BPG is committed to discovery and dissemination of knowledge
Brief Article Open Access
©2010 Baishideng Publishing Group Co., Limited. All rights reserved.
World J Stem Cells. Aug 26, 2010; 2(4): 97-102
Published online Aug 26, 2010. doi: 10.4252/wjsc.v2.i4.97
Epigenetic states and expression of imprinted genes in human embryonic stem cells
Steven Shoei-Lung Li, Institute of Clinical Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan
Sung-Liang Yu, Department of Clinical Laboratory Sciences and Medical Biotechnology, National Taiwan University College of Medicine, Taipei 100, Taiwan
Sher Singh, Department of Life Science, College of Science, National Taiwan Normal University, Taipei 116, Taiwan
Author contributions: Li SS designed the experiments, analyzed data and wrote the manuscript; Yu SL supervised the analyses of the Microarray Core Facility of National Program for Genomic Medicine of NSC in Taiwan; Singh S performed bioinformatic analyses.
Supported by National Program for Genomic Medicine Grants NSC95/96/97-3112-B-037-002 of National Science Council in Taiwan (to Li SS); a Chair Professorship of The Medical Education and Development Foundation of Kaohsiung Medical University (to Li SS).
Correspondence to: Steven Shoei-Lung Li, PhD, Institute of Clinical Medicine, Kaohsiung Medical University, Kaohsiung 807, Taiwan. lissl@kmu.edu.tw
Telephone: 886-7-313-5162 Fax: 886-7-313-5162
Received: March 15, 2010
Revised: July 25, 2010
Accepted: August 2, 2010
Published online: August 26, 2010

Abstract

AIM: To investigate the epigenetic states and expression of imprinted genes in five human embryonic stem cell (hESC) lines derived in Taiwan.

METHODS: The heterozygous alleles of single nucleotide polymorphisms (SNPs) at imprinted genes were analyzed by sequencing genomic DNAs of hESC lines and the monoallelic expression of the imprinted genes were confirmed by sequencing the cDNAs. The expression profiles of 32 known imprinted genes of five hESC lines were determined using Affymetrix human genome U133 plus 2.0 DNA microarray.

RESULTS: The heterozygous alleles of SNPs at seven imprinted genes, IPW, PEG10, NESP55, KCNQ1, ATP10A, TCEB3C and IGF2, were identified and the monoallelic expression of these imprinted genes except IGF2 were confirmed. The IGF2 gene was found to be imprinted in hESC line T2 but partially imprinted in line T3 and not imprinted in line T4 embryoid bodies. Ten imprinted genes, namely GRB10, PEG10, SGCE, MEST, SDHD, SNRPN, SNURF, NDN, IPW and NESP55, were found to be highly expressed in the undifferentiated hESC lines and down-regulated in differentiated derivatives. The UBE3A gene abundantly expressed in undifferentiated hESC lines and further up-regulated in differentiated tissues. The expression levels of other 21 imprinted genes were relatively low in undifferentiated hESC lines and five of these genes (TP73, COPG2, OSBPL5, IGF2 and ATP10A) were found to be up-regulated in differentiated tissues.

CONCLUSION: The epigenetic states and expression of imprinted genes in hESC lines should be thoroughly studied after extended culture and upon differentiation in order to understand epigenetic stability in hESC lines before their clinical applications.

Key Words: DNA microarray; Imprinting; Single nucleotide polymorphism; Human embryonic stem cell



INTRODUCTION

Genomic imprinting, the parent-of-origin-specific silencing of genes, is an epigenetic modification that gives rise to differential expression of paternally and maternally inherited alleles of some genes. The imprinting is established afresh in the germ line in each generation and stably inherited throughout the somatic cell division[1-3]. Imprinted genes play important roles in human fetal and placental development and aberrant expression of imprinted genes is associated with human diseases including several cancers and a number of neurological disorders such as Prader-Willi syndrome[4-8].

Human embryonic stem cell (hESC) lines were derived from inner cell mass of blastocysts produced by in vitro fertilization using mitotically inactivated mouse embryonic fibroblast cells as feeder layer[9]. Thus far, many hESC lines have been derived and characterized (http://www.nih.gov/news/stemcell/). Because of the dual abilities to proliferate indefinitely and differentiate into various cell type derivatives of all three embryonic germ layers, ectoderm, mesoderm and endoderm, the hESC lines could potentially provide an unlimited supply of different cell types for transplantation therapy to treat a variety of degenerative diseases such as Parkinson’s disease, spinal cord injury, diabetes and heart failure[10-13].

