Basic Study
Copyright ©The Author(s) 2019.
World J Stem Cells. Sep 26, 2019; 11(9): 705-721
Published online Sep 26, 2019. doi: 10.4252/wjsc.v11.i9.705
Table 1 List of primers
NamePrimer sequence
SOX2FTGCACCGCTACGACGTGA
RGGAGCCAAGAGCCATGCC
NANOGFTGCTGAGATGCCTCACACG
RTGCAGAAGTGGGTTGTTTGC
OCT4FGAAACCCACACTGCAGCAG
RGACCCAGCAGCCTCAAAATC
LIN28FGGATGTCTTTGTGCACCAGAGTA
RTGGATTCCAGACCCTTGGCT
ALBFTGCCTGTTGCCAAAGCTCG
RGCTACTGCCCATGCTTTGAAAG
AFPFGCAAACGATGAAGCAAGAGTTTC
RGCAGCATTTCTCCAACAGGC
AATFACTGGAACCTATGATCTGAAGAGC
RGCCTTATGCACGGCCTTGG
CYP3A4FGGATGAAAGAAAGTCGCCTCGA
RTCCAGATCGGACAGAGCTTTG
ACTBFCCTCGCCTTTGCCGATCC
RCATGCCGGAGCCGTTGT
Table 2 RNAseq data sources used in the bioinformatics analysis
Sample nameSRA numberInstrumentMemoRef.
AEC-1SRR9643783Illumina HiSeq 2500Primary AEC
AEC-2SRR9643784Illumina HiSeq 2500Primary AEC
MSC-1SRR6431450Illumina HiSeq 2000[44]
MSC-2SRR6431451Illumina HiSeq 2000[44]
hESC-1SRR4241924Illumina HiSeq 4000H9[45]
hESC-2SRR4241926Illumina HiSeq 4000H9[45]
NiPS-1SRR7592168Illumina HiSeq 2500Normal human iPSC[46]
NiPS-2SRR7592169Illumina HiSeq 2500Normal human iPSC[46]
DE-1SRR771468Illumina HiSeq 2000Definitive endoderm induced from H9[47]
DE-2SRR771469Illumina HiSeq 2000Definitive endoderm induced from H9[47]
hiHep-1SRR5974291Illumina HiSeq 2000Umbilical cord fibroblast derived hepatocyte-like like cell[8]
hiHep-2SRR5974292Illumina HiSeq 2000Umbilical cord fibroblast derived hepatocyte-like cell[8]
iPSCHLC-1SRR5974295Illumina HiSeq 2500iPSC-derived Hepatocyte-like cell[8]
iPSCHLC-2SRR5974296Illumina HiSeq 2500iPSC-derived hepatocyte-like cell[8]
Hepa-1SRR6176953Illumina HiSeq 2500Hepatocyte from clinical sample of adult[48]
Hepa-2SRR6176948Illumina HiSeq 2500Hepatocyte from clinical sample of adult[48]
Hepa-3SRR5974298Illumina HiSeq 2000Primary human hepatocyte 2 d[8]
Hepa-4SRR5974299Illumina HiSeq 2000Primary human hepatocyte 4 d[8]
Table 3 Stemness (upper)- and hepatic (lower) genes expressed in amniotic epithelial cells.
Gene symbolExplanationRef.
CD9CD9 belongs to the transmembrane 4 superfamily. It is associated with cell proliferation, motility, and adhesion and regulates hematopoietic differentiation[49]
TJP1Tight junction protein 1 is a determinant of plasma cell proteasome and is associated with EGFR, JAK1, and STAT3. It is regulated by TGF-b and involved with cell motility[30,50]
IGF2BP2This member of the insulin–like growth factor 2 mRNA-binding protein family participates in normal embryonic growth and development. It is expressed in the pancreas and associated with type 2 diabetes mellitus[51]
KRT19Keratin 19 is a cytoplasmic intermediate filament protein and belongs to the type 1 keratin family. It is used as a cholangiocyte marker and is not expressed in hepatocytes. It is associated with the progression of several cancers[31,32]
GRB7Growth factor receptor-bound protein 7 mediates signal transduction and cell migration. It is associated with the metastasis of several cancers[52]
KRT8Keratin 8 is a cytoplasmic intermediate filament protein of the type 2 keratin family. It is expressed in single layered epithelial cells. In cancer cells, it is associated with progression in the form of migration and adhesion[33]

Gene symbolExplanationRef.

ApoMApolipoprotein M (apoM) belongs to the lipocalin family. It is expressed in the liver and kidney. Hepatic apoM controls HDL metabolism[53,54]
CPS1Carbamoyl phosphate synthase 1 is a mitochondrial enzyme and participates in the first step of the urea cycle in the liver.[55]
SLC51AOrganic solute transporter subunit alpha is a bile acid transporter in the liver, small intestine, and kidney. It prevents the bile acid reflux[56]
IL6STInterleukin 6 signal transducer controls IL-6 and other cytokines such as IL-11, IL-27, oncostatin M, and leukemia inhibitory factor[57]
ACOX1Acyl-CoA oxidase 1 is a rate-limiting enzyme in fatty acid β-oxidation[58]
RXRaThe nuclear hormone receptor retinoid X receptor belongs to the steroid hormone receptor family. It is a key factor of cholesterol synthesis[59]
METMET encodes the hepatocyte growth factor (HGF) receptor and the key factor of hepatic regeneration. It activates epithelial migration and 3D morphogenesis[35,36]
ABCC2ATP binding cassette subfamily C member 2 is expressed in the hepatocytes and is a biliary transporter. It is also related to drug elimination and multidrug resistance in several cancers[60]
CYP1A1This member of the cytochrome P450 enzyme superfamily participates in fatty acid and steroid metabolism. It is associated with the detoxification of anthropogenic chemicals such as polycyclic aromatic hydrocarbons[61]