Published online Jun 16, 2023. doi: 10.12998/wjcc.v11.i17.4026
Peer-review started: March 28, 2023
First decision: April 11, 2023
Revised: April 21, 2023
Accepted: May 12, 2023
Article in press: May 12, 2023
Published online: June 16, 2023
Processing time: 75 Days and 22.4 Hours
Pseudomonas aeruginosa (P. aeruginosa) is an important cause of nosocomial infections, and contributes to high morbidity and mortality, especially in intensive care units. P. aeruginosa is considered a 'critical' category bacterial pathogen by the World Health Organization to encourage an urgent need for research and development of new antibiotics against its infections.
To investigate the effectiveness of baicalin combined with tobramycin therapy as a potential treatment method for carbapenem-resistant P. aeruginosa (CRPA) infections.
Polymerase chain reaction (PCR) and RT-PCR were used to detect the expression levels of drug-resistant genes (including VIM, IMP and OprD2) and biofilm-related genes (including algD, pslA and lasR) in CRPA that confer resistance to tobramycin, baicalin and tobramycin combined with baicalin (0, 1/8, 1/4, 1/2 and 1MIC).
There was a correlation between biofilm formation and the expression of biofilm-related genes. In addition, VIM, IMP, OprD2, algD, pslA and lasR that confer biofilm production under different concentrations in CRPA were significantly correlated. The synergistic effect of baicalin combined with tobramycin was a significant down-regulation of VIM, IMP, algD, pslA and lasR.
Baicalin combined with tobramycin therapy can be an effective treatment method for patients with CRPA infection.
Core Tip: Baicalin combined with tobramycin therapy shows potential as an effective treatment method for patients with carbapenem-resistant Pseudomonas aeruginosa infection, as it significantly down-regulates drug-resistant and biofilm-related genes.
- Citation: Jin LM, Shen H, Che XY, Jin Y, Yuan CM, Zhang NH. Anti-bacterial mechanism of baicalin-tobramycin combination on carbapenem-resistant Pseudomonas aeruginosa. World J Clin Cases 2023; 11(17): 4026-4034
- URL: https://www.wjgnet.com/2307-8960/full/v11/i17/4026.htm
- DOI: https://dx.doi.org/10.12998/wjcc.v11.i17.4026
Pseudomonas aeruginosa (P. aeruginosa) is an important cause of nosocomial infections, and contributes to high morbidity and mortality, especially in intensive care units[1,2]. P. aeruginosa is considered a 'critical' category bacterial pathogen by the World Health Organization (WHO) to encourage an urgent need for research and development of new antibiotics against its infections. It is an opportunistic pathogen that naturally exists in the human skin, respiratory tract, and gastrointestinal tract. As P. aeruginosa is a common cause of respiratory and urinary tract infections, as well as bloodstream infections, its infections are priority healthcare-associated infections in some hospitals. According to data collected by the Global Drug Resistance Surveillance Network from 1996 to 2016, P. aeruginosa bloodstream infections accounted for 5.3% of all bloodstream infections in more than 200 medical centers in 45 countries.
With the widespread and irrational use of carbapenem antibiotics to treat P. aeruginosa infections, carbapenem-resistant P. aeruginosa (CRPA) strains have gradually appeared, presenting a new challenge to existing clinical treatments. In 2017, WHO listed CRPA as one of the three major bacteria requiring urgent development of new drugs to control infection[3]. Although aminoglycoside antibacterial drug-tobramycin has shown strong efficacy against CRPA, they are dose-dependent, have greater renal and ear toxicity, and are prone to drug resistance[4,5]. At the same time, recent research has increasingly focused on the antibacterial effect of compounds found in traditional Chinese medicine. Among them, baicalin has been shown to have a strong effect on P. aeruginosa in some studies[6].