In vitro fertilization has been reported to increase human diseases caused by aberrant genomic imprinting[14] and abnormal imprinting has also been reported in mouse embryonic stem cells[15]. Furthermore, a large number of the imprinting genes show discordance of their imprinting states between human and mouse[16]. Therefore, it is important to monitor and maintain epigenetic stabilities in hESC lines for transplantation purposes[13]. However, little is known about the epigenetic states and the expression profiles of imprinted genes in hESC lines following extended culture and upon differentiation. In the present study, the allele-specific expressions of seven imprinted genes in five hESC lines derived in Taiwan[17] were investigated using single nucleotide polymorphism (SNP) markers. In addition, the expression profiles of 32 known imprinted genes[16] in undifferentiated state and some of differentiated derivatives of these five hESC lines were analyzed using DNA microarray.

MATERIALS AND METHODS
Allele-specific expression of imprinted genes

Genomic DNAs (gDNA) were isolated using the Wizard SV Genomic DNA Purification System (Promega) and total RNAs were extracted using the Absolutely RNA Nanoprep Kit (Stratagene) from undifferentiated cells, embryoid bodies and/or teratomas of hESC lines. The cDNAs were synthesized using the ‘Microarray’ Target Amplification Kit and purified with ‘Microarray’ Target Purification Kit (Roche Applied Science). Polymerase chain reaction (PCR) amplification of genomic DNA and cDNA was carried out in a 25 uL reaction volume with 2 units of the Go Tag Flexi DNA polymerase (Promega), 1x supplied reaction buffer, 0.12 umol/L of each primer, 0.75 mmol/L MgCl2, 0.2 mmol/L of dNTPs and 10-200 ng DNA template. Cycle conditions are as follows: initial denaturation at 95°C for 2 min then 30 cycles of 95°C for 30 s, 55°C for 30 s and 72°C for 3 min followed by a final extension at 72°C for 5 min. Primer sequences are given in Table 1. Amplified DNA was purified using the Wizard SV Gel and PCR Clean-up System (Promega) and sequenced with the BigDye terminator cycle Sequencing Kit (3.1 version) and ABI 3730 DNA sequencer.

Table 1 Polymerase chain reaction primer sequences and polymorphisms.
GenePrimer sequence (5'3')Size (bp)SNPAcc. NoLocationRef.
IGF2F CTTGGACTTTGAGTCAAATTGG235G→AX07868[18]
R CCTCCTTTGGTCTTACTGGGPos. 820
IPWF GGGAACTCTTCTGGGAGTGAATGTTATCA1550C→TU12897[18]
R GGGAGGTTCATTGCACAGAAATTTGGPos. 1670
Seq. TGGATAGATGCACACAAACAC868
NESP55 gDNAF GGCTCCTTGTGCTGTCTGTCTTGTAG233T→CM21741[18]
R CCACACAAGTCGGGGTGTAGCTTAPos. 299
NESP55 cDNAF TCGGAATCTGACCACGCGCA1141
R CACGAAGATGATGGCAGTCAC
Seq. CAACCTGAAAGAGGCGATTGAA
PEG10F TCATTTTCCTGCCTGGTTGC405C→TXM_496907[19]
R GGAGCCTCTCATTCACAGCPos. 4404
KCNQ1 gDNAF CACTGCCTGCACTTTGAGCC282G→AAJ006345[19]
R GTGAGGAGAAGGGGGTGGTTPos. 331010
KCNQ1 cDNAF GGACCTGGAAGGGGAGACT282
R GCGATCCTTGCTCTTTTCT
ATP10AF AAAGACACCACCGACAGGAA318G→CBC052251This study
R ATGCTCATGTCCACTGTGCTPos. 4006
TCEB3CF CCAGAGCTGAGAGAAAGTGC249C→GNM_145653This study
R TTTCCTGGCGAGACGATTTGPos. 772
Expression profiling of imprinted genes in human embryonic stem cell lines

