©The Author(s) 2016.
World J Gastroenterol. Jun 28, 2016; 22(24): 5540-5547
Published online Jun 28, 2016. doi: 10.3748/wjg.v22.i24.5540
Published online Jun 28, 2016. doi: 10.3748/wjg.v22.i24.5540
Table 1 Primer sequences of CCKAR and GAPDH
| Genes | Forward primer (5’-3’) | Reverse primer (5’-3’) |
| CCKAR | ACGGAGGGTAGTGAACTCCA | TCGCAGGCAGAAGTGATGTT |
| GAPDH | GCACCGTCAAGGCTGAGAAT | CATCACGAACATAGGGGCATC |
Table 2 Changes of sphincter of Oddi myoelectric activity in the process of gallstone formation
Table 3 Sphincter of Oddi manometry in the process of gallstone formation
| Group | SO basal pressure | CBD pressure | Amplitude of SO | Frequency of SO |
| Control group | 26.59 ± 8.16 | 23.25 ± 8.35 | 8.72 ± 2.05 | 11.27 ± 3.74 |
| 3-wk group | 21.25 ± 1.38 | 18.48 ± 1.94 | 8.33 ± 3.85 | 11.50 ± 1.64 |
| 6-wk group | 27.57 ± 8.67 | 25.82 ± 8.26 | 8.03 ± 3.15 | 9.33 ± 3.27 |
| 9-wk group | 34.11 ± 11.56 | 32.15 ± 11.64 | 5.89 ± 1.41a | 7.67 ± 3.44a |
| 12-wk group | 52.38 ± 12.84c | 50.11 ± 12.59e | 6.82 ± 1.34 | 10.60 ± 3.51 |
Table 4 Changes in VIP, gastrin and CCK-8 in the process of cholesterol stone formation (pg/mL)
| Group | 3-wk | 6-wk | 9-wk | 12-wk |
| VIP | ||||
| Control | 9.36 ± 2.72 | 9.30 ± 8.91 | 6.91 ± 3.14 | 8.39 ± 0.99 |
| Cholesterol stone | 11.83 ± 3.57 | 7.08 ± 2.31 | 31.20 ± 7.78a | 22.15 ± 2.87c |
| Gastrin | ||||
| Control | 17.83 ± 2.35 | 18.56 ± 5.77 | 17.42 ± 6.39 | 19.41 ± 4.58 |
| Cholesterol stone | 0.08 ± 0.03c | 4.18 ± 2.87 | 2.16 ± 0.44a | 18.92 ± 8.37 |
| CCK-8 | ||||
| Control | 1970.33 ± 439.82 | 2353.32 ± 13.18 | 2100.27 ± 29.70 | 2107.77 ± 171.70 |
| Cholesterol stone | 2214.61 ± 174.96 | 2044.18 ± 147.03 | 2034.75 ± 138.39 | 2042.61 ± 265.01 |
- Citation: Rong ZH, Chen HY, Wang XX, Wang ZY, Xian GZ, Ma BZ, Qin CK, Zhang ZH. Effects of sphincter of Oddi motility on the formation of cholesterol gallstones. World J Gastroenterol 2016; 22(24): 5540-5547
- URL: https://www.wjgnet.com/1007-9327/full/v22/i24/5540.htm
- DOI: https://dx.doi.org/10.3748/wjg.v22.i24.5540