In vivo experiments showed that baicalin (100 mg/kg) could reduce mortality in mice infected with drug-resistant P. aeruginosa, indicating its potent bacteriostatic effect on this strain[7,8]. Therefore, in this study, the anti-bacterial effect of baicalin combined with tobramycin on CRPA infection was investigated, including the potential synergistic effect of the two drugs against this pathogen. Our previous study also demonstrated the synergistic effect of combining baicalin with tobramycin against CRPA. The biofilm formation ability and biofilm activity of CRPA decreased under the combined effect of baicalin and tobramycin in a non-dose-dependent manner. In this study, RT-polymerase chain reaction (PCR) was used to investigate the synergistic effect of combining baicalin with tobramycin on the expression of carbapenem resistance genes VIM, IMP and OprD2 and biofilm-related genes algD, pslA and lasR in CRPA. In addition, tobramycin combined with baicalin medication group was compared with tobramycin alone medication group to study the effect of baicalin combined with tobramycin on CRPA.
A total of 30 tobramycin-susceptible CRPA strains were collected from inpatients in our hospital from 2018 to 2020. Repeated strains isolated from the same part of the same patient were excluded from this count. All the 30 strains screened met the “Regulations on the Administration of Medical Institutions” of the State Council. The quality control strain ATCC27853 was provided by Mérieux (France). Both baicalin and tobramycin were purchased from Shanghai Maclean Biochemical Technology Co., Ltd (China).
The following reagents were used: Columbia blood agar plate (Mérieux, France), lysostaphin (Shanghai Yuanye Biotechnology Co., Ltd., China), quantitative PCR reagent SG Fast qPCR Master Mix (ABI) and absolute ethanol (Jiangxi Grass Coral Disinfection Products Co., Ltd.). The following equipment were used: Ezup column bacterial genomic DNA extraction kit (Shanghai Sangon Bioengineering Co., Ltd.), 96-well cell culture plate (NEST company), common bacteria incubator (Shanghai Boxun Biotechnology Co., Ltd., China), VITEK turbidimeter (BioMérieux China Co., Ltd., China), Micropipette (Xingchuang Experimental Instrument Co., Ltd., China), Micro Vortex Mixer (Shanghai Huxi Analytical Instrument Factory Co., Ltd., China), Electrothermal Thermostat (Shanghai Yuejin Medical Instrument Co., Ltd., China), Small low-speed centrifuge (Thermo company), SW-CJ-1D clean workbench (Jiangsu Sujie equipment factory), PCR reaction amplifier (BIO company), StepOne fluorescence quantitative PCR instrument (ABI) and Stepone plus fluorescence Quantitative PCR instrument (ABI).
Briefly, the reserved experimental strains were inoculated on Columbia blood plates and cultured overnight at 35°C. After 18-24 h, a single pure colony was inoculated into 4 mL sterile LB broth with shaking at 35°C for 18-24 h. The concentration was then adjusted to 0.5 McDonnell's with sterile physiological saline. A certain amount of bacterial solution was diluted 100 times with sterile solution. To prepare bacterial culture, bacteria containing a certain concentration of tobramycin, baicalin, and tobramycin solution (1, 1/2, 1/4, 1/8 MIC) in LB broth (equivalent to 5 × 105 cfu/mL) was incubated at 35°C for 24 h. For DNA extraction, 1 mL of this bacterial culture was added to a 1.5 mL centrifuge tube and centrifuged at 8000 rpm for 1 min at room temperature, with the supernatant discarded and the precipitate retained as DNA.
PCR and RT-PCR were used to detect the expression of CRPA genes resistant to tobramycin, baicalin, and tobramycin combined with baicalin and biofilm-related genes, including carbapenem resistance genes VIM, IMP and OprD2, and biofilm-related genes algD, pslA, and lasR. With 16SrRNA as the reference gene, the differences in the expression profile of drug resistance genes in different groups were analyzed in comparison with the blank control group. The primers were adapted from previous publications. The primer sequences are shown in Table 1.