Five hESC lines were derived with IRB approval from surplus blastocysts in Taiwan and continuously cultured on mitotically inactivated mouse embryonic fibroblast feeder layer for more than 44 passages. hESC lines T1 and T3 possess normal female karyotypes whereas lines T4 and T5 are normal male but line T2 is male trisomy 12 (47XY, + 12). hESC lines T1, T2, T3 and T5 were able to produce teratomas in SCID mice and line T4 could only form embryoid bodies in vitro. Expression profiles of imprinted genes from undifferentiated hESC lines, embryoid bodies and teratoma were analyzed using Affymetrix human genome U133 plus 2.0 GeneChip containing 54 675 probe sets for 47 400 transcripts and variants including 38 500 well-characterized human genes, as previously reported[17]. It may be noted that Affymetrix GeneChip expression analysis can be used as a stand-alone quantitative comparison since the correlation between Affymetrix GeneChip results and TagMan RT-qPCR results was shown in a good linearity of R2 = 0.95 by the MicroArray Quality Control Study, a collaborative effort of 137 scientists led by the US-FDA[18,19].

RESULTS
Allele-specific expression of imprinted genes

In order to distinguish mRNA transcripts from each parental allele, the potential SNPs of the 32 known imprinted genes[16] were researched from the literature[20,21] and SNP database of NCBI. The heterozygous alleles of SNPs at seven genes, IPW, PEG10, NESP55, KCNQ1, ATP10A, TCEB3C and IGF2 genes, were found by sequencing gDNA of hESC lines (Table 2). The gDNA of hESC lines T1 and T2 exhibited T and C alleles of IPW gene whereas the cDNA sequencing of undifferentiated cells and teratomas from hESC lines T1 and T2 showed only T allele of IPW gene (Figure 1). The genomic DNA from hESC lines T2 and T3 exhibited C and T alleles of PEG10 gene whereas the cDNA sequencing of undifferentiated hESC T2 and T3 cells, as well as hESC line T2 teratoma, showed only C allele of PEG10 gene. The T and C alleles of NESP55 gene were identified in the genomic DNA of hESC line T1 whereas the cDNA from hESC line T1 teratoma (TT1) showed only T allele of NESP55 gene. The G and A alleles of KCNQ1 gene were identified in genomic DNA of hESC line T3 whereas only G allele of KCNQ1 was found in the sequencing cDNA from undifferentiated hESC line T3 cells. The C and G alleles of ATP10A gene were found in the genomic DNA of hESC line T2 whereas the sequencing cDNA products from undifferentiated cells and teratoma of hESC line T2 showed only C allele of ATP10A gene. The G and C alleles of TCEB3C gene were found in the gDNA of hESC lines T1 whereas only G allele of TCEB3C gene was identified in the cDNAs of hESC line TT1. These results clearly demonstrated the monoallelic expression of six imprinted genes, IPW, PEG10, NESP55, KCNQ1, ATP10A and TCEB3C, in undifferentiated hESC lines and/or differentiated derivatives. As to IGF2 gene, the A and G alleles were identified by sequencing genomic DNA of hESC lines T2 and T3 whereas the cDNA sequencing of undifferentiated cells and teratoma from hESC line T2 showed only A allele. However, the cDNA of undifferentiated cells from hESC line T3 detected the full expression of G allele and partial expression of A allele, indicating the partially relaxed imprinting of IGF2 gene. Furthermore, the embryoid bodies of hESC line T4 (EB4) showed equal expression of both A and G alleles, indicating no imprinting of IGF2 gene.

Figure 1
Figure 1 Allele-specific expression of seven imprinted genes. The heterozygous alleles of single nucleotide polymorphism (SNPs) at seven genes, IPW, PEG10, NESP55, KCNQ1, ATP10A, TCEB3C and IGF2 genes, were found by sequencing genomic DNAs (gDNA) of hESC lines T1, T2, T3 and T4 (Table 2). The cDNA sequences of undifferentiated cells and teratomas from hESC lines T1, T2 and/or T3, as well as embryoid bodies of hESC line T4, were determined using either forward (F) or reverse (R) primers given in Table 1. It may be noted that the peak height of heterozygous alleles (nucleotides) was lower than that of homozygous allele (nucleotide) in addition to two different colors instead of single color. When the non-informative homozygotes at SNPs were detected in gDNA, no cDNA sequencing was carried out.
Table 2 Allele-specific expression of imprinted genes in human embryonic stem cell lines.
GeneshESC linesgDNAcDNA
Undiff. cellsTetratomaEB
IPWT1T/CTT
T2T/CTT
PEG10T2C/TCC
T3C/TC
NESP55T1T/CT
KCNQ1T3G/AG
ATP10AT2C/GCC
TCEB3CT1G/CG
IGF2T2A/GAA
T3G/AG > Aa
T4A/Gb
Expression profiles of imprinted genes in human embryonic stem cell lines

