Copyright
©The Author(s) 2025.
World J Psychiatry. Nov 19, 2025; 15(11): 108964
Published online Nov 19, 2025. doi: 10.5498/wjp.v15.i11.108964
Published online Nov 19, 2025. doi: 10.5498/wjp.v15.i11.108964
Table 1 Primers for single nucleotide polymorphism analysis of rs2279020 A/G and rs211013 A/G polymorphism
| SNP | Primers | Sequence | Restriction enzyme |
| rs2279020 A/G | Forward primer | 5’ GCTATGGATTGGTTTATTGCCGTGTG 3’ | Ava II |
| Reverse primer | 5’ ATAATATTGATGTACTACAGGGAC 3’ | ||
| rs211013 A/G | Forward primer | 5’ AGAAATTTACCAACTGGTCTAGCCGG 3’ | Nci I |
| Reverse primer | 5’ AAATCAAATATTGTGTCATGCTTAGT 3’ |
Table 2 Distribution of rs2279020 polymorphism in patients with drug responsive vs drug resistant epilepsy, n (%)
| Genotype | Drug responsive (n = 50) | Drug resistant (n = 45) | χ2 | P value |
| AA | 30 (60) | 30 (66.7) | 1.608 | 0.488 |
| AG | 13 (26) | 7 (15.6) | ||
| GG | 7 (14) | 5 (11.1) |
Table 3 Risk of drug resistance associated with rs2279020 genotype, n (%)
| Genotype | Drug responsive (n = 50) | Drug resistant (n = 45) | Odds ratio (95%CI) | P value |
| AA | 30 (60) | 30 (66.7) | Reference | Reference |
| AG | 13 (26) | 7 (15.6) | 0.966 (0.346-2.698) | 0.948 |
| GG | 7 (14) | 5 (11.1) | 1.808 (0.480-6.817) | 0.382 |
| AG | 13 (26) | 7 (15.6) | Reference | Reference |
| GG | 7 (14) | 5 (11.1) | 1.667 (0.693-4.004) | 0.253 |
- Citation: Dabla PK, Singh S, Viswas A, Gupta S, Yadav M, Sonkar SC, Koner BC, Serdarevic N. Polymorphic variants in GABA-A receptor and their association with epilepsy and drug resistance: A North Indian cohort study. World J Psychiatry 2025; 15(11): 108964
- URL: https://www.wjgnet.com/2220-3206/full/v15/i11/108964.htm
- DOI: https://dx.doi.org/10.5498/wjp.v15.i11.108964