| Gene | Sequence | Tm (℃) |
| VIM-1 | RTF:GTTTG GTCGC ATATC GCAAC | 60 |
| VIM-2 | RTR:AATGC GCAGC ACCAG GATAG | 60 |
| IMP-1 | RTF:GAAGG YGTTT ATGTT CATAC | 60 |
| IMP-2 | RTR:GTAMG TTTCA AGAGT GATGCC | 60 |
| OprD-1 | RTF:ATGAA AGTGA TGAAG TGGAG CG | 60 |
| OprD-2 | RTR:TTACA GGATC GACAG CGGAT AG | 60 |
| algD-1 | RTF:CGAGAAGTCCGAACGCCACAC | 60 |
| algD-2 | RTR:ATCGGCGGGAAGTCGTA | 60 |
| pslA-1 | RTF:GGCCTGTTTCCCTACCT | 60 |
| pslA-2 | RTR:GCGGATGTCGTGGTTG | 60 |
| lasR-1 | RTF:GAAGATGGCGAGCGACCTTGGATTC | 60 |
| lasR-2 | RTR:CTCGTGCTGCTTTCGCGTCTGGTAG | 60 |
| 16sRNA | RTF:ACTCCTACGGGAGGCAGCAG | 60 |
| 16sRNA | RTR:ATTACCGCGGCTGCTGG | 60 |
From 2016 to 2020, patients admitted to our hospital with CRPA bloodstream infection were included. Their clinical and microbiological data were comprehensively collected. The inclusion criteria were as follows: (1) Inpatients aged ≥ 18 years; (2) having complete clinical data; and (3) ≥ 1 blood culture specimen of P. aeruginosa with positive culture and clinical evidence of corresponding bloodstream infection and multiple cultures of P. aeruginosa strains collected from the same patient. This study analyzed the first cultured strains.
Patients were divided into death group and survival group according to whether the patients died during hospitalization or not. Univariate analysis was performed on the clinical characteristics, laboratory indicators and treatments of the two groups of patients. Subsequently, univariate analysis results with P < 0.05 were included in the multivariate analysis to explore independent risk factors for patient mortality.
The SPSS version 26.0 statistical software was used to analyze and process the results. Chi-square test was used to analyze count data, and t-test was used for comparison between two samples. Logistic regression analysis was used for multivariate analysis, and the odds ratio and 95%CI were calculated. Values with P < 0.05 were considered statistically significant.
The relative expression levels of CRPA resistance genes and biofilm-related genes varied under different drug concentrations, as shown in Table 2.
| Index | Group | Assay name | ∆Ct | ∆∆CT | Fold change | Up/down |
| 1 | Baicalin | VIM | 15.94 | 2.63 | 0.16 | Down |
| Tobramycin | VIM | 16.81 | 3.50 | 0.09 | Down | |
| Baicalin + tobramycin | VIM | 18.09 | 4.78 | 0.04 | Down | |
| Control | VIM | 13.31 | 1.00 | |||
| 2 | Baicalin | IMP | 13.73 | 2.58 | 0.17 | Down |
| Tobramycin | IMP | 13.49 | 2.34 | 0.20 | Down | |
| baicalin+ tobramycin | IMP | 13.56 | 2.41 | 0.19 | Down | |
| Control | IMP | 11.15 | 1.00 | |||
| 3 | Baicalin | OprD2 | 10.13 | -0.11 | 1.08 | Up |
| Tobramycin | OprD2 | 11.40 | 1.16 | 0.45 | Down | |
| Baicalin + tobramycin | OprD2 | 9.64 | -0.60 | 1.52 | Up | |
| Control | OprD2 | 10.24 | 1.00 | |||
| 4 | Baicalin | algD | 1.88 | 0.37 | 0.77 | Down |
| Tobramycin | algD | 2.23 | 0.72 | 0.61 | Down | |
| Baicalin + tobramycin | algD | 3.44 | 1.93 | 0.26 | Down | |
| Control | algD | 1.51 | 1.00 | |||
| 5 | Baicalin | pslA | 3.29 | 0.63 | 0.65 | Down |
| Tobramycin | pslA | 3.11 | 0.45 | 0.73 | Down | |
| Baicalin + tobramycin | pslA | 3.17 | 0.51 | 0.70 | Down | |
| Control | pslA | 2.66 | 1.00 | |||
| 6 | Baicalin | lasR | 1.18 | -0.09 | 1.06 | Up |
| Tobramycin | lasR | 1.43 | 0.16 | 0.90 | Down | |
| Baicalin + tobramycin | lasR | 1.66 | 0.39 | 0.76 | Down | |
| Control | lasR | 1.27 |
As shown in the Table 2, the drug resistance genes VIM and IMP were significantly down-regulated in both the single-use group and the combination group. Similarly, most of the biofilm-related genes, including algD, pslA and lasR were significantly down-regulated. In contrast, the OprD2 combination and baicalin and tobramycin alone were up-regulated. Mycin was down-regulated, whereas lasR was slightly up-regulated in the baicalin-alone group.