Expression profiles of the 32 known imprinted genes[16] from five undifferentiated hESC lines, T4 embryoid bodies (EB4) and TT1 were analyzed using Affymetrix human genome U133 plus 2.0 GeneChip and the results are given in Table 3. Ten imprinted genes, namely GRB10, PEG10, SGCE, MEST, SDHD, SNRPN, SNURF, NDN, IPW and NESP55, were found to be highly expressed in the undifferentiated hESC lines and down-regulated in differentiated derivatives (EB4 and TT1) (Table 3 top). The UBE3A gene abundantly expressed in undifferentiated hESC lines and further up-regulated in differentiated tissues (EB4 and TT1). The expression levels of other 21 imprinted genes were relatively low in undifferentiated hESC lines and six of them (TP73, COPG2, OSBPL5, IGF2, ATP10A and PEG) were found to be up-regulated in differentiated tissues (EB4 and TT1) (Table 3 bottom).

Table 3 Expression of 32 human imprinted genes.
GenesT1T2T3T4T5EB4TT1Probe IDChromosomeExp. allele
GRB10254332493128377859276896209409_at7p12-p11.2P/M
PEG10160210801710203332551330683212094_at7q21P
SGCE125616201725751501250737204688_at7q21-q22P
MEST70667416260987275814828202016_at7q32P
SDHD27024707232448494079104235202026_at11q23P
SNRPN4819322867215534593428951571228370_at15q11.2P
SNURF423615825727211640335746811159201522_x_at15q11.2-q12P
NDN458932734734334849209550_at15q11.2-q12P
IPW26532848184246858969113328213447_at15q11-q12P
GNAS-NESP55303034968845911556434646566905212273_x_at20q13.3M
UBE3A4119201231252362449178126646211285_s_at15q11-q13M
HYMAI601967616110113401215513_at6q24P
PLAGL1351222518792351559282_at6q24-q25P
WT1902556912631129206067_s_at11p13P
KCNQ1DN89783117621513220629_at11p15.4M
KCNQ1232552251702889159204487_s_at11p15.5M
SLC22A1827431395197213134204981_at11p15.5M
PHLDA220513114918913166117209802_at11p15.5M
H19831002295123107224997_x_at11p15.5M
CDKN1C22301712519119938213183_s_at11p15.5M
DLK11346138104982332209560_s_at14q32P
MEG33812321587124010226211_at14q32M
HBII-4379710160128168251091214834_at15q11.2-q12P
MAGEL222267221740125219894_at15q11-q12P
MKRN382715516814885304206585_at15q11-q13P
TCEB3C15135135144495481552860_at18q21.1M
TP731366213627812411058232546_at1p36.3M
COPG2507515451061040737222298_at7q32P
OSBPL524016817055952612101895233734_s_at11p15.4M
IGF2201766122025962014210881_s_at11p15.5P
ATP10A138248105198981341081214256_at15q11.2M
PEG372445714134808479209242_at19q13.4P
DISCUSSION

The five hESC lines were previously derived with IRB approval in Taiwan and hESC lines T1, T 2, T3 and T5 were able to produce teratomas in SCID mice while hESC line T4 could only form embryoid bodies in vitro[17]. In this investigation, the monoallelic expression of six imprinted genes (IPW, PEG10, NESP55, KCNQ1, ATP10A and TCEB3C) was confirmed in undifferentiated hESC lines and/or differentiated teratomas. The monoallelic expression of PEG10, NESP55 and KCNQ1 genes was also reported previously in hESC lines[20,21]. However, the IGF2 gene was found to be imprinted in hESC line T2 but partially imprinted in hESC line T3 and not imprinted in hESC line EB4. The different extents of IGF2 imprinting among different hESC lines might be due to different developmental stages of blastocysts at which hESC lines were derived. The molecular mechanism responsible for this variability of imprinting remains to be elucidated. The IGF2, as well as H19 in the same chromosomal region 11P15.5, was also reported to be more variable and thus could potentially provide a sensitive indication of epigenetic status of hESC lines[22]. The IGF2 gene was also shown to be only partially imprinted in human germ cell-derived lines[23]. It may be noted that the IGF2 gene was found to be highly expressed in differentiated derivatives, namely hESC lines EB4 and TT1 (see EB4 and TT1 in Table 3).

