Sodium channel mutation SCN1A T875M, D188V and associated dysfunction with drug resistant epilepsy

Table 1 Primers for single nucleotide polymorphism analysis of rs121918623 C/T* and rs121917953 T/A* polymorphisms

SNP	Primers	Sequence
rs121918623	Forward primers	WT- 5’ATGATCTTTATTAGCATATTTAACG3’
		MT-5’ATGATCTTTATTAGCATATTTAATG3’
	Reverse primer	R-5’CAGCTTTTCCTAGGGAGTCCAAAAA3'
rs121917953	Forward primers	WT-5’ACAGTGAAATCGAGCCAGTTCCATGGAT3’
		MT-5’ACAGTGAAATCGAGCCAGATCCATGG3’
	Reverse primer	R-5’TCTGCTTAGTTTTCTTTTTTAGTATTT3’

SNP: Single nucleotide polymorphism; WT: Wild-type genotype; MT: Mutant genotype; R: Reverse.

Table 2 Distribution of SCN1A rs121917953 T/A* and SCN1A rs121918623 C/T* polymorphisms in patients with drug-responsive vs drug-resistant epilepsy, n (%)

SCN1A rs121917953 T/A*				SCN1A rs121918623 C/T*
Genotype	Drug-responsive, n = 52	Drug-resistant, n = 43	P value	Genotype	Drug-responsive, n = 41	Drug-resistant, n = 47	P value
TT	18 (34.6)	6 (13.9)	0.001a	CC	39 (95.1)	43 (91.4)	1.00b
AT	33 (63.4)	36 (83.7)		CT	1 (2.4)	4 (8.5)
AA	1 (1.9)	1 (2.3)		TT	1 (2.4)	0 (0)

^aP value calculated using χ² test.

^bP value calculated using Fisher’s exact test, P < 0.05 is considered significant.

Table 3 Risk of drug resistance associated with SCN1A rs121917953 genotype, n (%)

Genotype	Drug-responsive, n = 52	Drug-resistant, n = 43	OR (95%CI)	P value
TT	18 (34.6)	6 (13.9)	Reference	Reference
AT	33 (63.4)	36 (83.7)	3.51 (1.256-3.826)	0.017
AA	1 (1.9)	1 (2.3)	3.33 (0.180-61.686)	0.419

OR: Odds ratio; 95%CI: 95% confidence interval. Reference polymorphism in regression analysis; P value was calculated using Binary Logistic regression analysis.