Published online May 26, 2026. doi: 10.4252/wjsc.v18.i5.117241
Revised: January 6, 2026
Accepted: March 12, 2026
Published online: May 26, 2026
Processing time: 174 Days and 14.4 Hours
Mesenchymal stem cells (MSCs) hold great promise for aesthetic dermatology due to their self-renewal, multipotency, and paracrine effects. However, MSCs derived from aged donors exhibit limited therapeutic efficacy in autologous applications due to their impaired regenerative potential. Hypoxic preconditioning has been explored as an effective strategy to improve the potential of stem cells. In the cu
To evaluate the effect of hypoxic preconditioning on enhancing the regenerative capacity of aged ADMSCs.
ADMSCs were isolated from 12 young (≤ 20 years) and 12 aged (≥ 60 years) donors. ADMSCs isolated from both donor groups were cultured under normoxic conditions (21% O2), while aged ADMSCs were additionally subjected to hypoxic preconditioning at 3% O2 for 48 hours at each passage. We performed various assays to determine the effect of hypoxia on growth kinetics; cumulative popu
Hypoxic preconditioned aged ADMSCs exhibited higher cumulative population doublings, lower doubling time, decreased senescence, enhanced in vitro wound closure, improved colony formation, greater angiogenic, osteogenic, and adipogenic differentiation potential compared with aged-normoxic ADMSCs. Gene expression analysis showed upregulation of protein kinase B, sirtuin 1, insulin-like growth factor 1, vascular endothelial growth factor and stromal cell-derived factor-1 genes, concurrently with downregulation of BAX, BAK1, P53, P21 and P16 genes.
Hypoxic preconditioning enhances regenerative potential of aged ADMSCs. This strategy may be promising for autologous regenerative medicine applications, particularly for autologous therapy.
Core Tip: Mesenchymal stem cells (MSCs) exhibit age-related decline in their regenerative potential. Hypoxic preconditioning has been found to be an effective strategy to augment their regenerative potential. Aged adipose tissue derived MSCs subjected to hypoxic preconditioning (3% O2) for 48 hours exhibited enhanced proliferative potential, clonogenicity, differentiation capability, concurrent with reduced senescence. These findings suggest that hypoxic-preconditioning is a promising therapeutic option to enhance the regenerative potential of aged adipose tissue derived MSCs for autologous use.
- Citation: Bashir B, Choudhery MS, Hussain I. Hypoxic preconditioning restores the regenerative potential of aged adipose tissue derived mesenchymal stem cells. World J Stem Cells 2026; 18(5): 117241
- URL: https://www.wjgnet.com/1948-0210/full/v18/i5/117241.htm
- DOI: https://dx.doi.org/10.4252/wjsc.v18.i5.117241
Mesenchymal stem cells (MSCs) are adult, multipotent cells with the unique ability to self-renew and differentiate into a variety of mesodermal and non-mesodermal lineages (ectoderm or endoderm). MSCs are readily derived from various tissues including bone marrow, adipose tissue, cord tissue, and cord blood etc. MSCs enhance tissue regeneration because of their differentiation potential and paracrine effects by secreting cytokines, chemokines, and growth factors that regulate local environment promote angiogenesis, and enhance tissue regeneration. These properties make MSCs a promising cell type for regenerative medicine applications for the treatment of number of diseases including cardiovascular diseases, neurodegenerative diseases, bone and cartilage diseases, cancer, kidney diseases, liver diseases, autoimmune diseases including graft vs host disease, multiple sclerosis, Crohn’s disease and systemic lupus erythematosus[1-3]. In addition, within aesthetic and regenerative dermatology, MSC-based interventions are increasingly investigated as therapeutic approaches to reverse age-related dermal degeneration, restore extracellular matrix structure, stimulate vascularization, and accelerate wound repair[4,5]. Despite their promise, MSCs derived from aged donors’ exhibit significant functional impairment. Compared with MSCs from young donors, aged MSCs show reduced proliferative capacity, diminished differentiation potential and altered secretory profiles. Since autologous cell therapy is preferred to minimize immunological risks, overcoming age-associated MSC dysfunction remains a critical translational challenge in regenerative medicine[6,7].
Regenerative potential of MSCs depends on their tissue-specific microenvironment or stem cell niche. MSC niches are generally characterized by low levels of oxygen ranging from 1% to 7%, whereas standard in vitro culture conditions utilize ambient oxygen at 21%[8]. It does not reflect their natural habitat. Prolonged growth under elevated oxygen tension modifies MSC metabolism by diverting it from glycolysis to oxidative phosphorylation, resulting in increased oxidative stress, accelerated senescence, impaired self-renewal capacity, differentiation and reduced production of angiogenic and trophic factors[9]. Furthermore, the transplantation of MSCs into ischemic or inadequately vascularized tissues exposes them to acute hypoxia and nutrient-deficient environments that compromise cell survival, engraftment, and therapeutic effectiveness[10].
Preconditioning strategies have been developed to improve the efficiency of MSCs prior to transplantation to address these limitations. Examples of such methods include the use of specific growth factors or small molecules, nutrient depletion, heat shock exposure, and hypoxic preconditioning[11]. Hypoxic preconditioning is one of the most intriguing approaches because it closely resembles the physiological stem cell niche. Hypoxia stimulates hypoxia-inducible factor-1α (HIF-1α), which is a key transcriptional regulator that helps cells adapt to low-oxygen situations. Once stabilized, HIF-1α may increase the activity of many genes that are involved in glycolytic metabolism, angiogenesis [like vascular endothelial growth factor (VEGF) and angiopoietin 1], cell survival (like Bcl-2), and cell migration (like C-X-C receptor 4 and matrix metalloproteinases). These transcriptional modifications collectively maintain the stemness of MSCs, increase their proliferative potential, promote paracrine signaling, and enhance their resistance to apoptosis and oxidative stress[12]. Therefore, hypoxic preconditioning maintains the intrinsic biological functions of MSCs by closely replicating the physiological microenvironment of the native stem cell niche. It is a reliable and robust method to improve their rege
Optimization of hypoxia is equally important. Considering that prolonged or excessively low hypoxia during the initial culture phase produces inconsistent and inhibitory effects, whereas short-term exposure to 2%-5% hypoxia has shown favorable outcomes[13,14], we investigated the effect of 3% hypoxia for 48 hours at each passage on aged adipose tissue derived MSCs (ADMSCs).
The present study was designed to systematically investigate whether hypoxic preconditioning can rejuvenate aged ADMSCs. ADMSC have gained popularity for their regenerative potential but age-related decline of functions is the main limitation for clinical application. Therefore, the present study was designed to systematically investigate whether hypoxic preconditioning can rejuvenate aged ADMSCs. ADMSCs were harvested from young (≤ 20 years) and aged (≥ 60 years) donors. These cells were cultured under normoxic (21% O2) conditions. ADMSCs from aged donors were divided into two groups i.e., normoxic ADMSCs and hypoxic ADMSCs. Hypoxic ADMSCs were exposed to 3% oxygen for 48 hours during culture at approximately 50% confluence and impact of hypoxic priming was assessed on the biological properties of this aged group mainly on proliferative capacity, differentiation, migration, angiogenesis, cellular senescence, survival and senescence-related gene expression. The goal of the study is to provide innovative under
This study was approved (approval number: 2744/KEMU/2016) by Advanced Studies & Research Board of King Edward Medical University and was performed in accordance with institutional ethical guidelines and the Declaration of Helsinki. After written informed consent adipose tissue samples from abdomen or lateral thigh were obtained from healthy volunteer donors who presented in Plastic Surgery and Dermatology Department, King Edward Medical University for fat grafting of face, contour deformities, lipofilling of depressed areas and acne scarring treatment etc. Adipose tissue from two distinct age groups was obtained: Young donors (≤ 20 years) and aged donors (≥ 60 years). Donors with hepatitis B virus, hepatitis C virus, human immunodeficiency virus and diabetes were excluded to avoid confounding factors. Adipose tissue was harvested during liposuction procedures using a 2.5 mm blunt-tipped cannula attached to a sterile 10 mL syringe under local anesthesia. Immediately after collection, lipoaspirates were transferred to the Tissue Engineering and Regenerative Medicine Laboratory of King Edward Medical University under sterile conditions.
