Dopamine receptor D1-mediated suppression of liver fibrosis via Hippo/Yes-associated protein 1 signaling in levodopa treatment

Abstract

BACKGROUND

Yes-associated protein 1 (YAP1), a downstream transcriptional coactivator regulated by the Hippo signaling pathway, has been shown to be involved in liver fibrosis. YAP activity is modulated by G-protein coupled receptors, including Gα s-coupled protein dopamine receptor D1 (DRD1). Levodopa, a dopamine precursor, activates DRD1 on cell surface, triggering its downstream signaling pathway.

AIM

To investigate the therapeutic effect of levodopa and the downstream mechanism on carbon tetrachloride (CCl₄)-induced liver fibrosis, including liver DRD1 expression.

METHODS

SD rats were intraperitoneally injected with 40% CCl₄ for 8 weeks to induce liver fibrosis, followed by treatment with varying doses of levodopa for 2 weeks. Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) levels were measured, and liver pathology was assessed using hematoxylin and eosin and Masson's staining. Alpha-smooth muscle actin (α-SMA) content, along with the expressions of DRD1, YAP, and phosphorylated protein, was analyzed by Western blot, immunohistochemistry, and reverse transcription–quantitative real-time polymerase chain reaction.

RESULTS

Compared with the controls, levodopa-treated rats showed a decrease in the proportion of collagen in the liver and a recovery from liver fibrosis (P = 0.0007). Western blot and immunohistochemistry indicated that DRD1 was upregulated in the fibrotic liver of rats treated with levodopa, showing an increase in DRD1 Level (P < 0.0001). In addition, the upregulation of DRD1 activated the Hippo signaling pathway, manifested as increased YAP phosphorylation (P < 0.05).

CONCLUSION

This was the first study to demonstrate that levodopa attenuates CCl₄-induced liver fibrosis by inhibiting the Hippo/YAP signaling pathways.

Key Words: Levodopa; Liver fibrosis; Yes1 associated transcriptional regulator; Hippo/Yes-associated protein 1 signaling pathway; Dopamine receptor D1

Core Tip: This study found that levodopa significantly alleviated carbon tetrachloride-induced liver fibrosis in rats by upregulating Gα s-coupled protein dopamine receptor D1 (DRD1) expression and enhancing Yes-associated protein 1 (YAP) phosphorylation through the activation of the Hippo signaling pathway. This study for the first time demonstrates levodopa's potential as a novel therapeutic strategy targeting the DRD1-Hippo/YAP axis in liver fibrosis.

INTRODUCTION

Liver fibrosis is a pathological condition characterized by the destruction of hepatocytes and the activation of hepatic stellate cells (HSCs) resulting from various chronic tissue injuries. Triggered by factors such as alcohol abuse, food poisoning, viral infections (e.g., hepatitis B and C), metabolic disorders (e.g., non-alcoholic steatohepatitis), and environmental toxins, these injuries can lead to abnormal distribution and excessive deposition of extracellular matrix components[1]. If left untreated, liver fibrosis can progress to end-stage liver diseases such as cirrhosis and hepatocellular carcinoma, both of which are associated with severe complications, including liver failure and portal hypertension. Consequently, identifying effective therapies that can delay or reverse the progression of liver fibrosis is a critical research priority. Extensive clinical data and preclinical studies have demonstrated that liver function can be restored following the successful removal of the primary causes of chronic inflammation or injury in both humans and rodents with liver fibrosis[2-5]. While several pharmaceutical agents have been developed to treat liver fibrosis, their effectiveness depends highly on the underlying etiology, disease stage, and progression. No universally approved treatment exists for liver fibrosis, underlining the urgent need for novel therapeutic strategies, particularly those targeting multiple disease mechanisms.

The development of liver fibrosis is primarily driven by the activation of HSCs. The Hippo/Yes-associated protein 1 (YAP) signaling pathway serves as a central regulator of HSC activation following chronic liver injury. Both upstream kinases and downstream transcription coactivators, such as YAP, are essential for modulating downstream signals. In the Hippo signaling pathway, these components primarily exert regulatory effects through a kinase cascade[6]. Upon phosphorylation, YAP is unable to translocate from the cytoplasm to the nucleus, thereby inhibiting the expression of pro-fibrotic factors and consequently suppressing HSC activation, which help alleviate fibrosis[7,8]. Recent studies have shown that YAP activity is elevated in diet-induced liver injury models[9]. Bou Saleh et al[10] demonstrated that key liver functions, including bile duct differentiation and regenerative capacity, which were impaired in human liver fibrotic cells, were restored in fibrotic mice after treatment with YAP inhibitors, suggesting that inhibiting YAP expression in the Hippo signaling pathway might reduce liver fibrosis. Although evidence indicates that YAP activity in fibroblasts promotes fibrosis progression, RNA interference targeting YAP/transcriptional coactivator with PDZ-binding motif (TAZ) in a mouse model of pulmonary fibrosis led to increased lung injury and fibrosis[11]. Recent studies have focused on strategies that specifically inhibit YAP in fibroblasts.

