GATA2 deficiency exacerbates chronic liver injury via disrupting hepatocyte death-regeneration balance: Clinical, histopathological, and molecular evidence

Table 1 Primers used in this study

Name	Sequences (5’-3’)		Tm	CG (%)	Product length (bp)
HSPD1	Sense	AGGGTTCAAATGATTCTCCTGC	60.0	45.5	143
	Antisense	CAAGGTCAGGAGTTCAAGACCAG	60.7	52.2
PPARA	Sense	TGAACTCCTGACCTCAAGTGATC	58.3	47.8	114
	Antisense	CCAGGTACACAGAAAGCATTAACT	57.8	41.7
GPX4	Sense	GAGCAGTACCAGCCACCGTT	59.9	60.0	176
	Antisense	AGACCTCTCAACCCAGTGTCTG	58.1	54.5

GPX4: Glutathione peroxidase 4; HSPD1: Heat shock protein family D member 1; PPARA: Peroxisome proliferator-activated receptor alpha.

Table 2 Short hairpin RNA sequences used for in vivo knockdown of Gata2

	Sequences (5’ to 3’)
Gata2 target	GAATCGGAAGATGTCCAGCAA
Gata2 shRNA	GAATCGGAAGATGTCCAGCAACGAATTGCTGGACATCTTCCGATTC
Control shRNA	AAACGTGACACGTTCGGAGAACGAATTCTCCGAACGTGTCACGTTT

shRNA: Short hairpin RNA.

Table 3 Primary antibodies used in this study

Antibody	Source	Lot number	Manufacturer	Molecular weight (kDa)
Cleaved caspase-3	Rabbit mAb	9664	Cell Signaling Technology, Danvers, MA, United States	17
GAPDH	Mouse mAb	MAB45855	Bioswamp, Wuhan, China	36
GATA2	Mouse mAb	sc-267	Santa Cruz, TX, United States	50
GRP78	Rabbit mAb	ab108615	Abcam, Cambridge, MA, United States	78
GPX4	Mouse mAb	sc-166437	Santa Cruz, TX, United States	21
UCP2	Mouse mAb	sc-390189	Santa Cruz, TX, United States	70
HSP60	Mouse mAb	sc-376240	Santa Cruz, TX, United States	60
PCNA	Mouse mAb	sc-25280	Santa Cruz, TX, United States	36
MCAD	Mouse mAb	sc-365109	Santa Cruz, TX, United States	45
MLKL	Rabbit pAb	PA5-34733	Thermo Fisher Scientific, Waltham, MA, United States	54
PPARα	Mouse mAb	MA5-37652	Thermo Fisher Scientific, Waltham, MA, United States	55
p-MLKL	Rabbit mAb	37333S	Cell Signaling Technology, Danvers, MA, United States	54

GATA2: GATA binding protein 2; GRP78: Glucose-regulated protein 78; GPX4: Glutathione peroxidase 4; UCP2: Uncoupling protein 2; HSP60: Heat shock protein 60; PCNA: Proliferating cell nuclear antigen; MCAD: Medium chain acyl-CoA dehydrogenase; MLKL: Mixed lineage kinase domain-like protein; PPARα: Peroxisome proliferator-activated receptor alpha; p-MLKL: Phosphorylated mixed lineage kinase domain-like protein; mAb: Monoclonal antibody; pAb: Polyclonal antibody.

Table 4 Dynamic changes in the patient’s liver biochemical indexes

Date	ALT (U/L)	AST (U/L)	TBil (μmol/L)	DBil (μmol/L)	ALP (U/L)	GGT (U/L)	ALB (g/L)	GLB (g/L)
	Reference: 7-40	Reference: 13-35	Reference: 5-21	Reference: 0-3.4	Reference: 50-135	Reference: 7-45	Reference: 40-55	Reference: 20-40
December 3, 2021	73↑	53↑	115.1↑	56.4↑	166↑	153↑	28↓	26
December 5, 2021	51↑	43↑	106.4↑	49↑	158↑	129↑	27.6↓	27
December 9, 2021	26	34	83.2↑	38.8↑	149↑	118↑	27.7↓	26
December 12, 2021	21	32	76.9↑	35.1↑	131	105↑	30.9↓	24
December 14, 2021	15	27	84.4↑	39.7↑	142↑	97↑	28.7↓	27
December 17, 2021	13	26	73.3↑	31↑	150↑	85↑	33.8↓	25
August 4, 2022	21	26	15.4	4.5↑	176↑	62↑	37.4↓	25
August 6, 2022	44↑	15	20.9↑	5.5↑	157↑	48↑	32.5↓	19↓
August 8, 2022	76↑	26	20.3	6.2↑	153↑	45	32.7↓	19↓