Table 3 shows the Pearson correlation between the amount of biofilm formation and the expression of related genes.
| RB | VIM | IMP | OprD2 | algD | pslA | lasR | |
| RB | 1 | 0.862 | 0.373 | -0.3548 | 0.178 | 0.223 | -0.001 |
| VIM | 1 | 0.761 | 0.287 | 0.319 | 0.1321 | 0.007 | |
| IMP | 1 | -0.811 | 0.0505 | 0.471 | |||
| OprD2 | 1 | 0.3155 | 0.683 | 0.214 | |||
| algD | 1 | 0.4772 | 0.691 | ||||
| pslA | 1 | 0.935 | |||||
| lasR | 1 |
The experimental data revealed a certain correlation between the biofilm formation of the strain and the expression of related genes (Table 3). Significant correlations were found between biofilm volume and VIM (PCC = 0.862, P < 0.01), IMP and VIM (PCC = 0.761, P < 0.05), OprD2 and IMP (PCC = 0.811, P < 0.05), pslA and OprD2 (PCC = 0.683, P < 0.01) and lasR and pslA (PCC = 0.935, P < 0.01).
After applying the inclusion criteria, a total of 57 patients were enrolled in this study, including 22 in the tobramycin combined with baicalin group and 35 in the tobramycin-only group, with a mean age of 58 years. The baseline data for all patients with CRPA bloodstream infections are shown in Table 4. Among the 57 patients, 36 were admitted to the intensive care unit, and 12 were mechanically ventilated. During follow-up, 17 patients died and the remaining patients survived.
| Clinical variables | Patients (n = 57) |
| Age (yr) | 58 ± 23 |
| Length of hospital stay before infection (d) | 24 ± 5 |
| Combeites | |
| Blood system disease | 12 |
| Solid tumor | 11 |
| Admission to intensive care unit | 36 |
| APACHE II | 19 ± 7 |
| TTP | 18 ± 6 |
| Albumin < 30 g/L | 23 |
| Underwent surgery | 18 |
| Invasive mechanical ventilation | 12 |
| Antibiotic application ≥ 7 d | 37 |
| Outcome | |
| Sepsis and shock | 22 |
| Death | 17 |
This paper analyzed clinical variables associated with patient outcomes. The results of univariate analysis showed that APACHE II score, albumin, combined surgical treatment and baicalin combined with tobramycin were significantly associated with the prognosis of patients. As can be seen from the multivariate analysis results shown in Table 5, patients receiving baicalin in combination with tobramycin had a significant improvement in prognosis. Table 5 presents the multivariate logistic regression analysis of death group and survival group in P. aeruginosa bloodstream infection.
| Clinical variables | Odds ratio | 95%CI | P value |
| APACHE II | 1.27 | 1.02-1.58 | 0.033 |
| Albumin < 30 g/L | 6.72 | 1.18-32.57 | 0.035 |
| Underwent surgery | 3.56 | 1.03-6.22 | 0.048 |
| The baicalin in combination with tobramycin | 0.56 | 0.42-0.73 | 0.027 |
P. aeruginosa is a non-fermenting gram-negative bacillus that is a common opportunistic pathogen[9]. It is highly adaptable to external environments and can survive in a humid environment for a long time[10]. When P. aeruginosa contaminates medical water or medical equipment, it easily forms biofilms that are difficult to remove, which often leads to hospital-acquired infections[11]. In recent years, with the widespread use of antibiotics, P. aeruginosa has acquired resistance genes, developing multidrug resistance, pan-drug resistance and even complete resistance[5]. CRPA is resistant strain of P. aeruginosa that poses a great challenge to current clinical treatment[12].