Adipose tissue samples were washed three times with phosphate-buffered saline (PBS) to remove blood and debris. Enzymatic digestion was performed by incubating the tissue samples with 0.2% collagenase type IV (Invitrogen, CA, United States) at 37 °C for 20 minutes with gentle intermittent agitation to disaggregate the extracellular matrix and release cells. The enzymatic reaction was neutralized by adding an equal volume of minimum essential medium alpha (MEM-α) culture medium containing 10% fetal bovine serum (Gibco, NY, United States). The suspension was then passed through a 70 μm sterile cell strainer to remove undigested tissue fragments followed by centrifugation at 1000 rpm for 10 minutes to obtain an SVF pellet. The cell pellet was resuspended in MEM-α supplemented with 10% foetal bovine serum, 1% L-glutamine, 1% non-essential amino acids, and 1% penicillin-streptomycin solution. Cells were plated in 25 cm2 tissue culture flasks and incubated at 37 °C in a humidified atmosphere containing 5% CO2, 21% oxygen. After 48-72 hours, non-adherent cells were removed by washing with PBS, and the adherent cells were further expanded. At 70% to 80% confluence, cells were trypsinized with 1 mL of 0.25% trypsin-EDTA and cells were seeded into new culture flasks labeled passage 1 (P1). Young ADMSCs and aged normoxic ADMSCs group remained in 21% oxygen and 5% CO2 throughout all further passages and before performing assays. All assays were performed at the end of P2 or P3.
To investigate the effect of hypoxia, ADMSCs from aged cultures were divided into two groups after primary culture, ADMSCs cultured under normoxic conditions and ADMSCs cultured under hypoxic conditions. Aged normoxic ADMSCs remained in 21% oxygen, 5% CO2. ADMSCs assigned to the hypoxic group were cultured in a tri-gas incubator (Galaxy 170R, Germany) maintained at 3% O2, 5% CO2, and 37 °C for 48 hours at each passage when cells reached 40%-50% confluence. Oxygen levels were regulated automatically by the incubator’s internal feedback-controlled gas delivery system (balance N2) with continuous monitoring. Gas replacement occurred as required to maintain the preset oxygen concentration, and the incubator was not opened during hypoxic exposure to minimize oxygen fluctuations. No fluctuations in oxygen concentration were observed. No hypoxia was applied during the initial 24 hours post-seeding, ensuring efficient cell attachment. This preconditioning was maintained consistently until cells were harvested for subsequent assays.
To assess the proliferative potential of ADMSCs (young, aged and aged hypoxia), cells were serially passaged under their respective oxygen conditions. At each passage, cells were detached using 0.25% trypsin-EDTA, counted using a hemocytometer and 50000 cells from each group was seeded into new culture flask for each group. The viability of cells was confirmed by trypan blue exclusion assay. The cumulative population doublings (cPDs) and doubling time (DT) were calculated according to the following formulae: CPDs = (logN/N0) × 3.33, DT = CT/cPDs, where N represents the final cell count, N0 the initial seeding density, and CT the culture time in hours.
Cells from both experimental groups (aged hypoxic-preconditioned and aged normoxic control) were harvested by trypsinization. Cells were counted and plated at a density of 1000 viable cells into 100-mm culture plates. Cells were cultured under standard culture conditions in CO2 incubator for 14 days. At the end of incubation period, cultures were washed with PBS and fixed with methanol. 0.01% of crystal violet was added to culture plates to fix the cells. Colony-forming efficiency was assessed by calculating the proportion of seeded cells that formed visible colonies. Colonies consisting of ≥ 30 cells were counted using a phase-contrast inverted microscope. Plating efficiency (PE) was expressed as a percentage using the following formula: PE = (number of colonies formed/number of cells plated) × 100.
The osteogenic differentiation potential of MSCs was assessed by seeding 25000 cells per well in a 12-well plate containing standard expansion medium (complete MEM-α medium). For hypoxia, aged ADMSCs were cultured under 3% oxygen for 48 hours, whereas the cells of the control group were cultured under normoxic conditions. Following preconditioning, cells were cultured in osteogenic induction medium (Invitrogen, CA, United States) according to the manufacturer’s protocol. The medium was replaced every 5-7 days. Differentiation was continued for 21 days. Mineralized matrix deposition was evaluated using von Kossa staining to detect calcium phosphate deposits. Stained cultures were examined under a phase-contrast microscope to confirm successful osteogenic induction of MSCs. Image J software was used for quantitative analysis (https://imagej.net/ij/).
Adipogenic differentiation was carried out by seeding 25000 cells per well of a 12-well plate. The hypoxia-preconditioned ADMSCs were cultured under 3% oxygen for 48 hours, while the control group remained under normoxic conditions. When the cultures become confluent, the medium was replaced with adipogenic induction medium (Invitrogen, CA, United States). The medium was replaced every 5-7 days, and cells were maintained in induction medium for 21 days. Lipid droplet accumulation was assessed using Oil Red O staining. Lipid vesicles were visualized under a phase-contrast microscope, confirming adipogenic differentiation of MSCs. Image J software was used for quantitative analysis (https://imagej.net/ij/).
To investigate the effect of hypoxia on MSC migration, a total of 50000 cells per well of a 6-well plate were seeded under standard culture conditions in complete MEM-α medium. When a uniform monolayer of cells was achieved (approximately 100% confluence), a straight linear scratch was created across the center of each well using a sterile tip. The wells were gently rinsed with PBS to remove detached cells and debris. Fresh culture medium was added. Images of the scratch area were captured using an inverted phase-contrast microscope. Wound closure was quantified using ImageJ software (https://imagej.net/ij/).
The angiogenic potential of MSCs was assessed using a Matrigel-based tube formation assay. Growth factor-reduced Matrigel (Cat# 356234, Corning, NY, United States) was thawed overnight at 4 °C and kept on ice during handling. 50 μL of Matrigel per well was dispensed into each well of a pre-chilled 96-well plates and allowed to polymerize at 37 °C for 30 minutes. MSCs from all groups were harvested at 80% confluence, counted, and seeded at a density of 50000 cells per well onto the solidified Matrigel. After 3 hours to 4 hours of incubation, the formation of capillary-like tube networks was examined using an inverted microscope. Image J software was used for quantitative analysis (https://imagej.net/ij/).
Cellular senescence was assessed using the senescence-associated β-galactosidase (SA-β-gal) staining. Briefly, ADMSCs from young, aged normoxic, and aged hypoxic groups were seeded in six-well plates and cultured until they reach 70%-80% confluency. Cells were then washed with PBS, fixed with 4% paraformaldehyde for 10 minutes at room temperature, and subsequently incubated with freshly prepared SA-β-gal staining solution (1 mg/mL X-gal) at 37 °C in an incubator without CO2. Following incubation, cells were washed again with PBS and examined under a light microscope. SA-β-gal-positive cells were identified by the presence of blue staining. Representative images were captured, and the relative distribution of senescent cells among groups was compared.