Dopamine receptors are part of the G-protein coupled receptors (GPCRs) superfamily, which includes five receptor members, including the Gα s-coupled protein dopamine D1 (DRD1). DRD1 is preferentially expressed in lung and liver mesenchymal cells, and the use of DRD1 agonists in vivo inhibits YAP nuclear translocation in these cells. Levodopa, an intermediate product of L-tyrosine in catecholamine synthesis, serves as a dopamine precursor and is currently the most effective and widely-used drug for the treatment of Parkinson's disease[12,13]. When injected into rodent and non-human primate models, levodopa is converted into dopamine by the dopa decarboxylase in vivo. The resulting dopamine binds to DRD1 on cell surface, activating the downstream signaling pathway of DRD1[14,15].

The present study for the first time investigated whether levodopa reduces the liver fibrosis index in rats, examining its effects and exploring whether DRD1, a member of GPCRs, could serve as a potential treatment for liver fibrosis.

MATERIALS AND METHODS

Drugs and reagents

Carbon tetrachloride (CCl₄; C805329; Sigma), olive oil (0815211; Sigma), ascorbic acid (A800295; Sigma), and benserazide hydrochloride (B801922; Sigma) were purchased from Shanghai Macklin Biochemical Technology, Inc. Levodopa (72816; Sigma-Aldrich) was purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). The anti-phospho-YAP1 (AF2371), anti-α-smooth muscle actin (anti-α-SMA; AG8004), and GAPDH (AF2819) antibodies were purchased from Beyotime Institute of Biotechnology, Shanghai, China.

Animal modeling and treatment

Male SD rats aged 6 weeks and weighing 200-220 g were purchased from Shanghai Slack Laboratory Animal Center (Shanghai, China) and housed in the animal facility of Shanghai University under specific pathogen-free conditions with a 12-hour light/dark cycle and free access to food and water. All animals received humane care according to the criteria outline in the Guide for the Care and Use of Laboratory Animals of the National Academy of Sciences. The experimental plan was approved by the Ethics Committee of Animal Experiments of the Shanghai University (Shanghai, China; approval No. ECSHU 2023-103). All rats were kept at a controlled temperature of 22-23 °C and maintained on a 12 hours light/12 hours dark cycle, with ad libitum food and water. All animals were acclimated to their new housing conditions for one week prior to the start of the experiments.

Euthanasia was performed under pentobarbital anesthesia followed by cervical dislocation to ensure painless procedures. Based on a previous study, rats received intraperitoneal injection of 1.5 mL/kg 40% CCl₄ (dissolved in olive oil) twice a week for 8 weeks[16,17]. As shown in Figure 1A, the rats were randomly assigned into four groups (n = 8 in each group): CCl₄ group, DOPA-L group, DOPA-H group, and blank control group. Rats in the CCl₄, DOPA-L, and DOPA-H groups were administered with CCl₄, while rats in the blank control group received 1.5 mL/kg normal saline. In week 7, rats in the DOPA-L and DOPA-H groups were additionally given levodopa (10 mg/kg and 25 mg/kg, respectively) for two consecutive weeks. Previous studies have shown that high doses of levodopa (50 and 100 mg/kg) caused dyskinesia and neurotoxicity in rats, while lower doses (10 and 25 mg/kg) did not exhibit these effects[18,19]. Therefore, these two lower doses were selected for the present study. At the experimental endpoint, all animals were anaesthetized with an intraperitoneal injection of 200 mg/kg sodium pentobarbital and euthanized by cervical dislocation. Blood samples were collected via cardiac puncture, and livers were subsequently harvested. Liver and blood samples were stored at -80 °C for further analysis.

