©The Author(s) 2024.
World J Clin Cases. Aug 26, 2024; 12(24): 5492-5501
Published online Aug 26, 2024. doi: 10.12998/wjcc.v12.i24.5492
Published online Aug 26, 2024. doi: 10.12998/wjcc.v12.i24.5492
Table 1 Primer sequences for each gene
| Gene | Forward | Reverse |
| TEX14 | ATGTCGGACATCGGAGACTG | CTGGTCTCCAAGTCGAAAG |
| ADAM17 | CTGGCTGGCTCATCACATTC | CATGCCTGTAATCCCAGCAC |
| β-actin | AGAGCCTCGCCTTTGCCGATCC | CTGGGCCTCGTCGCCCACATA |
Table 2 Differences in TEX14 and ADAM17 mRNA profiles between colorectal cancer tissues and adjacent normal tissues
| Group | n | TEX14 mRNA | ADAM17 mRNA |
| CRC tissues | 86 | 1.61 ± 0.23 | 1.82 ± 0.29 |
| Adjacent normal tissues | 86 | 0.98 ± 0.13 | 1.00 ± 0.12 |
| t value | 22.114 | 24.230 | |
| P value | < 0.001 | < 0.001 |
Table 3 TEX14 and ADAM17 protein profiles in colorectal cancer and adjacent normal tissues
| Group | n | TEX14 | ADAM17 | ||||||
| (-) | (+) | (++) | (+++) | (-) | (+) | (++) | (+++) | ||
| CRC tissues | 86 | 25 (29.07) | 20 (23.26) | 29 (33.72) | 12 (13.95) | 19 (22.09) | 31 (36.04) | 27 (31.40) | 9 (10.47) |
| Adjacent normal tissues | 86 | 63 (73.26) | 17 (19.76) | 6 (6.98) | 0 (0) | 55 (63.95) | 18 (20.93) | 13 (15.12) | 0 (0) |
| χ2 value | 43.767 | 34.863 | |||||||
| P value | < 0.001 | < 0.001 | |||||||
Table 4 Association between the protein profile of TEX14 and clinical pathology
| Pathological features | n | TEX14 | χ2 value | P value | ||
| Positive, n = 61 | Negative, n = 25 | |||||
| Age | ≥ 65 years | 54 | 36 (66.67) | 18 (33.33) | 1.279 | 0.258 |
| < 65 years | 32 | 25 (78.13) | 7 (21.88) | |||
| Sex | Male | 47 | 35 (74.47) | 12 (25.53) | 0.629 | 0.428 |
| Female | 39 | 26 (66.67) | 13 (33.33) | |||
| Pathological type | Tubular adenocarcinoma | 33 | 23 (69.70) | 10 (30.30) | 0.715 | 0.699 |
| Villous adenocarcinoma | 27 | 18 (66.67) | 9 (33.33) | |||
| Papillary carcinoma | 26 | 20 (76.92) | 6 (23.08) | |||
| Tumor diameter | ≥ 3 cm | 46 | 30 (65.22) | 16 (34.78) | 1.565 | 0.211 |
| < 3 cm | 40 | 31 (77.50) | 9 (22.50) | |||
| Differentiation degree | Low differentiation | 27 | 15 (55.56) | 12 (44.44) | 6.602 | 0.037 |
| Moderate differentiation | 25 | 17 (68.00) | 8 (32.00) | |||
| High differentiation | 34 | 29 (85.29) | 5 (14.71) | |||
| TNM staging | Stages I-II | 37 | 21 (56.76) | 16 (43.24) | 6.327 | 0.012 |
| Stages III-IV | 49 | 40 (81.63) | 9 (18.37) | |||
| Lymph node metastasis | Presence | 53 | 43 (83.13) | 10 (18.87) | 6.972 | 0.008 |
| Absence | 33 | 18 (54.55) | 15 (45.45) | |||
| Infiltration depth | T1 + T2 | 37 | 21 (56.76) | 16 (43.24) | 6.486 | 0.039 |
| T3 | 41 | 33 (80.49) | 8 (19.51) | |||
| T4 | 8 | 7 (87.50) | 1 (12.5) | |||
| Distant metastasis | Presence | 46 | 37 (80.43) | 9 (19.57) | 4.333 | 0.037 |
| Absence | 40 | 24 (60.00) | 16 (40.00) | |||
Table 5 Correlation between ADAM17 protein expression and clinical pathology