For gene expression analysis, total RNA was extracted using TRIzol® reagent (Invitrogen, CA, United States) according to manufacturer’s instructions. The concentration and purity of RNA were determined with nanodrop spectrophotometer at 260/280 nm. 1 μg of RNA was reverse transcribed into cDNA using the M-MLV reverse transcriptase kit (Invitrogen, CA, United States). Quantitative real-time polymerase chain reaction was carried out using SYBR green master mix in 15 μL reaction mixtures containing gene-specific primers. Amplification was performed using following conditions: 95 °C for 3 minutes, followed by denaturation at 95 °C for 25 seconds, annealing at 60 °C for 25 seconds and extension at 72 °C for 30 seconds. Melt curve analysis was included to verify specificity. Each sample was analyzed in triplicate. The cycle threshold (Ct) values were used to calculate ΔCt (Ct target - Ct_housekeeping), and ΔΔCt values were calculated relative to the calibrator group (young MSCs). Fold changes in expression were expressed as 2-ΔΔCt. Genes analyzed were VEGF, insulin-like growth factor 1 (IGF1), stromal cell-derived factor (SDF), protein kinase B (AKT), sirtuin 1 (SIRT1), BAX, BAK1, p16, p21, and p53. GAPDH was used as housekeeping controls. Table 1 shows the nucleotide sequences of the primers used for the amplification of target genes.
| Gene | Sequence | Annealing temperature |
| VEGF | TTGCCTTGCTGCTCTACCTCCA | 60 °C |
| GATGGCAGTAGCTGCGCTGATA | ||
| AKT1 | TGGACTACCTGCACTCGGAGAA | 60 °C |
| GTGCCGCAAAAGGTCTTCATGG | ||
| SDF1 | CTCAACACTCCAAACTGTGCCC | 60 °C |
| CTCCAGGTACTCCTGAATCCAC | ||
| SIRT1 | TAGACACGCTGGAACAGGTTGC | 60 °C |
| CTCCTCGTACAGCTTCACAGTC | ||
| IGF1 | CTCTTCAGTTCGTGTGTGGAGAC | 60 °C |
| CAGCCTCCTTAGATCACAGCTC | ||
| P16 | CTCGTGCTGATGCTACTGAGGA | 60 °C |
| GGTCGGCGCAGTTGGGCTCC | ||
| P21 | AGGTGGACCTGGAGACTCTCAG | 60 °C |
| TCCTCTTGGAGAAGATCAGCCG | ||
| P53 | CCTCAGCATCTTATCCGAGTGG | 60 °C |
| TGGATGGTGGTACAGTCAGAGC | ||
| BAX | TCAGGATGCGTCCACCAAGAAG | 60 °C |
| TGTGTCCACGGCGGCAATCATC | ||
| BAK | TTACCGCCATCAGCAGGAACAG | 60 °C |
| GGAACTCTGAGTCATAGCGTCG |
Statistical analysis was performed using GraphPad Prism 10 (GraphPad Software, Boston, MA, United States). Data of quantitative variables like population doublings, population DT, PE, genes expression were presented as mean ± SD. One way analysis of variance (ANOVA) was employed to determine the association of each variable. For post-hoc multiple comparisons, Tukey’s honestly significant difference test was applied. P ≤ 0.05 was considered as statistically significant.
The mean age of donors in young group (young ADMSC group) was 18.2 ± 1.64 and male to female ratio was 1:3 in this group. Three young males were smokers and the average body mass index of young donor group was 23.3 ± 4 kg/m2. The mean age of donors of aged group was 63.8 ± 2.12. The male to female ratio in this group was 1:4. Two of the males of this group were smokers. The average body mass index of aged group was 25.5 ± 3.5 kg/m2.
Phase contrast microscope was used to observe the morphology of MSCs isolated from young (≤ 20 years) and aged (≥ 60 years) donors. MSCs isolated from both donors demonstrated plastic adherence and fibroblast like spindle shaped morphology (Figure 1). MSCs isolated from young donors maintained a slender, elongated shape under normoxia (21% O2) (Figure 1A). However, aged MSCs showed enlarged cytoplasm, flattened cell bodies, and irregular contours under normoxia (21% O2) (Figure 1B). In contrast, when aged MSCs were subjected to hypoxic preconditioning (3% O2), they retained a morphology similar to that of young MSCs, appearing slender and actively proliferating rather than senescent (Figure 1C). This observation suggests that low oxygen culture conditions may preserve the youthful phenotype of aged ADMSCs.
The proliferative capacity of MSCs was assessed by analyzing cPDs and DT of all samples. Calculations of nine young and ten aged samples were finally considered due to loss of three young and two old samples during cultures due to contamination issue (Figure 2). Young ADMSCs showed higher cPDs (18.7 ± 4.7) compared to aged ADMSCs under normoxia (12.4 ± 2.5) till 45 days. These results showed statistical significance difference (P = 0.001) between young ADMSCs and aged normoxic ADMSCs. Although aged ADMSCs preconditioned with hypoxia exhibited improved cPDs (15.9 ± 3.2), the difference was not statistically significant when compared with young ADMSCs (P = 0.210) or aged normoxia ADMSCs group (P = 0.082). These findings suggest that hypoxia partially restores the proliferative potential of aged ADMSCs. These results indicated that aging is associated with a decline in proliferative potential, which may be partially ameliorated by hypoxic preconditioning.
In contrast, the analysis of population DT revealed significant differences among groups. Aged-normoxic ADMSCs demonstrated the prolonged DT (3.72 ± 0.77 days), more than both young ADMSCs (2.34 ± 0.41 days) and aged hypoxic ADMSCs (2.87 ± 0.52 days). Results showed a statistically significant difference between young ADMSCs and aged normoxia ADMSCs group (P < 0.0001), confirming that aging is associated with slower cell division, and between aged normoxia ADMSCs and aged hypoxia ADMSCs group (P = 0.009), indicating that hypoxia restores the proliferative kinetics of aged cells. There was no statistically significant difference between young ADMSCs and aged hypoxia ADMSC group (P = 0.144). These data indicate that while DT increases with age, hypoxic preconditioning significantly reduces DT in aged hypoxic ADMSCs, restoring proliferative dynamics closer to youthful levels.
The clonogenic potential of ADMSCs was assessed using colony-forming unit (CFU) assay and by calculating PE (Figure 3). Young ADMSCs formed the highest number of colonies (74.5 ± 14.5), whereas aged normoxia ADMSC group produced less number of colonies (42.5 ± 10.3). Hypoxic preconditioning markedly improved colony formation in aged ADMSC group (59.3 ± 8.7), comparable to young ADMSCs. Similarly, PE analysis revealed a similar pattern. The PE of young ADMSCs was 7.45 ± 1.45 as compared to aged normoxia ADMSCs (4.25 ± 1.03, P < 0.0001) and aged hypoxia ADMSCs (5.93 ± 0.87, P = 0.03). Aged hypoxia group showed significant improvement when compared with aged normoxia group (P = 0.02). These results indicate that hypoxic preconditioning substantially restores clonogenic ability of aged ADMSCs, both by increasing the total number of colonies formed and by improving PE, thereby reducing the age-associated decline in self-renewal potential.
The osteogenic differentiation potential of ADMSCs was assessed using von Kossa staining after 21 days of induction. Images from each group were quantitatively analyzed by Image J software under the same threshold and measurement settings. Young ADMSCs exhibited highest mineralization level and integrated density. Aged normoxic ADMSCs show reduced mineralization and integrated density. Fewer and smaller calcified nodules were also observed, which reflect an age-related decline in osteogenic capacity. Mean percentage area of young ADMSCs was 18.54 ± 4.55, aged normoxic ADMSCs was 10.80 ± 5.23 and aged hypoxic ADMSCs was 17.03 ± 4.917. Aged hypoxia ADMSCs group displayed a significant increase in calcium deposition close to young (Figure 4).