The expression of imprinted genes plays important roles during early embryo development[6,8]. hESC lines and their differentiated derivatives offer an opportunity for studying the expression of different imprinted genes shortly before and after the embryonic implantation. In this investigation, using DNA microarray we analyzed the expression profiles of 32 known imprinted genes[16] in five undifferentiated hESC lines derived in Taiwan and some of their differentiated derivatives. The expression levels of these 32 imprinted genes were relatively consistent among five hESC lines. It may be noted that five (SNRPN, SNURF, NDN, IPW and UBE3A) of eleven highly expressed imprinted genes in undifferentiated hESC lines are located on chromosomal region 15q11-q13 (Table 3) and that abnormal expression of SNRPN and NDN genes results in the neurogenetic disorder known as Prader-Willi Syndrome[5]. In short, the epigenetic states and expression of imprinted genes in hESC lines should be thoroughly studied after extended culture and upon differentiation in order to understand epigenetic stability in hESC lines before their clinical applications[24].

COMMENTS
Background

Human embryonic stem cell (hESC) lines possess the dual abilities to proliferate indefinitely and differentiate into various cell types in the body. Thus, hESC lines could potentially provide an unlimited supply of different cell types for transplantation therapy. Genomic imprinting is established afresh in the germ cells in each generation and stably inherited throughout the somatic cell divisions.

Research frontiers

The imprinted genes play important roles in human fetal and placental development and aberrant expression of imprinted genes is associated with human diseases. Therefore, it is important to monitor and maintain epigenetic stabilities in hESC lines before their clinical applications.

Innovations and breakthroughs

Six of seven imprinting genes were shown to be fully imprinted but the extent of IGF2 imprinting was found to be varied between different hESC lines. The observed variability of IGF2 imprinting adds to the overall picture of genomic stability of imprinting genes among hESC lines. The IGF2 gene was further found to be highly expressed in differentiated derivatives.

Applications

The IGF2 could potentially provide a sensitive indication of epigenetic status of hESC lines. The epigenetic stability of hESC lines should be fully understood before their medical applications.

Terminology

Genomic imprinting: genomic imprinting is an epigenetic modification that gives rise to differential expression of paternally and maternally inherited alleles of some genes. hESC lines: hESC lines were derived from inner cell mass of blastocysts produced by in vitro fertilization.

Peer review

Imprinting and epigenetic stability of hESCs is an important issue in the field and, as such, the research performed is important. Although imprinting has previously been studied in hESCs, the observed variability between different hESC lines adds to the overall picture of variations in imprinting amongst hESC lines.