Studies have shown that the current CRPA resistance mechanisms mainly include carbapenemase production, outer membrane permeability protein deletion, and active efflux pump mechanisms[13]. Metallo-β-lactamases (MBLs) are a group of carbapenemases that can extensively hydrolyze β-lactam antibiotics[14]. At present, the MBLs produced by P. aeruginosa are detected in all clinical settings, including the VIM and IMP families, especially VIM-2[15]. In contrast, the domestic P. aeruginosa detections are mainly VIM, IMP and SPM types[16]. Channel proteins are embedded in the lipid bilayer of P. aeruginosa, which is a non-specific, water-soluble diffusion channel that spans the cell membrane. Among them, the outer membrane proteins OprC, OprD2 and OprE show strong pore activity[17]. Scoffield et al[18] and Wang et al[19] reported that OprD2 gene deletion is the main mechanism of P. aeruginosa resistance to imipenem. Quorum sensing is a general mechanism of bacterial cell-to-cell information transfer, which controls the behavior of entire bacterial populations by synthesizing and secreting signaling molecules (also known as autoinducing molecules)[20]. When signal molecules reaches a certain concentration threshold in bacterial population density, the expression of some specific genes is activated, which regulates the adaptive function of bacterial populations. P. aeruginosa strains are characterized by quorum sensing systems, mainly Las quorum sensing systems[21].
The Las system consists of LasR and LasI genes. The Las system is associated with P. aeruginosa infection and can increase its resistance to certain antibiotics, such as imipenem and ciprofloxacin[22]. The algD gene is the first gene encoding an alginate biosynthesis enzyme operon. The transcriptional activation of this gene is associated with the synthesis of alginic acid[23]. It has been reported that acid salts play an important role in the formation of P. aeruginosa biofilms[24]. As a highly conserved sequence, pslA is the first gene encoding glucotransferase on the P. aeruginosa psl operon. It has been reported in the literature that both of these two-polysaccharide synthesis-related genes play key roles in P. aeruginosa adhesion and biofilm formation[25]. Therefore, in this study, the biofilm-related genes
This experiment showed that baicalin, tobramycin and baicalin combined with tobramycin group had different effects on gene expression. Pearson's correlation analysis results revealed a correlation between the amount of biofilm formation and the expression of VIM, IMP, OprD2, algD, pslA and lasR genes. The most significant correlations were as follows: the amount of biofilm and VIM, OprD2 and IMP, pslA and OprD2, lasR and pslA. The drug resistance genes VIM and IMP were significantly down-regulated in the single-use group and the combined drug group. Similarly, most of the biofilm-related genes algD, pslA, and lasR were significantly down-regulated, indicating that the three groups of drugs were all effective against CRPA, with better efficacy in combination than as single medication. The up-regulation of OprD2 combined with baicalin alone was consistent with the results of Scoffield et al[18]. However, the down-regulation of tobramycin alone and the slight up-regulation of lasR in the baicalin group was different, probably due to individual differences among strains, including their inhibition ratios. Other drug resistance mechanisms may also account for this difference. Therefore, the mechanism of action of P. aeruginosa is complex and requires further research.
The fatality rate among patients with P. aeruginosa bloodstream infection is high[26]. Many factors account for the poor prognosis of patients. These can be divided into host including advanced age, APACHE II score, underlying diseases such as hematological diseases and malignant tumors, and septic shock, and iatrogenic factors such as irrational initial antibiotic treatment[27]. The multivariate logistic regression analysis of death in this study showed that APACHE II score, combined surgery, and albumin < 30 g/L were independent risk factors for death[28]. A foreign study involving 187 cases of hospital-acquired P. aeruginosa bloodstream infection showed that the combined use of empiric antibiotics could reduce the mortality of infected patients[29]. Further multivariate analysis showed that empiric sensitive antibiotic therapy could reduce the risk of infection. For patients with suspected infection, sensitive drugs should be empirically used early. Our results showed that patients treated with baicalin combined with tobramycin had significantly better prognosis compared with those treated with tobramycin alone. Therefore, baicalin combined with tobramycin therapy shows potential as an effective treatment for patients with CRPA infection.
Pseudomonas aeruginosa (P. aeruginosa) is an important cause of nosocomial infections, and contributes to high morbidity and mortality, especially in intensive care units. P. aeruginosa is considered a 'critical' category bacterial pathogen by the World Health Organization to encourage an urgent need for research and development of new antibiotics against its infections.