Oil red O staining was used to evaluate the adipogenic differentiation potential of ADMSCs (Figure 5). Abundant intracellular lipid droplets were distributed throughout the cytoplasm of young ADMSCs. Image J software analysis showed high lipid accumulation in young ADMSC group. Aged normoxic ADMSCs displayed sparse and faint lipid staining, with reduced percentage area and integrated density. In contrast, aged hypoxic ADMSCs demonstrated a substantial increase in lipid-laden vacuole formation representing a significant improvement. These findings indicate that hypoxic preconditioning partially restored the adipogenic differentiation potential of aged ADMSCs. The mean percentage area of young group was 27.66 ± 5.07, aged normoxic group was 9.03 ± 5.13, aged hypoxic group was 19.30 ± 6.57.
In vitro scratch assay was used to evaluate the migration ability of ADMSCs (Figure 6). ImageJ was used for quantitative analysis. Smaller residual wound area indicated greater closure. After 24 hours, young ADMSCs exhibited nearly complete wound closure. Aged normoxic ADMSCs showed markedly reduced migration. Hypoxic preconditioning moderately regenerated the wound healing potential of aged ADMSCs. The mean wound closure was 99.59 ± 0.05 of young group, 23.46 ± 6.578 of aged normoxic ADMSCs and 79.06 ± 14.44 of aged hypoxic ADMSCs group. There was significant improvement in migration of aged hypoxic ADMSC (P = 0.0007) compared to its counterpart aged normoxic ADMSCs.
Matrigel tube formation assay was used to evaluate the angiogenic potential of ADMSCs (Figure 7). ImageJ was used for quantitative analysis. The young ADMSCs showed a larger tubular network that is well developed, organized and mature, depicted by number of nodes, meshes and branching lengths. Aged normoxia ADMSCs displayed smaller number of nodes, meshes and branching length as compared to young ADMSCs suggesting their angiogenic ability decreased with aging. Their tubular network was loose and disordered. Aged hypoxic ADMSCs showed improved mesh efficiency, nodes and total branching length. These results demonstrate that hypoxia preconditioning improves the structural complexity and effectiveness of angiogenic networks in old ADMSCs. Interestingly, the effect of hypoxia on angiogenesis of stem cells resulted in even better than young ADMSCs in terms of number of nodes, meshes and branching lengths. Data was analyzed using one-way ANOVA followed by Tukey’s post hoc multiple comparison test. There is no statistically significant difference between young ADMSCs vs aged normoxic ADMSCs (P = 0.94) and young ADMSCs vs aged hypoxia ADMSCs group (P = 0.83) when number of nodes were compared. Although, there is marked rise in number of nodes with hypoxia but the difference was not statistically significant between aged groups (P = 0.65). Similar results obtained for number of meshes [young ADMSCs vs aged normoxic ADMSCs (P = 0.95), young ADMSCs vs aged hypoxic ADMSCs (P = 0.75), aged normoxic ADMSCs vs aged hypoxic ADMSCs (P = 0.59)] and total branching length [young ADMSCs vs aged normoxic ADMSCs (P = 0.82), young ADMSCs vs aged hypoxic ADMSCs group (P = 0.98), aged normoxia ADMSCs vs aged hypoxia ADMSCs (P = 0.72)].
To determine the cellular senescence young ADMSCs, aged normoxic ADMSCs and aged hypoxic ADMSCs were stained with SA-β-gal staining. Microscopic examination revealed a clear difference in the number of senescent cells across the groups. Young ADMSCs (Figure 8A) exhibited very few SA-β-gal-positive cells. In contrast, aged MSCs cultured under normoxic conditions (Figure 8B) demonstrated an increase in the number of SA-β-gal-positive cells, with senescent cells distributed across the fields of view. However, hypoxic preconditioning of aged ADMSCs (Figure 8C) resulted in a visible reduction in the number of SA-β-gal-positive cells compared with aged normoxic cultures. Although the senescent cell population in the hypoxia group remained higher than that of the young MSCs, the overall staining intensity and frequency of senescent cells were noticeably lower relative to aged normoxic controls. These results suggests that hypoxic culture conditions can attenuate the senescence phenotype in aged ADMSCs, at least partially restoring a more youthful cellular profile.
The expression levels of genes associated with survival signaling (AKT1, SIRT1, IGF1, VEGF, SDF1), apoptosis (BAX, BAK1), and cell cycle regulation & senescence (p53, p21, p16) were assessed in young ADMSCs, aged normoxic ADMSCs, and aged hypoxic ADMSCs using real-time polymerase chain reaction analysis (Figure 9). Gene expression was nor
For fold-change analysis, the young ADMSCs was selected as the control group, while the aged normoxia and aged hypoxia groups were considered as the experimental groups (Figure 10). Fold-change analysis revealed that the aged group under normoxia generally exhibited strong upregulation of pro-apoptotic; BAK1 (approximately 4.29 folds), BAX (approximately 12.60 folds), and cell cycle checkpoint regulators; p16 (approximately 9.43 folds), p21 (approximately 8 folds), p53 (approximately 20.31 folds). Conversely, stress- and survival-associated genes; SIRT1 (approximately -6.18 folds), SDF1 (approximately -6.06 folds), VEGF (approximately -5.81 folds), AKT1 (approximately -7.50 folds), and IGF1 (approximately -6.38 folds) were markedly downregulated in aged normoxia group, suggesting impaired survival signaling and diminished regenerative potential in aged ADMSCs compared with young controls. Interestingly, under hypoxic conditions, aged ADMSCs exhibited a partial reversal of these aging-associated effects. Compared with aged normoxia, pro-apoptotic and checkpoint genes including BAK1 (approximately 2.19 folds), BAX (approximately 4.33 folds), p16 (approximately 3.33 folds), p21 (approximately 2.83 folds), p53 (approximately 8.44 folds), were downregulated while, stress- and survival-associated genes; SIRT1 (approximately -2.14 folds), SDF1 (approximately -2.41 folds), VEGF (approximately -1.88 folds), AKT1 (approximately -2.17 folds), and IGF1 (approximately -2.33 folds) were upregulated. Although these changes did not completely restore the gene expression profile to that of young ADMSCs, hypoxia clearly mitigated senescence and promoted survival and stress resistance in aged ADMSCs. Collectively, these findings indicate that normoxia accelerates senescence-related molecular changes in aged ADMSCs, whereas hypoxia exerts a protective effect by inhibiting pro-apoptotic and checkpoint pathways while enhancing survival-associated gene expression, thereby partially rejuvenating the aged stem cell phenotype.
MSCs play a pivotal role in regenerative medicine by harnessing their self-renewal capabilities, multipotency and paracrine factor secretion to improve therapeutic outcomes. Adipose derived stem cells are gaining particular attention over others because of their high yield, minimally invasive harvesting technique, less ethical concerns and efficient clinical potential[15]. However, ADMSCs derived from aged donors often exhibit diminished proliferation, impaired differentiation, reduced clonogenicity, and weakened paracrine functions such as migration and angiogenesis. This functional impairment restricts its clinical application in autologous studies especially in the aged patients, the group most likely to seek regenerative therapies. Hypoxic preconditioning also provides an opportunity to overcome these drawbacks by recreating the physiological oxygen levels found in the stem cell niches (1%-7% O2) rather than those found in the atmosphere (21% O2). Current research illustrates that hypoxic preconditioning is effective in the rehabilitation of various functional characteristics of aged ADMSCs to bring their biological characteristics nearer to those of young ADMSCs and enhance their therapeutic effectiveness in skin rejuvenation and wound healing. These findings together with our quantitative analysis of images indicate that microvascular network formation, growth, clonogenicity, lineage differentiation, migration, and a general phenotypic recovery during passage-combined and transient exposure to 3% O2 are adequate indicating a coordinated response to hypoxia. Importantly, the consistency across multiple assays (cPDs, DT, CFU, PE, von Kossa, Oil Red O, scratch closure, and tube-formation) suggests that hypoxia induces a systemic change in the aged MSC state, rather than isolated changes in individual endpoints.