“↑” indicates values above the normal range, and “↓” denotes values below the normal range. ALT: Alanine transaminase; AST: Aspartate aminotransferase; TBil: Total bilirubin; DBil: Direct bilirubin; ALP: Alkaline phosphatase; GGT: Gamma-glutamyl transferase; ALB: Albumin; GLB: Globulin.

Table 5 Dynamic changes in the patient's blood routine indexes

Date	WBC (× 109/L)	RBC (× 1012/L)	HB (g/L)	PLT (× 109/L)	NEUT (%)	Lym, %
	Reference: 3.5-9.5	Reference: 3.8-5.1	Reference: 115-150	Reference: 125-350	Reference: 0.40-0.75	Reference: 0.20-0.50
December 1, 2021	2.0↓	1.77↓	70↓	9↓	0.66	0.27
December 3, 2021	1.92↓	1.94↓	79↓	41↓	0.49	0.40
December 5, 2021	1.46↓	1.99↓	81↓	21↓	0.40	0.49
December 9, 2021	1.51↓	1.87↓	74↓	12↓	0.35↓	0.54↑
December 12, 2021	1.62↓	1.71↓	70↓	30↓	0.41	0.48
December 14, 2021	4.26	1.71↓	71↓	21↓	0.72	0.22
December 15, 2021	2.15↓	1.65↓	70↓	46↓	0.64	0.30

“↑” indicates values above the normal range, and “↓” denotes values below the normal range. WBC: White blood cell; RBC: Red blood cell; HB: Hemoglobin; PLT: Platelets; NEUT: Neutrophils; Lym: Percentage of lymphocytes.

Table 6 Dynamic changes in bone marrow examinations

Date	G/E	NRBC	MKC (a)	PLT (a)	LYM%	Bone marrow granules	Blood
June 19, 2020	1.39:1↓	Hyperplasia of active	11	Rare and scattered	Increased	Relatively full	White blood cells reduce
August 31, 2020	2.86:1	Hyperplasia of active	Not	Not	Increased	Not seen	White blood cells reduce
June 15, 2021	5.53:1↑	Hyperplasia of active	Not	Rare	Increased	Not seen	White blood cells reduce
January 18, 2022	1.72:1↓	Hyperplasia of active	Not	Not	Increased	Not seen	White blood cells reduce

G/E: Grain:red; NRBC: Nucleated red blood cell; MKC: Megakaryocyte; PLT: Platelets; LYM: Lymphatic ratio.

Table 7 Dynamic changes in serum-related iron indexes

Date	Zn, μmol/L	Cu, μmol/L	Fe, μmol/L	UIBC, μmol/L	TIBC, μmol/L
	Reference: 10.7-17.7	Reference: 12.56-23.55	Reference: 9-27	Reference: 22.4-57.8	Reference: 50-77
November 25, 2021	4.5↓	17.12	32.3↑	1.5↓	34↓
May 31, 2022	-	-	24.6	18.1↓	42.7↓

“↑” indicates values above the normal range, and “↓” denotes values below the normal range. UIBC: Unsaturated iron binding capacity; TIBC: Total iron binding capacity.

Table 8 Results of flow cytometric immunofluorescence analysis

Cell population	Percentage of total (%)	Cell series/phenotype analysis
Lymphoid	6.53	The relative ratio decreased
CD45 weakly expressed cells	5.75	Some of them were normally hyperplastic B progenitor cells
CD45 negative expression cells	24.57	They were mainly nucleated red cells and cell debris