In this study, the anti-bacterial effect of baicalin combined with tobramycin on carbapenem-resistant P. aeruginosa (CRPA) infection was investigated, including the potential synergistic effect of the two drugs against this pathogen.
The objective of this research is to analyze the distribution of CRPA in a specific hospital over a period of time, and to investigate the effectiveness of baicalin combined with tobramycin therapy as a potential treatment method for CRPA infections. The study aims to explore the correlation between biofilm formation and the expression of drug-resistant and biofilm-related genes in CRPA, with the goal of identifying potential targets for effective treatment.
The expression levels of drug-resistant genes and biofilm-related genes in CRPA that confer resistance to tobramycin, baicalin and tobramycin combined with baicalin were detected.
There was a correlation between biofilm formation and the expression of biofilm-related genes. In addition, VIM, IMP, OprD2, algD, pslA and lasR that confer biofilm production under different concentrations in CRPA were significantly correlated. The synergistic effect of baicalin combined with tobramycin was a significant down-regulation of VIM, IMP, algD, pslA and lasR.
Baicalin combined with tobramycin therapy can be an effective treatment method for patients with CRPA infection.
Future research can focus on further investigating the effectiveness of baicalin combined with tobramycin therapy in the treatment of CRPA infections, including exploring optimal dosage and administration methods. Additionally, further studies can explore the mechanisms underlying the down-regulation of drug-resistant and biofilm-related genes by baicalin and tobramycin, as well as potential side effects or limitations of this treatment method. Moreover, more research could be conducted to investigate other potential treatments for CRPA infections and to evaluate their clinical efficacy. Finally, efforts can be made to develop new approaches for preventing and controlling the spread of CRPA in hospitals and healthcare settings.
| 1. | García-Reyes S, Soberón-Chávez G, Cocotl-Yanez M. The third quorum-sensing system of Pseudomonas aeruginosa: Pseudomonas quinolone signal and the enigmatic PqsE protein. J Med Microbiol. 2020;69:25-34. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 49] [Cited by in RCA: 100] [Article Influence: 16.7] [Reference Citation Analysis (0)] |
| 2. | Sharma G, Rao S, Bansal A, Dang S, Gupta S, Gabrani R. Pseudomonas aeruginosa biofilm: potential therapeutic targets. Biologicals. 2014;42:1-7. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 105] [Cited by in RCA: 137] [Article Influence: 11.4] [Reference Citation Analysis (3)] |
| 3. | Mittal R, Lisi CV, Gerring R, Mittal J, Mathee K, Narasimhan G, Azad RK, Yao Q, Grati M, Yan D, Eshraghi AA, Angeli SI, Telischi FF, Liu XZ. Current concepts in the pathogenesis and treatment of chronic suppurative otitis media. J Med Microbiol. 2015;64:1103-1116. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 99] [Cited by in RCA: 145] [Article Influence: 13.2] [Reference Citation Analysis (0)] |
| 4. | Becker B, Cooper MA. Aminoglycoside antibiotics in the 21st century. ACS Chem Biol. 2013;8:105-115. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 222] [Cited by in RCA: 296] [Article Influence: 22.8] [Reference Citation Analysis (0)] |
| 5. | Pang Z, Raudonis R, Glick BR, Lin TJ, Cheng Z. Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnol Adv. 2019;37:177-192. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1874] [Cited by in RCA: 1398] [Article Influence: 199.7] [Reference Citation Analysis (0)] |
| 6. | Ahmadian L, Haghshenas MR, Mirzaei B, Norouzi Bazgir Z, Goli HR. Distribution and Molecular Characterization of Resistance Gene Cassettes Containing Class 1 Integrons in Multi-Drug Resistant (MDR) Clinical Isolates of Pseudomonas aeruginosa. Infect Drug Resist. 2020;13:2773-2781. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 3] [Cited by in RCA: 18] [Article Influence: 3.0] [Reference Citation Analysis (0)] |