Morphologically, ADMSCs typically exhibit a fibroblast-like, spindle-shaped morphology with a uniform appearance, indicative of healthy proliferative and differentiation potential. Conversely, aged ADMSCs often display a large, flat, and irregular morphology, characteristic of cellular senescence and diminished regenerative capacity[16-18]. In our study, young ADMSCs showed typical (spindle) shape, whereas aged normoxic aged ADMSCs showed enlarged and flattened appearance. Hypoxia-preconditioned aged ADMSCs maintained a thin spindle like shape just like the young ADMSCs throughout all passages. This result is in consistent with recent study of Ma[19] and Ahmed et al[20]. However, there were many groups previously who found no effect of hypoxia on morphology[21-23]. Although all these groups found better effect of hypoxia on other parameters which were under investigate in their studies. Ahmed et al[20], also observed that effect of 3% hypoxia on morphology is even better than 5% hypoxia. These differences are mainly because of difference of oxygen tension. However, duration of exposure, precision of oxygen delivery, donor age and passage numbers all can contribute towards differences in these findings.
This is an indication that hypoxia contributes to retention of the young cytoskeletal structure of MSCs, which is probably due to decreased oxidative stress and stabilization of HIF-1α signaling. Hypoxic conditions led to a decrease in senescent cells and preservation of actin-microtubule dynamics, enabling MSCs migration and colony formation. This was accompanied by microscopic recovery of the spindle shape, reduced SA-β-gal positivity, and improved kinetic parameters, suggesting a reversal of senescent morphology and function.
CPD measures a population’s proliferative potential over an extended period, whereas population DT indicates proliferative efficiency in the short period. Peak cPDs and minimum DTs were observed in young ADMSCs, which is a confirmation of strong proliferative capacity. Aged normoxic ADMSCs, relative to young cells, however, exhibited much lower cPDs and increased DTs, which is in agreement with the earlier studies that aging decreases MSC proliferation and self-renewal ability[7,16,18,24]. Hypoxic preconditioning of aged ADMSCs showed distinct increase in cPDs and decrease in DT leading to partial youthful recovery. These findings are consistent with previous studies that demonstrated hypoxia increases MSCs growth[13,25-27]. However, Pezzi et al[28] didn’t found effect of hyoxia on proliferation. This may be due to prolonged exposure of hypoxia during cultures.
HIF-1α stabilization at 3% O2 can shift the metabolism towards glycolysis, decrease mitochondrial reactive oxygen species, and counteract p53/p21-mediated checkpoints and changes that match our reduced DTs and increased cPDs in hypoxic-aged MSCs. The partial convergence with young MSCs is probably evidence of permanent age-related damage (e.g., epigenetic changes, cumulative DNA damage) which cannot be removed by hypoxia itself, suggesting that a synergistic benefit in future studies is to combine hypoxia with redox or epigenetic modulators.
Colony-forming assay and PE determine the clonogenic potential of MSCs, a characteristic of stemness. This research showed that young ADMSCs made a high number of large colonies, whereas the aged normoxic ADMSCs made smaller and fewer colonies, which supported the decrease of clonogenic potential with age. Aged hypoxic ADMSCs group showed significant increase in both the number and size of colonies, approaching the proliferative efficiency of young ADMSCs (P < 0.05). These findings are in line with other studies who also found that hypoxia maintained clonogenicity with the reduction of oxidative damages[14]. However, Alwohoush et al[29] found that hypoxia impaired the colony forming potential of induced pluripotent stem cells. He raised this question in his research that too low oxygen tension 1% might have detrimental effect on cells. On the other hand, Heylman et al[14] applied very low oxygen tension 0.1% and found much improvement, he didn’t apply hypoxia for the first 96 hours. Similarly, we didn’t apply hypoxia for the first 24 hours and till 40% to 50% confluence. However, further studies with modification of timings of hyoxia needed to establish the findings.
Hypoxia preserves functional heterogeneity and avoids earlier depletion of clonogenic MSC subpopulations, leading to improved therapeutic outcomes. An increase in CFU, PE during hypoxia suggests the preservation of self-renewing progenitors, which support both proliferation and differentiation. This is reflected in the enhanced osteogenic and adipogenic outcomes. This clonogenic recovery aligns with the observed changes in gene expression, where survival and stress-response genes are upregulated, while pro-apoptotic and checkpoint genes are downregulated under hypoxic conditions.
Osteogenic differentiation was assessed using von Kossa staining, which revealed the presence of mineralized nodules, indicating bone-forming capacity. Young ADMSCs depicted significant calcium deposition and the aged normoxic ADMSCs depicted lesser mineralization, which was in line with earlier findings of age-dependent osteogenic impairment[13-15]. However, aged hypoxic ADMSCs group depicted nodule formation that was closer the young ADMSCs. This finding is in line with the results of many studies[30-32], but there are certain studies that found an inhibitory effect of hypoxia on osteogenesis of stem cells[33-35]. Then there are groups who found that stem cells grown in hypoxia and normoxia both retains the ability of osteogenic differentiation[36]. Optimization of hypoxia is a key to achieve better results. As far as osteogenic differentiation is concerned its already established that short term hypoxia rather than long term is appropriate for osteogenic differentiation of ADMSCs[13,37]. Constant hypoxia results in down regulation of Runt-related transcription factor 2 and collagen type 1 alpha 1 chain[36].
Hypoxia induces osteogenic differentiation of adipose-derived MSCs through HIF-1α-VEGF-Notch signaling resulting in an increased mineralization. The hypoxia increases mineralized percent area and integrated density. It implies that the extracellular matrix maturation and calcification is more uniform in hypoxia compared to aged normoxia, consistent with VEGF-Notch coupling that enables the angiogenic interaction as well as the commitment of osteoprogenitor. Bone development requires synchronized vascularity. Therefore, the resultant improvement of tube-formation measures during hypoxia indicated a possible paracrine process that indirectly strengthens osteogenesis.
Adipogenic differentiation was determined by the Oil Red O stain. Results showed that aged ADMSCs developed a limited number of lipid droplets. However, hypoxic aged ADMSCs-developed large number of lipid vacuoles, which restored the differentiation effectiveness. Young ADMSCs showed large number of lipid droplets and vacuoles. These findings confirm that lineage-specific transcriptional regulations were improved by hypoxia and confirm the previous findings[25,38-40]. There are very few reports of adipogenesis inhibition of MSCs grown in hypoxic culture[41]. The degree of recovery in the lipid-positive region during hypoxia indicates that adipogenic transcriptional activity is reactivated, as well as pro-survival/metabolic genes (e.g., AKT1, SIRT1, IGF1) are partially restored to facilitate lipid regulation and adipocyte differentiation. The simultaneous increase of osteogenic and adipogenic differentiation suggests that hypoxia does not cause differentiation to a single lineage, but preserves multi-lineage plasticity.
