  Kageyama S, Nakamura K, Fujii T, Ke B, Sosa RA, Reed EF, Datta N, Zarrinpar A, Busuttil RW, Kupiec-Weglinski JW. Recombinant relaxin protects liver transplants from ischemia damage by hepatocyte glucocorticoid receptor: From bench-to-bedside. Hepatology. 2018;68:258-273.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 33]  [Cited by in RCA: 52]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
17.  Schofield ZV, Woodruff TM, Halai R, Wu MC, Cooper MA. Neutrophils--a key component of ischemia-reperfusion injury. Shock. 2013;40:463-470.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 133]  [Cited by in RCA: 186]  [Article Influence: 14.3]  [Reference Citation Analysis (0)]
18.  Eltzschig HK, Carmeliet P. Hypoxia and inflammation. N Engl J Med. 2011;364:656-665.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1798]  [Cited by in RCA: 1662]  [Article Influence: 110.8]  [Reference Citation Analysis (2)]
19.  Thomas SM, Brugge JS. Cellular functions regulated by Src family kinases. Annu Rev Cell Dev Biol. 1997;13:513-609.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1956]  [Cited by in RCA: 1987]  [Article Influence: 71.0]  [Reference Citation Analysis (0)]
20.  Partanen J, Armstrong E, Mäkelä TP, Korhonen J, Sandberg M, Renkonen R, Knuutila S, Huebner K, Alitalo K. A novel endothelial cell surface receptor tyrosine kinase with extracellular epidermal growth factor homology domains. Mol Cell Biol. 1992;12:1698-1707.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 81]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
21.  Augustin HG, Koh GY, Thurston G, Alitalo K. Control of vascular morphogenesis and homeostasis through the angiopoietin-Tie system. Nat Rev Mol Cell Biol. 2009;10:165-177.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1229]  [Cited by in RCA: 1102]  [Article Influence: 64.8]  [Reference Citation Analysis (1)]
22.  Kim KL, Shin IS, Kim JM, Choi JH, Byun J, Jeon ES, Suh W, Kim DK. Interaction between Tie receptors modulates angiogenic activity of angiopoietin2 in endothelial progenitor cells. Cardiovasc Res. 2006;72:394-402.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 54]  [Cited by in RCA: 56]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
23.  Milner CS, Hansen TM, Singh H, Brindle NP. Roles of the receptor tyrosine kinases Tie1 and Tie2 in mediating the effects of angiopoietin-1 on endothelial permeability and apoptosis. Microvasc Res. 2009;77:187-191.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 19]  [Article Influence: 1.1]  [Reference Citation Analysis (2)]
Footnotes

Peer review: Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific quality: Grade B, Grade B

Novelty: Grade A, Grade B

Creativity or innovation: Grade B, Grade B

Scientific significance: Grade A, Grade B

P-Reviewer: Yan SY, PhD, Associate Professor, China; Zeng JQ, MD, Academic Fellow, Postdoc, China S-Editor: Wu S L-Editor: A P-Editor: Xu J

Write to the Help Desk