| 7. | Pannewick B, Baier C, Schwab F, Vonberg RP. Infection control measures in nosocomial MRSA outbreaks-Results of a systematic analysis. PLoS One. 2021;16:e0249837. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 2] [Cited by in RCA: 16] [Article Influence: 3.2] [Reference Citation Analysis (0)] |
| 8. | Entenza JM, Moreillon P. Tigecycline in combination with other antimicrobials: a review of in vitro, animal and case report studies. Int J Antimicrob Agents. 2009;34:8.e1-8.e9. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 64] [Cited by in RCA: 70] [Article Influence: 4.1] [Reference Citation Analysis (0)] |
| 9. | Al-Tawfiq JA, Bazzi AM, Rabaan AA, Okeahialam C. The effectiveness of antibacterial curtains in comparison with standard privacy curtains against transmission of microorganisms in a hospital setting. Infez Med. 2019;27:149-154. [PubMed] |
| 10. | Alpers K, Vatareck E, Gröbe L, Müsken M, Scharfe M, Häussler S, Tomasch J. Transcriptome Dynamics of Pseudomonas aeruginosa during Transition from Overlapping To Non-Overlapping Cell Cycles. mSystems. 2023;8:e0113022. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 8] [Reference Citation Analysis (0)] |
| 11. | Loveday HP, Wilson JA, Kerr K, Pitchers R, Walker JT, Browne J. Association between healthcare water systems and Pseudomonas aeruginosa infections: a rapid systematic review. J Hosp Infect. 2014;86:7-15. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 93] [Cited by in RCA: 118] [Article Influence: 9.1] [Reference Citation Analysis (0)] |
| 12. | Horcajada JP, Montero M, Oliver A, Sorlí L, Luque S, Gómez-Zorrilla S, Benito N, Grau S. Epidemiology and Treatment of Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa Infections. Clin Microbiol Rev. 2019;32. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 818] [Cited by in RCA: 672] [Article Influence: 96.0] [Reference Citation Analysis (0)] |
| 13. | Jean SS, Harnod D, Hsueh PR. Global Threat of Carbapenem-Resistant Gram-Negative Bacteria. Front Cell Infect Microbiol. 2022;12:823684. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 5] [Cited by in RCA: 251] [Article Influence: 62.8] [Reference Citation Analysis (0)] |
| 14. | Pal A, Dhara L, Tripathi A. Contribution of acrB upregulation & OmpC/Ompk36 loss over the presence of bla(NDM) towards carbapenem resistance development among pathogenic Escherichia coli & Klebsiella spp. Indian J Med Res. 2019;149:528-538. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 10] [Cited by in RCA: 15] [Article Influence: 2.5] [Reference Citation Analysis (0)] |
| 15. | Soberón-Chávez G, González-Valdez A, Soto-Aceves MP, Cocotl-Yañez M. Rhamnolipids produced by Pseudomonas: from molecular genetics to the market. Microb Biotechnol. 2021;14:136-146. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 61] [Cited by in RCA: 78] [Article Influence: 15.6] [Reference Citation Analysis (0)] |
| 16. | Ruiz-Roldán L, Rojo-Bezares B, de Toro M, López M, Toledano P, Lozano C, Chichón G, Alvarez-Erviti L, Torres C, Sáenz Y. Antimicrobial resistance and virulence of Pseudomonas spp. among healthy animals: concern about exolysin ExlA detection. Sci Rep. 2020;10:11667. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 21] [Cited by in RCA: 41] [Article Influence: 6.8] [Reference Citation Analysis (0)] |
| 17. | Zhao C, Li K, Mou X, Zhu Y, Chen C, Zhang M, Wang Y, Zhou K, Sheng Y, Liu H, Bai Y, Li X, Zhou C, Deng D, Wu J, Wu HC, Bao R, Geng J. High-fidelity biosensing of dNTPs and nucleic acids by controllable subnanometer channel PaMscS. Biosens Bioelectron. 2022;200:113894. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2] [Cited by in RCA: 8] [Article Influence: 2.0] [Reference Citation Analysis (0)] |
| 18. | Scoffield JA, Wu H. Oral streptococci and nitrite-mediated interference of Pseudomonas aeruginosa. Infect Immun. 2015;83:101-107. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 52] [Cited by in RCA: 55] [Article Influence: 5.0] [Reference Citation Analysis (0)] |