The age and oxygen-dependent variability of ADMSC migration was shown in the scratch wound-healing assay. The closure rate of young ADMSCs was almost 100% within 24 hours, compared to the low closure rate in aged normoxic ADMSCs even after 48 hours. Young ADMSCs exhibited efficient migration to the wound site and promoted rapid wound closure. The migration of aged hypoxic ADMSC group was enhanced, leading to faster wound closure compared to aged normoxic ADMSCs group. These observations indicate that hypoxia reverses the decline in migratory ability of aged MSCs by increasing the chemokine receptor signaling and supporting cytoskeletal reorganization, which are mechanisms of tissue repair[12]. The large increase in 24-hour closure under hypoxia is in agreement with increased front-rear polarity and longitudinal dynamics and is also in agreement with the upregulation of SDF1/C-X-C receptor 4 signaling that supports directed motility during ischemia or damaged conditions. This migratory response plays a functional role in angiogenic healing, as optimal wound repair necessitates not only rapid cellular coverage but also efficient neovascularization. There are studies that showed impaired migration and decreased expression of adhesion molecules but they used very low 0.5% hypoxia[42].
Matrigel tube formation assay was used to evaluate the angiogenic activity of young ADMSCs. Young ADMSCs rapidly assembled to form extensive vascular networks within 4 hours. In contrast, aged normoxic ADMSCs exhibited delayed and disorganized network formation, characterized by reduced branching and shorter tubes. However, hypoxia-preconditioned aged ADMSCs demonstrated earlier sprouting and developed more interconnected and stable vascular networks, resembling those of young MSCs. These results are in line with previous studies who suggest that hypoxia stimulate VEGF and SDF-1 leading to neovascularization and structural stabilization of vascular systems[43]. These features are linked to a pro-angiogenic secretome and are quantitatively associated with a longer total branch length, increased branch number, and a lower mesh index during hypoxia, indicating the formation of denser, more efficient networks with fewer discontinuities. Angiogenesis improvement supports the translational rationale of using hypoxia-preconditioned MSCs in skin repair and dermal rejuvenation because microvascular integrity is fundamentally necessary to support the tissue perfusion.
SA-β-gal staining further confirmed the rejuvenating effect of hypoxia. Young ADMSCs displayed minimal SA-β-gal positivity, while aged normoxic ADMSCs showed a significant accumulation of senescent cells. Hypoxia-preconditioned aged ADMSCs exhibited a notable reduction in SA-β-gal-positive cells, suggesting alleviation of cellular senescence and restoration of a more youthful phenotype. These findings align with previous reports indicating that hypoxia mitigates senescence-associated alterations and improves the functional capacity of aged MSCs[44]. The reduction in SA-β-gal positive correlates with our findings of enhanced proliferation and clonogenic potential, and the gene expression pattern (lowered p53/p21/p16), which shows a determined suppression of senescence markers. The concordance between the functional, and transcriptional dimensions of our findings strengthens the internal validity of the results.
Aging of MSCs is characterized by impaired self-renewal, loss of differentiation on potential, and deregulated stress response pathways. In our study, we observed distinct differences in gene expression patterns between young ADMSCs and aged ADMSCs. Aged ADMSCs maintained under normoxia showed strong upregulation of survival and stress-associated genes (AKT1, SIRT1, IGF1, VEGF, SDF1), consistent with earlier findings where aged stem cells exhibited compensatory activation of pro-survival pathways as a response to oxidative stress and replicative exhaustion[45]. Simultaneously, we observed marked downregulation of apoptotic regulators (BAX, BAK1) and senescence-associated checkpoint genes (p53, p21, p16), a pattern previously reported to impair DNA damage responses and promote accumulation of dysfunctional MSCs. Importantly, hypoxic preconditioning reversed many of these maladaptive changes, as aged ADMSCs exposed to low oxygen tension exhibited reduced overactivation of AKT1, SIRT1, IGF1, VEGF, and SDF1, while simultaneously restoring the expression of BAX, BAK1, p53, p21, and p16. This is in line with other study who demonstrated that hypoxia preserves MSC stemness, enhances DNA repair capacity, and mitigates senescence through stabilization of HIF-1α and induction of downstream adaptive pathways[46,47].
The transcriptional reprogramming offers a biological basis for the observed improvements in growth, clonogenicity, migration, and angiogenesis, elucidating why the recovery process is not limited to a specific functional pathway. The findings of this study indicate that hypoxia reduces proximal stress-response and survival mechanisms, although may not fully reverse more significant age-related alterations in epigenetics or genomes. These findings indicate that hypoxia preconditioning may rejuvenate aged MSCs by restoring many cellular functions essential for tissue regeneration. This approach increases proliferation, clonogenicity, differentiation, migration and angiogenesis and decreases senescence and apoptosis. The theoretical idea of hypoxia-preconditioned cells is a pragmatic approach to enhance autologous MSC therapy, without any genetic alteration. Important implications for clinical applications in regenerative dermatology are associated with the observed rejuvenation of aged MSCs under hypoxia. Autologous therapies for skin rejuvenation, wound healing, and anti-aging frequently experience limitations because to the low quality of MSCs recovered from aged donors. In this study, hypoxic preconditioning was shown to be a simple, reproducible, and clinically applicable method for restoring functional competence in aged MSCs without the necessity of genetic modification or exogenous factors. By enhancing proliferation, clonogenicity, differentiation, migration, and angiogenesis, hypoxia-preconditioned MSCs could function as more potent therapeutic agents in dermal regeneration. Further research is required to optimize oxygen concentrations, determine the duration of hypoxic exposure, and evaluate long-term safety. Moreover, in vivo validation in animal models and clinical trials is necessary to confirm the therapeutic superiority of hypoxia-preconditioned MSCs in real-world applications.
The properties of MSCs have prompted significant interest in their application in cell therapy. These properties include the modulation of biological processes, including low immunogenicity, inflammation and angiogenesis, as well as high expansion and differentiation in vitro. However, the potential of MSCs from aged donors is significantly reduced. The benefits of cell-based therapy can be compromised if the cells from such patients are taken for autologous use. Optimizing culture conditions is the preferable method to improve the regenerative potential of cells prior to their use. Various pretreatment strategies have been implemented to optimize the regenerative potential of stem cells. However, hypoxic preconditioning appears to be more effective in improving stem cell function due to the relatively low oxygen concentrations that are present in stem cell niches in comparison to normoxic conditions. This study provides strong evidence that hypoxic preconditioning reverses age-associated impairments in adipose-derived MSCs across key functional parameters, including morphology, proliferation, clonogenicity, differentiation, migration, angiogenesis, and gene expression. Hypoxia is a viable approach for various applications such as anti-aging therapies, wound repair, skin rejuvenation, and vascular regeneration.
The authors acknowledge the support of their institution for providing the necessary resources and facilities to carry out this research.