Figure 1 Evaluation of the anti-fibrosis effect of L-DOPA in carbon tetrachloride-induced liver fibrosis rat model. A: The rats were divided into four groups. On day 0, 40% carbon tetrachloride (CCl₄) was injected intraperitoneally once every three days. L-DOPA (10 mg/kg) was intraperitoneally injected daily from the 7^th to the 9^th week in the low-dose and the injection group, while L-DOPA (25 mg/kg) was intraperitoneally injected daily from the 7^th to the 9^th week in the high dose group. The intervention effect of L-DOPA on liver fibrosis throughout the entire process of fibrosis and inflammation was observed with normal saline as a control; B: Changes were visualized during the experiment, the body weight of the three groups of rats was measured and standardized to the initial weight at week 7; C: Tukey's multiple comparison tests were performed to detect the levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT) and the ratio of AST to ALT in serum of rats in different groups. ^aP < 0.05; ^cP < 0.001; AST: Aspartate aminotransferase; ALT: Alanine aminotransferase; CCl₄: Carbon tetrachloride.

Histopathology

To evaluate potential histopathological changes and collagen deposition, liver sections (5 µm thick) were stained with hematoxylin and eosin (H&E) and Masson trichrome and then examined under a microscope. For quantitative histological analysis, the degree of fibrosis was determined using the Image-Pro Plus 6.0 imaging software (Media Cybernetics, Inc.).

Immunofluorescence analysis and immunohistochemistry

Paraffin-embedded liver tissue sections were dewaxed and rehydrated, then antigen repair and peroxidase inhibition were performed in 3% H₂O₂ for 15 minutes. The sections were blocked with 10% normal goat serum (Beyotime, Shanghai, China, https://www.beyotime.com) at room temperature for 1 hour, then incubated overnight with primary antibody at 4 °C. Subsequently, the sections were incubated with horseradish peroxidase-labeled secondary antibody or fluorescently-labeled secondary antibody in phosphate-buffered saline. Finally, the tissue slides were covered with a cover glass and examined under an optical microscope.

Western blotting

Tissue lysate was prepared using RIPA lysis buffer (Beyotime Institute of Biotechnology). The lysate was centrifuged, and total protein was separated by sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE0 and transferred onto a polyvinylidene fluoride membrane (Merck Millipore). After blocking with 5% BSA for 1 hour, the membranes were incubated with primary antibodies at 4 °C overnight, followed by incubation with secondary antibodies for 2 hours at room temperature. The protein bands were visualized using an enhanced chemiluminescence detection reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. The gray values of protein bands were analyzed using Image J software.

Reverse transcription-quantitative real-time polymerase chain reaction

Total RNA was extracted from liver tissues using TRIzol^® reagent (R711-01; Vazyme, Inc.). The RNA concentration was determined by measuring the absorbance at 260 nm using a SMA2000 spectrophotometer (Vazyme, Inc.). Reverse transcription was performed using HiScript III RT SuperMix for quantitative real-time polymerase chain reaction (qPCR) (+gDNA wiper; R323-01; Vazyme, Inc.), with the following conditions: 37 °C for 15 minutes and 98 °C for 5 minutes, followed by storage at 4 °C. qPCR was carried out using the SYBR Green PCR Master Mix-PLUS kit (Vazyme, Inc.) on the CFX96 Touch^™ Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). Each 20 µL of reaction mixture contained 10 µL of SYBR Green Mix, 6 µL of nuclease-free H₂O, 2 µL of cDNA, 1 µL of upstream primer, and 1 µL of downstream primer. The qPCR thermal cycling conditions were as follows: Initial denaturation at 95 °C for 60 seconds, followed by 40 cycles of 95 °C for 15 seconds, 60 °C for 15 seconds, and extension at 72 °C for 45 seconds. The primers were synthesized by Tsingke, Ltd. Relative mRNA expression levels were calculated using the 2^-ΔΔCq method, with β-actin used as an internal reference gene. The primer sequences are listed in Table 1.

Table 1 Primer sequences for quantitative polymerase chain reaction.

Gene	Sequence (5'-3')	Product size, bp
β-actin		375
Forward	CGTAAAGACCTCTATGCCAACA
Reverse	TAGGAGCCAGGGCAGTAATC
YAP1		162
Forward	TCCCGGGATGACTCAGGAAT
Reverse	TCCACGCTGTTCAGGAAGTC

YAP1: Yes-associated protein 1.

Statistical analysis

Data are presented as mean ± SD. An unpaired two-tailed Student’s t-test and ANOVA analysis followed by Tukey’s post hoc test were used for single and multiple comparisons between two or more groups, respectively. Images were analyzed using Image J software. P < 0.05 was considered statistically significant.