| 19. | Wang D, Li J, Wang L. Comprehensive study of instable regions in Pseudomonas aeruginosa and Mycobacterium tuberculosis. Biomed Eng Online. 2018;17:133. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 2] [Cited by in RCA: 2] [Article Influence: 0.3] [Reference Citation Analysis (0)] |
| 20. | Wang J, Meng M, Li M, Guan X, Liu J, Gao X, Sun Q, Li J, Ma C, Wei L. Integrin α5β1, as a Receptor of Fibronectin, Binds the FbaA Protein of Group A Streptococcus To Initiate Autophagy during Infection. mBio. 2020;11. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 3] [Cited by in RCA: 14] [Article Influence: 2.3] [Reference Citation Analysis (0)] |
| 21. | Veetilvalappil VV, Manuel A, Aranjani JM, Tawale R, Koteshwara A. Pathogenic arsenal of Pseudomonas aeruginosa: an update on virulence factors. Future Microbiol. 2022;17:465-481. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2] [Cited by in RCA: 34] [Article Influence: 8.5] [Reference Citation Analysis (0)] |
| 22. | González-Alsina A, Mateu-Borrás M, Doménech-Sánchez A, Albertí S. Pseudomonas aeruginosa and the Complement System: A Review of the Evasion Strategies. Microorganisms. 2023;11. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 15] [Reference Citation Analysis (0)] |
| 23. | Satarian F, Hosseini HM, Ghadaksaz A, Amin M, Fooladi AAI. Multi-Drug Resistant Clinical Pseudomonas aeruginosas Inhibited by Ferula gummosa Boiss. Recent Pat Antiinfect Drug Discov. 2018;13:89-99. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 4] [Cited by in RCA: 4] [Article Influence: 0.5] [Reference Citation Analysis (0)] |
| 24. | Ma LZ, Wang D, Liu Y, Zhang Z, Wozniak DJ. Regulation of Biofilm Exopolysaccharide Biosynthesis and Degradation in Pseudomonas aeruginosa. Annu Rev Microbiol. 2022;76:413-433. [PubMed] [DOI] [Full Text] |
| 25. | Kim S, Li XH, Hwang HJ, Lee JH. Thermoregulation of Pseudomonas aeruginosa Biofilm Formation. Appl Environ Microbiol. 2020;86. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 8] [Cited by in RCA: 49] [Article Influence: 8.2] [Reference Citation Analysis (0)] |
| 26. | GBD 2019 Antimicrobial Resistance Collaborators. Global mortality associated with 33 bacterial pathogens in 2019: a systematic analysis for the Global Burden of Disease Study 2019. Lancet. 2022;400:2221-2248. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1699] [Cited by in RCA: 1410] [Article Influence: 352.5] [Reference Citation Analysis (0)] |
| 27. | Gellatly SL, Hancock RE. Pseudomonas aeruginosa: new insights into pathogenesis and host defenses. Pathog Dis. 2013;67:159-173. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 757] [Cited by in RCA: 942] [Article Influence: 72.5] [Reference Citation Analysis (0)] |
| 28. | Karatuna O, Yagci A. Analysis of quorum sensing-dependent virulence factor production and its relationship with antimicrobial susceptibility in Pseudomonas aeruginosa respiratory isolates. Clin Microbiol Infect. 2010;16:1770-1775. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 111] [Cited by in RCA: 98] [Article Influence: 6.1] [Reference Citation Analysis (0)] |
| 29. | Zhao Y, Lin Q, Liu L, Ma R, Chen J, Shen Y, Zhu G, Jiang E, Mi Y, Han M, Wang J, Feng S. Risk Factors and Outcomes of Antibiotic-resistant Pseudomonas aeruginosa Bloodstream Infection in Adult Patients With Acute Leukemia. Clin Infect Dis. 2020;71:S386-S393. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 6] [Cited by in RCA: 45] [Article Influence: 7.5] [Reference Citation Analysis (1)] |
Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/
Provenance and peer review: Unsolicited article; Externally peer reviewed.
Peer-review model: Single blind
Specialty type: Methodology
Country/Territory of origin: China
Peer-review report’s scientific quality classification
Grade A (Excellent): 0
Grade B (Very good): B
Grade C (Good): C
Grade D (Fair): 0
Grade E (Poor): 0
P-Reviewer: Douglas P, Canada; Keluskar J, United States S-Editor: Wang JL L-Editor: A P-Editor: Yu HG