| 1. | Berebichez-Fridman R, Montero-Olvera PR. Sources and Clinical Applications of Mesenchymal Stem Cells: State-of-the-art review. Sultan Qaboos Univ Med J. 2018;18:e264-e277. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 390] [Cited by in RCA: 324] [Article Influence: 40.5] [Reference Citation Analysis (0)] |
| 2. | Tong Y, Tu Y, Wang J, Liu X, Su Q, Wang Y, Wang W. Mechanisms and therapeutic strategies linking mesenchymal stem cells senescence to osteoporosis. Front Endocrinol (Lausanne). 2025;16:1625806. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 11] [Article Influence: 11.0] [Reference Citation Analysis (0)] |
| 3. | Li H, Bai L. Advances in mesenchymal stem cell and exosome-based therapies for aging and age-related diseases. Stem Cell Res Ther. 2025;16:401. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 10] [Reference Citation Analysis (0)] |
| 4. | Dutra Alves NS, Reigado GR, Santos M, Caldeira IDS, Hernandes HDS, Freitas-Marchi BL, Zhivov E, Chambergo FS, Nunes VA. Advances in regenerative medicine-based approaches for skin regeneration and rejuvenation. Front Bioeng Biotechnol. 2025;13:1527854. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 27] [Reference Citation Analysis (0)] |
| 5. | Wong RS, Ng NC, Brianna B, Goh BH. Role of Mesenchymal Stem Cells in Skin Aging and Damage: Insights from Recent Preclinical and Clinical Studies. Curr Stem Cell Rep. 2025;11:4. [DOI] [Full Text] |
| 6. | Yang YK, Ogando CR, Wang See C, Chang TY, Barabino GA. Changes in phenotype and differentiation potential of human mesenchymal stem cells aging in vitro. Stem Cell Res Ther. 2018;9:131. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 539] [Cited by in RCA: 480] [Article Influence: 60.0] [Reference Citation Analysis (2)] |
| 7. | Choudhery MS, Badowski M, Muise A, Pierce J, Harris DT. Donor age negatively impacts adipose tissue-derived mesenchymal stem cell expansion and differentiation. J Transl Med. 2014;12:8. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 442] [Cited by in RCA: 401] [Article Influence: 33.4] [Reference Citation Analysis (2)] |
| 8. | Costa LA, Eiro N, Fraile M, Gonzalez LO, Saá J, Garcia-Portabella P, Vega B, Schneider J, Vizoso FJ. Functional heterogeneity of mesenchymal stem cells from natural niches to culture conditions: implications for further clinical uses. Cell Mol Life Sci. 2021;78:447-467. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 271] [Cited by in RCA: 242] [Article Influence: 48.4] [Reference Citation Analysis (1)] |
| 9. | Moniz I, Ramalho-Santos J, Branco AF. Differential Oxygen Exposure Modulates Mesenchymal Stem Cell Metabolism and Proliferation through mTOR Signaling. Int J Mol Sci. 2022;23:3749. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 22] [Cited by in RCA: 18] [Article Influence: 4.5] [Reference Citation Analysis (0)] |
| 10. | Biniazan F, Stoian A, Haykal S. Adipose-Derived Stem Cells: Angiogenetic Potential and Utility in Tissue Engineering. Int J Mol Sci. 2024;25:2356. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 38] [Reference Citation Analysis (6)] |
| 11. | Li M, Jiang Y, Hou Q, Zhao Y, Zhong L, Fu X. Potential pre-activation strategies for improving therapeutic efficacy of mesenchymal stem cells: current status and future prospects. Stem Cell Res Ther. 2022;13:146. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 88] [Cited by in RCA: 90] [Article Influence: 22.5] [Reference Citation Analysis (1)] |
| 12. | Yang Y, Lee EH, Yang Z. Hypoxia-Conditioned Mesenchymal Stem Cells in Tissue Regeneration Application. Tissue Eng Part B Rev. 2022;28:966-977. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 9] [Cited by in RCA: 97] [Article Influence: 19.4] [Reference Citation Analysis (1)] |
| 13. | Antebi B, Rodriguez LA 2nd, Walker KP 3rd, Asher AM, Kamucheka RM, Alvarado L, Mohammadipoor A, Cancio LC. Short-term physiological hypoxia potentiates the therapeutic function of mesenchymal stem cells. Stem Cell Res Ther. 2018;9:265. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 125] [Cited by in RCA: 112] [Article Influence: 14.0] [Reference Citation Analysis (0)] |
| 14. | Heylman CM, Caralla TN, Boehm CA, Patterson TE, Muschler GF. Slowing the Onset of Hypoxia Increases Colony Forming Efficiency of Connective Tissue Progenitor Cells In Vitro. J Regen Med Tissue Eng. 2013;2. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 7] [Cited by in RCA: 7] [Article Influence: 0.5] [Reference Citation Analysis (0)] |
| 15. | Skrypnyk M. Current progress and limitations of research regarding the therapeutic use of adipose-derived stem cells: literature review. J Umm Al-Qura Univ Appll Sci. 2025;11:63-75. [DOI] [Full Text] |
| 16. | Yang YK. Aging of mesenchymal stem cells: Implication in regenerative medicine. Regen Ther. 2018;9:120-122. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 51] [Cited by in RCA: 68] [Article Influence: 8.5] [Reference Citation Analysis (0)] |
| 17. | Elmi F, Soltanmohammadi F, Fayeghi T, Farajnia S, Alizadeh E. Preventing MSC aging and enhancing immunomodulation: Novel strategies for cell-based therapies. Regen Ther. 2025;29:517-539. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 3] [Cited by in RCA: 12] [Article Influence: 12.0] [Reference Citation Analysis (2)] |
| 18. | Jiang X, Li W, Ge L, Lu M. Mesenchymal Stem Cell Senescence during Aging:From Mechanisms to Rejuvenation Strategies. Aging Dis. 2023;14:1651-1676. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 3] [Cited by in RCA: 48] [Article Influence: 16.0] [Reference Citation Analysis (0)] |
| 19. | Ma M. Role of Hypoxia in Mesenchymal Stem Cells from Dental Pulp: Influence, Mechanism and Application. Cell Biochem Biophys. 2024;82:535-547. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 15] [Reference Citation Analysis (0)] |
| 20. | Ahmed NE, Murakami M, Kaneko S, Nakashima M. The effects of hypoxia on the stemness properties of human dental pulp stem cells (DPSCs). Sci Rep. 2016;6:35476. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 95] [Cited by in RCA: 92] [Article Influence: 9.2] [Reference Citation Analysis (1)] |
| 21. | Kwon SY, Chun SY, Ha YS, Kim DH, Kim J, Song PH, Kim HT, Yoo ES, Kim BS, Kwon TG. Hypoxia Enhances Cell Properties of Human Mesenchymal Stem Cells. Tissue Eng Regen Med. 2017;14:595-604. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 111] [Cited by in RCA: 100] [Article Influence: 11.1] [Reference Citation Analysis (1)] |
| 22. | Choi JR, Yong KW, Wan Safwani WKZ. Effect of hypoxia on human adipose-derived mesenchymal stem cells and its potential clinical applications. Cell Mol Life Sci. 2017;74:2587-2600. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 66] [Cited by in RCA: 65] [Article Influence: 7.2] [Reference Citation Analysis (1)] |
| 23. | Chen C, Tang Q, Zhang Y, Yu M, Jing W, Tian W. Physioxia: a more effective approach for culturing human adipose-derived stem cells for cell transplantation. Stem Cell Res Ther. 2018;9:148. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 17] [Cited by in RCA: 29] [Article Influence: 3.6] [Reference Citation Analysis (0)] |
| 24. | Nisar A, Khan S, Li W, Hu L, Samarawickrama PN, Gold NM, Zi M, Mehmood SA, Miao J, He Y. Hypoxia and aging: molecular mechanisms, diseases, and therapeutic targets. MedComm (2020). 2024;5:e786. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 19] [Reference Citation Analysis (0)] |
| 25. | Fotia C, Massa A, Boriani F, Baldini N, Granchi D. Hypoxia enhances proliferation and stemness of human adipose-derived mesenchymal stem cells. Cytotechnology. 2015;67:1073-1084. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 76] [Cited by in RCA: 89] [Article Influence: 7.4] [Reference Citation Analysis (0)] |