RESULTS

Levodopa attenuated the CCl₄-induced hepatic fibrosis in rats

Rat models of CCl₄-induced liver fibrosis were successfully established (n = 34; Figure 1A). Animals in the modeling groups exhibited significant weight loss after CCl₄ injection; however, levodopa treatment slowed the weight loss in rats after two weeks of administration (Figure 1B). Furthermore, animals in the DOPA-L group did not exhibit behavioral abnormalities, whereas rats in DOPA-H group displayed slight involuntary movements.

To evaluate the effect of levodopa on liver injury, the serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were measured (Figure 1C). Compared with the blank control group, the AST and ALT levels were significantly elevated in the model groups (P < 0.0001). However, compared to the CCl₄ group, the AST levels in the levodopa treatment groups were significantly reduced (P < 0.0001 and P = 0.0009), indicating that CCl₄ caused liver damage in SD rats and that levadopa treatment reduced the CCl₄-induced liver injury. However, no significant difference in AST levels was observed between DOPA-L and DOPA-H groups (P = 0.7325). Additionally, multiple comparisons revealed that the AST/ALT ratios in the blank control and the treatment groups were significantly lower than that in the CCl₄ group (P = 0.021 and P = 0.029; Figure 1C). These findings suggest that levodopa could attenuate CCl₄-induced hepatic fibrosis in rats.

The liver tissue of rats in the model groups showed pathological changes, including hepatic steatosis and fat vacuoles. H&E staining showed that rats treated with CCl₄ exhibited liver fibrosis with a small amount of fibrous septa, diffuse proliferation of fibers in hepatic lobules, and degeneration and necrosis of hepatocytes around hepatic lobules. Compared with the CCl₄ group, the levodopa treatment groups had significantly reduced connective tissue hyperplasia and segmentation; however, the degree of degeneration and necrosis of liver cells was reduced to a lesser extent. Overall, liver tissue morphologies were improved in DOPA-L and DOPA-H groups; however, the difference was not significant between these two levodopa treatment groups, possibly due to the small difference in the levodopa doses.

It is worth noting that there was no significant difference in liver fibrosis between the low- and high-dose groups (Figure 2A), possibly due to the small difference in drug doses. Masson's trichrome staining revealed that collagen deposition in the CCl₄ group was significantly increased, while the total collagen content in the levodopa treatment groups was lower than that in the blank control group (P < 0.0001 and P = 0.0007). However, there was no significant difference in collagen deposition between DOPA-L and DOPA-H groups (Figure 2B; P = 0.3903).

Figure 2 Morphological, histopathological and immunohistochemical analysis of the effect of L-DOPA on carbon tetrachloride-induced liver fibrosis. A: Representative images of rat liver treated with hematoxylin-eosin and Masson's staining, and α-smooth muscle actin (α-SMA) immunohistochemical staining; B: Western blotting analysis of α-SMA in lysed liver tissue; C and D: The results were standardized relative to of GAPDH expression, and the representative protein bands are displayed on the corresponding histogram. ImageJ software (NIH) was used for quantitative analysis of α-SMA positive area, n = 8/group. ^cP < 0.001; NS: Not significant; H&E: Hematoxylin and eosin; α-SMA: Α-smooth muscle actin; CCl₄: Carbon tetrachloride.

Additionally, potential variations in the protein levels of α-SMA in rat liver tissues were also investigated. Western blot analysis revealed that compared with the blank control group, the α-SMA protein level was upregulated in the CCl₄ group and downregulated in the levodopa treatment groups. Furthermore, immunofluorescence staining of liver tissue paraffin sections showed that, compared with the blank control group, the α-SMA expression was increased in the CCl₄ group (P < 0.0001) but decreased in levodopa treatment groups (P = 0.0076 and P < 0.0001; Figure 2B-D). These results suggest that levodopa significantly inhibits collagen deposition and fibrogenic protein production, thereby reducing CCl₄-induced liver fibrosis in rats.

To explore the signaling pathway through which levodopa inhibits liver fibrosis, the DRD1 protein level was measured using Western blotting and immunohistochemistry (IHC). As shown in Figure 3A and B, compared with the blank control group, DRD1 content in the CCl₄ group was significantly increased (P < 0.0001). Compared with the CCl₄ group, the DRD1 content in the levodopa group was also significantly increased (P < 0.0001). However, no significant difference was observed between the two treatment groups (P = 0.5924). IHC results further confirmed that DRD1 Levels in the CCl₄ group were significantly higher than in the levodopa treatment groups (P < 0.0001; Figure 3C and D) but was still higher than that in the blank control group (P = 0.0008). These findings are consistent with our previous study, which demonstrated that DRD1 Level was proportional to the severity of liver fibrosis.

