©The Author(s) 2025.
World J Psychiatry. Feb 19, 2025; 15(2): 100738
Published online Feb 19, 2025. doi: 10.5498/wjp.v15.i2.100738
Published online Feb 19, 2025. doi: 10.5498/wjp.v15.i2.100738
Table 1 Primers for single nucleotide polymorphism analysis of rs121918623 C/T* and rs121917953 T/A* polymorphisms
| SNP | Primers | Sequence |
| rs121918623 | Forward primers | WT- 5’ATGATCTTTATTAGCATATTTAACG3’ |
| MT-5’ATGATCTTTATTAGCATATTTAATG3’ | ||
| Reverse primer | R-5’CAGCTTTTCCTAGGGAGTCCAAAAA3' | |
| rs121917953 | Forward primers | WT-5’ACAGTGAAATCGAGCCAGTTCCATGGAT3’ |
| MT-5’ACAGTGAAATCGAGCCAGATCCATGG3’ | ||
| Reverse primer | R-5’TCTGCTTAGTTTTCTTTTTTAGTATTT3’ |
Table 2 Distribution of SCN1A rs121917953 T/A* and SCN1A rs121918623 C/T* polymorphisms in patients with drug-responsive vs drug-resistant epilepsy, n (%)
Table 3 Risk of drug resistance associated with SCN1A rs121917953 genotype, n (%)
| Genotype | Drug-responsive, n = 52 | Drug-resistant, n = 43 | OR (95%CI) | P value |
| TT | 18 (34.6) | 6 (13.9) | Reference | Reference |
| AT | 33 (63.4) | 36 (83.7) | 3.51 (1.256-3.826) | 0.017 |
| AA | 1 (1.9) | 1 (2.3) | 3.33 (0.180-61.686) | 0.419 |
- Citation: Dabla PK, Gupta S, Singh S, Viswas A, Yadav M, Sonkar SC, Koner BC. Sodium channel mutation SCN1A T875M, D188V and associated dysfunction with drug resistant epilepsy. World J Psychiatry 2025; 15(2): 100738
- URL: https://www.wjgnet.com/2220-3206/full/v15/i2/100738.htm
- DOI: https://dx.doi.org/10.5498/wjp.v15.i2.100738