| 26. | Kakudo N, Morimoto N, Ogawa T, Taketani S, Kusumoto K. Hypoxia Enhances Proliferation of Human Adipose-Derived Stem Cells via HIF-1ɑ Activation. PLoS One. 2015;10:e0139890. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 80] [Cited by in RCA: 81] [Article Influence: 7.4] [Reference Citation Analysis (0)] |
| 27. | Alagesan S, Brady J, Byrnes D, Fandiño J, Masterson C, McCarthy S, Laffey J, O'Toole D. Enhancement strategies for mesenchymal stem cells and related therapies. Stem Cell Res Ther. 2022;13:75. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 40] [Article Influence: 10.0] [Reference Citation Analysis (0)] |
| 28. | Pezzi A, Amorin B, Laureano Á, Valim V, Dahmer A, Zambonato B, Sehn F, Wilke I, Bruschi L, Silva MALD, Filippi-Chiela E, Silla L. Effects Of Hypoxia in Long-Term In Vitro Expansion of Human Bone Marrow Derived Mesenchymal Stem Cells. J Cell Biochem. 2017;118:3072-3079. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 36] [Cited by in RCA: 43] [Article Influence: 4.8] [Reference Citation Analysis (0)] |
| 29. | Alwohoush E, Ismail MA, Al-Kurdi B, Barham R, Al Hadidi S, Awidi A, Ababneh NA. Effect of hypoxia on proliferation and differentiation of induced pluripotent stem cell-derived mesenchymal stem cells. Heliyon. 2024;10:e38857. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 10] [Cited by in RCA: 11] [Article Influence: 5.5] [Reference Citation Analysis (0)] |
| 30. | Hung SP, Ho JH, Shih YR, Lo T, Lee OK. Hypoxia promotes proliferation and osteogenic differentiation potentials of human mesenchymal stem cells. J Orthop Res. 2012;30:260-266. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 202] [Cited by in RCA: 193] [Article Influence: 13.8] [Reference Citation Analysis (1)] |
| 31. | Fotia C, Massa A, Boriani F, Baldini N, Granchi D. Prolonged exposure to hypoxic milieu improves the osteogenic potential of adipose derived stem cells. J Cell Biochem. 2015;116:1442-1453. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 26] [Cited by in RCA: 31] [Article Influence: 3.1] [Reference Citation Analysis (0)] |
| 32. | Song S, Zhang G, Chen X, Zheng J, Liu X, Wang Y, Chen Z, Wang Y, Song Y, Zhou Q. HIF-1α increases the osteogenic capacity of ADSCs by coupling angiogenesis and osteogenesis via the HIF-1α/VEGF/AKT/mTOR signaling pathway. J Nanobiotechnology. 2023;21:257. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 2] [Cited by in RCA: 128] [Article Influence: 42.7] [Reference Citation Analysis (1)] |
| 33. | Yang DC, Yang MH, Tsai CC, Huang TF, Chen YH, Hung SC. Hypoxia inhibits osteogenesis in human mesenchymal stem cells through direct regulation of RUNX2 by TWIST. PLoS One. 2011;6:e23965. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 114] [Cited by in RCA: 141] [Article Influence: 9.4] [Reference Citation Analysis (1)] |
| 34. | Hsu SH, Chen CT, Wei YH. Inhibitory effects of hypoxia on metabolic switch and osteogenic differentiation of human mesenchymal stem cells. Stem Cells. 2013;31:2779-2788. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 88] [Cited by in RCA: 95] [Article Influence: 8.6] [Reference Citation Analysis (0)] |
| 35. | Meng H, Wei F, Ge Z, Jin J, Wang H, Wang LS, Wu CT. Long-term hypoxia inhibits the passage-dependent stemness decrease and senescence increase of human dental pulp stem cells. Tissue Cell. 2022;76:101819. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 8] [Reference Citation Analysis (0)] |
| 36. | Zhao AG, Shah K, Freitag J, Cromer B, Sumer H. Differentiation Potential of Early- and Late-Passage Adipose-Derived Mesenchymal Stem Cells Cultured under Hypoxia and Normoxia. Stem Cells Int. 2020;2020:8898221. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 4] [Cited by in RCA: 21] [Article Influence: 3.5] [Reference Citation Analysis (0)] |
| 37. | Volkmer E, Kallukalam BC, Maertz J, Otto S, Drosse I, Polzer H, Bocker W, Stengele M, Docheva D, Mutschler W, Schieker M. Hypoxic preconditioning of human mesenchymal stem cells overcomes hypoxia-induced inhibition of osteogenic differentiation. Tissue Eng Part A. 2010;16:153-164. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 89] [Cited by in RCA: 82] [Article Influence: 5.1] [Reference Citation Analysis (1)] |
| 38. | Wolff A, Frank M, Staehlke S, Peters K. A Comparative Study on the Adipogenic Differentiation of Mesenchymal Stem/Stromal Cells in 2D and 3D Culture. Cells. 2022;11:1313. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 5] [Cited by in RCA: 27] [Article Influence: 6.8] [Reference Citation Analysis (0)] |
| 39. | Chen W, Zhuo Y, Duan D, Lu M. Effects of Hypoxia on Differentiation of Mesenchymal Stem Cells. Curr Stem Cell Res Ther. 2020;15:332-339. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 14] [Cited by in RCA: 27] [Article Influence: 4.5] [Reference Citation Analysis (0)] |
| 40. | Valorani MG, Montelatici E, Germani A, Biddle A, D'Alessandro D, Strollo R, Patrizi MP, Lazzari L, Nye E, Otto WR, Pozzilli P, Alison MR. Pre-culturing human adipose tissue mesenchymal stem cells under hypoxia increases their adipogenic and osteogenic differentiation potentials. Cell Prolif. 2012;45:225-238. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 123] [Cited by in RCA: 118] [Article Influence: 8.4] [Reference Citation Analysis (0)] |
| 41. | Wagegg M, Gaber T, Lohanatha FL, Hahne M, Strehl C, Fangradt M, Tran CL, Schönbeck K, Hoff P, Ode A, Perka C, Duda GN, Buttgereit F. Hypoxia promotes osteogenesis but suppresses adipogenesis of human mesenchymal stromal cells in a hypoxia-inducible factor-1 dependent manner. PLoS One. 2012;7:e46483. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 135] [Cited by in RCA: 158] [Article Influence: 11.3] [Reference Citation Analysis (0)] |
| 42. | Khasawneh RR, Abu-El-Rub E. Hypoxia disturbs the Migration and Adhesion characteristics of Mesenchymal Stem Cells. Cell Mol Biol (Noisy-le-grand). 2022;68:28-32. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 10] [Reference Citation Analysis (0)] |
| 43. | Zhao Y, Zhang M, Lu GL, Huang BX, Wang DW, Shao Y, Lu MJ. Hypoxic Preconditioning Enhances Cellular Viability and Pro-angiogenic Paracrine Activity: The Roles of VEGF-A and SDF-1a in Rat Adipose Stem Cells. Front Cell Dev Biol. 2020;8:580131. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 6] [Cited by in RCA: 17] [Article Influence: 2.8] [Reference Citation Analysis (0)] |
| 44. | Zhou X, Hong Y, Zhang H, Li X. Mesenchymal Stem Cell Senescence and Rejuvenation: Current Status and Challenges. Front Cell Dev Biol. 2020;8:364. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 48] [Cited by in RCA: 125] [Article Influence: 20.8] [Reference Citation Analysis (0)] |
| 45. | Denu RA, Hematti P. Effects of Oxidative Stress on Mesenchymal Stem Cell Biology. Oxid Med Cell Longev. 2016;2016:2989076. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 172] [Cited by in RCA: 260] [Article Influence: 26.0] [Reference Citation Analysis (0)] |
| 46. | Yu J, Shi J, Zhang Y, Zhang Y, Huang Y, Chen Z, Yang J. The replicative senescent mesenchymal stem / stromal cells defect in DNA damage response and anti-oxidative capacity. Int J Med Sci. 2018;15:771-781. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 23] [Cited by in RCA: 37] [Article Influence: 4.6] [Reference Citation Analysis (0)] |
| 47. | Palomäki S, Pietilä M, Laitinen S, Pesälä J, Sormunen R, Lehenkari P, Koivunen P. HIF-1α is upregulated in human mesenchymal stem cells. Stem Cells. 2013;31:1902-1909. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 94] [Cited by in RCA: 113] [Article Influence: 9.4] [Reference Citation Analysis (0)] |