Figure 3 L-DOPA treatment of liver dopamine D1 pathway. A and B: Western blotting analysis of dopamine D1 (DRD1) in lysed liver tissue, the results were standardized relative to GAPDH expression, and the representative protein bands (B) are displayed on the corresponding histogram; C: Representative fiber images of DRD1 immunohistochemistry in the liver (original magnification, × 100). Scale bar = 100 μm; D: ImageJ software (NIH) was used for quantitative analysis of DRD1 positive area, n = 8/group. ^bP < 0.01; ^cP < 0.001; NS: Not significant; CCl₄: Carbon tetrachloride; DRD1: Dopamine D1.

Based on these results, it can be concluded that DRD1 Levels increase with the severity of liver fibrosis, and that levodopa administration reduces DRD1 Levels in vivo, thereby exerting its anti-liver fibrosis effects.

Levodopa inhibited the nuclear localization of YAP

Previous studies have shown that the Hippo/YAP signaling pathway was involved in liver regeneration, and inhibition of the nuclear translocation of the core factor YAP led to reduced expression of pro-fibrotic factors in the nucleus[7]. Research has also demonstrated that the Hippo signaling pathway was regulated by GPCR signaling. Stimulatory GPCRs activate large tumor suppressor 1 and 2 (LATS1/2) kinase activity, which phosphorylates YAP and inhibits its nuclear transfer function. DRD1 is a stimulatory GCPR-α subtybe. Dopamine binds to DRD1 to regulate Hippo pathway signal transduction. Previous studies have indicated that non-specific knockdown of YAP in the liver promotes hepatocyte necrosis and inhibits the expression of downstream pro-hepatic fibrosis genes[20].

Notably, Western blotting revealed that, compared with the blank control group, YAP expression was significantly decreased following levodopa treatment (P = 0.0143 and P = 0.0013; Figure 4A-C) but showed no significant difference between the DOPA-L and DOPA-H groups (P = 0.0996). IHC results also confirmed that the phosphorylation level of YAP significantly increased in both DOPA-L and DOPA-H groups (P = 0.0432 and P < 0.0001; Figure 4D-F).

Figure 4 Phosphorylation of Yes-associated protein 1 in Hippo signaling pathway. A: Western blotting was used to analyze the expression of p-Yes-associated protein 1 (YAP) in lysed liver tissue, and the results were standardized relative to GAPDH expression (n = 8); B: The representative protein bands were shown on the corresponding histogram; C: The ratio of pYAP to YAP is shown; D: Representative fiber images of liver pYAP immunohistochemistry (original magnification, × 100). Scale bar = 100 μm; E: ImageJ software (NIH) was used for quantitative analysis of DRD1 positive area, n = 8/group; F: Quantitative real-time polymerase chain reaction was used to detect the mRNA expression level of YAP. ^aP < 0.05; ^bP < 0.01; ^cP < 0.001; NS: Not significant; CCl₄: Carbon tetrachloride; YAP: Yes-associated protein 1; qRT-PCR: Reverse transcription-quantitative real-time polymerase chain reaction.

Finally, RNA levels were assessed. Reverse transcription-qPCR showed that the YAP levels in the model group were significantly lower in the CCl₄ group than in the blank control group and the levodopa treatment groups (P = 0.0405 and P = 0.009). These results suggest that levodopa inhibits YAP/TAZ in the Hippo pathway, thereby reducing liver fibrosis.

DISCUSSION

Recent studies have reported that dopamine receptor expression is associated with liver fibrosis[21-23]. Dopamine regulates physiological processes such as metabolism and hormone secretion through two subfamilies of GPCRs: D1-like receptors (DRD1 and DRD5) and D2-like receptors (DRD2, DRD3, and DRD4). DRD1 has been confirmed to be associated with YAP/TAZ in the Hippo pathway and is coupled to stimulatory GCPRs.

It is worth noting that studies have found that DRD1 is preferentially expressed in fibroblasts relative to endothelial and epithelial cells in lung and liver tissues, and DRD1 agonists can alter lung fibroblasts from a profibrotic to a fibrotic regression phenotype[15]. However, the mechanism by which DRD1 regulates liver fibrosis remains unclear.