References
1.  Bartolomei MS, Tilghman SM. Genomic imprinting in mammals. Annu Rev Genet. 1997;31:493-525.  [PubMed]  [DOI]
2.  Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science. 2001;293:1089-1093.  [PubMed]  [DOI]
3.  Haig D. Genomic imprinting and kinship: how good is the evidence? Annu Rev Genet. 2004;38:553-585.  [PubMed]  [DOI]
4.  Maher ER, Reik W. Beckwith-Wiedemann syndrome: imprinting in clusters revisited. J Clin Invest. 2000;105:247-252.  [PubMed]  [DOI]
5.  Nicholls RD, Knepper JL. Genome organization, function, and imprinting in Prader-Willi and Angelman syndromes. Annu Rev Genomics Hum Genet. 2001;2:153-175.  [PubMed]  [DOI]
6.  Verona RI, Mann MR, Bartolomei MS. Genomic imprinting: intricacies of epigenetic regulation in clusters. Annu Rev Cell Dev Biol. 2003;19:237-259.  [PubMed]  [DOI]
7.  Delaval K, Feil R. Epigenetic regulation of mammalian genomic imprinting. Curr Opin Genet Dev. 2004;14:188-195.  [PubMed]  [DOI]
8.  Morgan HD, Santos F, Green K, Dean W, Reik W. Epigenetic reprogramming in mammals. Hum Mol Genet. 2005;14 Spec No 1:R47-R58.  [PubMed]  [DOI]
9.  Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM. Embryonic stem cell lines derived from human blastocysts. Science. 1998;282:1145-1147.  [PubMed]  [DOI]
10.  Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A. Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol. 2000;18:399-404.  [PubMed]  [DOI]
11.  Odorico JS, Kaufman DS, Thomson JA. Multilineage differentiation from human embryonic stem cell lines. Stem Cells. 2001;19:193-204.  [PubMed]  [DOI]
12.  Heins N, Englund MC, Sjöblom C, Dahl U, Tonning A, Bergh C, Lindahl A, Hanson C, Semb H. Derivation, characterization, and differentiation of human embryonic stem cells. Stem Cells. 2004;22:367-376.  [PubMed]  [DOI]
13.  Wobus AM, Boheler KR. Embryonic stem cells: prospects for developmental biology and cell therapy. Physiol Rev. 2005;85:635-678.  [PubMed]  [DOI]
14.  Maher ER, Afnan M, Barratt CL. Epigenetic risks related to assisted reproductive technologies: epigenetics, imprinting, ART and icebergs? Hum Reprod. 2003;18:2508-2511.  [PubMed]  [DOI]
15.  Humpherys D, Eggan K, Akutsu H, Hochedlinger K, Rideout WM 3rd, Biniszkiewicz D, Yanagimachi R, Jaenisch R. Epigenetic instability in ES cells and cloned mice. Science. 2001;293:95-97.  [PubMed]  [DOI]
16.  Morison IM, Ramsay JP, Spencer HG. A census of mammalian imprinting. Trends Genet. 2005;21:457-465.  [PubMed]  [DOI]
17.  Li SS, Liu YH, Tseng CN, Chung TL, Lee TY, Singh S. Characterization and gene expression profiling of five new human embryonic stem cell lines derived in Taiwan. Stem Cells Dev. 2006;15:532-555.  [PubMed]  [DOI]
18.  Canales RD, Luo Y, Willey JC, Austermiller B, Barbacioru CC, Boysen C, Hunkapiller K, Jensen RV, Knight CR, Lee KY. Evaluation of DNA microarray results with quantitative gene expression platforms. Nat Biotechnol. 2006;24:1115-1122.  [PubMed]  [DOI]
19.  Shi L, Reid LH, Jones WD, Shippy R, Warrington JA, Baker SC, Collins PJ, de Longueville F, Kawasaki ES, Lee KY. The MicroArray Quality Control (MAQC) project shows inter- and intraplatform reproducibility of gene expression measurements. Nat Biotechnol. 2006;24:1151-1161.  [PubMed]  [DOI]
20.  Rugg-Gunn PJ, Ferguson-Smith AC, Pedersen RA. Epigenetic status of human embryonic stem cells. Nat Genet. 2005;37:585-587.  [PubMed]  [DOI]
21.  Sun BW, Yang AC, Feng Y, Sun YJ, Zhu Y, Zhang Y, Jiang H, Li CL, Gao FR, Zhang ZH. Temporal and parental-specific expression of imprinted genes in a newly derived Chinese human embryonic stem cell line and embryoid bodies. Hum Mol Genet. 2006;15:65-75.  [PubMed]  [DOI]
22.  Rugg-Gunn PJ, Ferguson-Smith AC, Pedersen RA. Status of genomic imprinting in human embryonic stem cells as revealed by a large cohort of independently derived and maintained lines. Hum Mol Genet. 2007;16 Spec No. 2:R243-R251.  [PubMed]  [DOI]
23.  Onyango P, Jiang S, Uejima H, Shamblott MJ, Gearhart JD, Cui H, Feinberg AP. Monoallelic expression and methylation of imprinted genes in human and mouse embryonic germ cell lineages. Proc Natl Acad Sci USA. 2002;99:10599-10604.  [PubMed]  [DOI]
24.  Rugg-Gunn PJ, Ferguson-Smith AC, Pedersen RA. Human embryonic stem cells as a model for studying epigenetic regulation during early development. Cell Cycle. 2005;4:1323-1326.  [PubMed]  [DOI]
Footnotes

Peer reviewer: Ernst Wolvetang, Associate Professor, Stem Cell Engineering Group, Australian Institute for Bioengineering and Nanotechnology, Level 4, Building 75, St Lucia campus, University of Queensland, 4072, Brisbane, Australia

S- Editor Wang JL L- Editor Roemmele A E- Editor Yang C

Write to the Help Desk