| Pathological characteristic | n | ADAM17 | χ2 value | P value | ||
| Positive, n = 67 | Negative, n = 19 | |||||
| Age | ≥ 65 years | 54 | 44 (81.48) | 10 (18.52) | 1.077 | 0.299 |
| < 65 years | 32 | 23 (71.88) | 9 (28.13) | |||
| Sex | Male | 47 | 39 (82.98) | 8 (17.02) | 1.549 | 0.213 |
| Female | 39 | 28 (71.79) | 11 (28.21) | |||
| Pathological type | Tubular adenocarcinoma | 33 | 27 (81.82) | 6 (18.18) | 1.308 | 0.520 |
| Villous adenocarcinoma | 27 | 19 (70.37) | 8 (29.63) | |||
| Papillary carcinoma | 26 | 21 (80.77) | 5 (19.23) | |||
| Tumor diameter | ≥ 3 cm | 46 | 38 (82.61) | 8 (17.39) | 1.270 | 0.260 |
| < 3 cm | 40 | 29 (72.50) | 11 (27.50) | |||
| Differentiation degree | Low differentiation | 27 | 20 (74.07) | 7 (25.93) | 10.079 | 0.006 |
| Moderate differentiation | 25 | 15 (60.00) | 10 (40.00) | |||
| High differentiation | 34 | 32 (94.12) | 2 (5.88) | |||
| TNM staging | Stages I-II | 37 | 24 (64.86) | 13 (35.14) | 6.418 | 0.011 |
| Stages III-IV | 49 | 43 (87.76) | 6 (12.24) | |||
| Lymph node metastasis | Presence | 53 | 46 (86.79) | 7 (13.21) | 6.336 | 0.012 |
| Absence | 33 | 21 (63.64) | 12 (36.36) | |||
| Infiltration degree | T1 + T2 | 37 | 24 (64.86) | 13 (35.14) | 7.250 | 0.027 |
| T3 | 41 | 35 (85.37) | 6 (14.63) | |||
| T4 | 8 | 8 (100.00) | 0 (0) | |||
| Distant metastasis | Presence | 46 | 40 (86.96) | 6 (13.04) | 4.706 | 0.030 |
| Absence | 40 | 27 (67.50) | 13 (32.50) | |||
Table 6 Binary variable assignment
| Variable | Assignment | Outcomes |
| TNM staging | Stages I-II | 0 |
| Stages III-III | 1 | |
| Invasion | Infiltration depths T1 + T2 | 0 |
| Infiltration depths T3 + T4 | 1 | |
| Lymph node metastasis | Presence | 1 |
| Absence | 0 | |
| Distant metastasis | Presence | 1 |
| Absence | 0 | |
| TEX14 | Positive | 1 |
| Negative | 0 | |
| ADAM17 | Positive | 1 |
| Negative | 0 |
Table 7 Correlation between TEX14 and ADAM17 profiles and tumor staging, invasion, and metastasis
| C | TEX14 | ADAM17 | ||||||||||
| Β | SE | Wald | OR | 95%CI | P value | β | SE | Wald | OR | 95%CI | P value | |
| TNM staging | 1.207 | 0.518 | 5.429 | 3.343 | 1.211-9.228 | 0.020 | 1.602 | 0.595 | 7.249 | 4.963 | 1.546-15.930 | 0.007 |
| Invasion | 2.703 | 0.988 | 7.485 | 14.924 | 2.152-103.491 | 0.006 | 1.886 | 0.803 | 5.516 | 6.593 | 1.366-31.813 | 0.019 |
| Lymph node metastasis | 1.613 | 0.732 | 4.856 | 5.018 | 1.195-21.067 | 0.028 | 0.978 | 0.466 | 4.405 | 2.659 | 1.067-6.628 | 0.036 |
| Distant metastasis | 1.825 | 0.819 | 4.965 | 6.203 | 1.246-30.884 | 0.026 | 2.077 | 0.804 | 6.674 | 7.980 | 1.651-38.584 | 0.010 |
- Citation: Chen G, Cong LH, Gu CJ, Li P. Correlation between TEX14 and ADAM17 expressions in colorectal cancer tissues of elderly patients and neoplasm staging, invasion, and metastasis. World J Clin Cases 2024; 12(24): 5492-5501
- URL: https://www.wjgnet.com/2307-8960/full/v12/i24/5492.htm
- DOI: https://dx.doi.org/10.12998/wjcc.v12.i24.5492