Our present study for the first time used levodopa, the precursor of dopamine, which is also a drug for the treatment of Parkinson’s disease, to attenuate CCl₄-induced liver fibrosis. Our study demonstrated that levodopa reduced collagen deposition in rat liver tissue and significantly decreased α-SMA expression; however, no significant difference in collagen deposition was observed between DOPA-L and DOPA-H groups, which may be explained by the fact that the effect of levodopa tends to be saturated after reaching a certain dose. In other words, once a certain dose is reached, increasing the dose may not significantly enhance efficacy, but may lead to side effects. Therefore, the therapeutic effect of levodopa may be non-dose-dependent. We will further investigate these aspects in future studies to better understand the underlying mechanisms and refine the experimental design. Additionally, levodopa is an amino acid that is converted into dopamine by the enzyme dopa decarboxylase (DDC) in the body. Dopamine binds to DRD1 on the cell surface with the help of transporters, initiating downstream signaling pathway. This can alter the factors related to the dopamine pathway in vivo, such as DRD1[24,25]. In the present study, levodopa upregulated DRD1 in liver tissue through DDC without increasing the level of DRD1.

The Hippo signaling pathway regulates several aspects of liver function. Specific knockout of YAP/TAZ in hepatocytes has been shown to reduce inflammation and myofibroblast proliferation in mice with liver fibrosis[26]. To verify whether levodopa can attenuate liver fibrosis by inhibiting YAP in the Hippo signaling pathway, we extracted proteins from the liver tissues of rats treated with levodopa, and the phosphorylation level of YAP was measured. Western blotting showed that, compared with the blank control group, the level of YAP phosphorylation in the liver of the levodopa treatment groups increased, and immunofluorescence assays also revealed a significant increase in YAP phosphorylation. These findings indicated that pYAP was reduced in rats with liver fibrosis, which was consistent with the previous studies[27]. Moreover, the levels of YAP and pYAP were correlated, suggesting that levodopa may influence pYAP by affecting YAP level to play a role in treating liver fibrosis.

We also found that the indicators of liver fibrosis showed no significant changes in SD rats treated with different doses of levodopa, which may be attributed to the minimal differences in levodopa dosages. Nevertheless, we observed that levodopa holds potential as a therapeutic agent for liver fibrosis. Based on these findings, low-dose levodopa may be employed in the treatment regimen, potentially combined with dopamine receptor agonists to optimize efficacy while minimizing required dose. For individuals with liver fibrosis, levodopa dosage may be tailored, along with close liver function monitoring.

The present study had certain limitations. First, while the results indicated that levadopa alleviated CCl₄-induced liver fibrosis in rats, its role in other animal models (e.g., bile duct ligation-induced liver fibrosis models) warrant further investigations. Second, neither cell nor gene experiments were performed in this animal study. Third, although it has been reported that the half-life of levodopa in the brain and blood is short (1.5 to 2 hours)[28], the pharmacokinetics of levodopa in the liver remains unclear.

Levodopa has shown potential as a long-term treatment for liver fibrosis, primarily through its antioxidant properties, modulation of HSC activation, and promotion of hepatocyte repair. While most research has focused on animal models, further studies are needed to confirm its efficacy in humans. Monotherapy in liver fibrosis often yields suboptimal outcomes, suggesting that levodopa may be more effective when combined with other therapeutic agents. Combinations with antioxidants, anti-inflammatory agents, immunomodulators, and other drugs may produce synergistic effects, enhancing its anti-fibrotic properties. In future clinical studies, levodopa could emerge as a promising therapeutic option for liver fibrosis, especially when used in combination with other treatments to improve patient outcomes.

CONCLUSION

In summary, levodopa may exert a potentially protective role against liver fibrosis (Figure 5). This is the first study to demonstrate that levodopa can ameliorate CCl₄-induced liver fibrosis by inhibiting the Hippo/YAP signaling pathways, thereby serving as a new drug for the prevention and treatment of liver fibrosis. However, the action of mechanism and clinical safety of levodopa remain to be explored.

Figure 5 Schematic diagram illustrates the protective mechanism of levodopa on liver fibrosis by inhibiting the Hippo/Yes-associated protein 1 signaling pathway. HSC: Hepatic stellate cell; CCl₄: Carbon tetrachloride; α-SMA: Α-smooth muscle actin; DDC: Dopa decarboxylase, dopamine dopa; DRD1: Dopamine receptor 1; YAP: Yes-associated protein 1.