BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Psychiatry. Dec 19, 2025; 15(12): 108867
Published online Dec 19, 2025. doi: 10.5498/wjp.v15.i12.108867
Sini-Suanzaoren decoction regulates mitochondrial biogenesis mediated by MT-SIRT1 in the treatment of insomnia rats
Ru-Ting Li, Bi-Juan Lan, Zhuo-Yang Xiao, Qing-Huan Shi, Xin-Yi Chen, Feng Li, School of Traditional Chinese Medicine, Beijing University of Chinese Medicine, Beijing 102488, China
ORCID number: Feng Li (0009-0002-8193-0025).
Author contributions: Li RT initiated the project, designed the experiment and conducted data collection; Li RT, Lan BJ, Shi QH and Chen XY participated in animal experimentation; Li RT and Xiao ZY conducted the collation and statistical analysis, and wrote the original manuscript; Li F make critical revisions to important knowledge content; all authors read and approved the final manuscript.
Supported by the Beijing Natural Science Foundation, No. 7232289.
Institutional animal care and use committee statement: The study was approved by the Animal Ethics Committee of Beijing University of Chinese Medicine (No. BUCM-2024050806-2107).
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: All data generated or analyzed during this study are included in this published article.
Corresponding author: Feng Li, PhD, School of Traditional Chinese Medicine, Beijing University of Chinese Medicine, No. 11 North Third Ring East Road, Chaoyang District, Beijing 102488, China. lifeng_bucm0610@126.com
Received: July 1, 2025
Revised: August 6, 2025
Accepted: September 19, 2025
Published online: December 19, 2025
Processing time: 149 Days and 1.4 Hours

Abstract
BACKGROUND

Insomnia is closely associated with anxiety and depression, with its pathogenesis involving biological, psychological, and social factors. Sini powder and Suanzaoren decoction are clinically effective traditional Chinese medicine formulas for insomnia, demonstrating promising bioactivity. However, the capability of the active components of Sini-Suanzaoren decoction (SNSZRD) to cross the blood-brain barrier (BBB) and their precise molecular mechanisms, particularly concerning the MT-SIRT1 pathway and mitochondrial function, remain largely unexplored.

AIM

To elucidate the bioactive components of SNSZRD that are capable of BBB penetration and investigate the therapeutic mechanism of SNSZRD against insomnia.

METHODS

The chemical components of SNSZRD were analyzed through liquid chromatography-mass spectrometry (LC-MS). Male Sprague-Dawley rats were intraperitoneally injected with DL-4-chlorophenylalanine (PCPA) to establish an insomnia model. Rats were divided into control, model, eszopiclone (positive control), and SNSZRD low-/medium-/high-dose groups. Molecular docking predicted BBB-penetrating components and their binding affinity for SIRT1. Key pathways were analyzed through open-field tests, elevated plus-maze tests, pentobarbital-induced sleep experiments, Haematoxylin and eosin staining, Nissl staining, ELISA, Western blot analysis, quantitative real-time PCR, and immunohistochemistry.

RESULTS

LC-MS identified 1574 compounds in SNSZRD, of which eight prototype components (e.g., pachymic acid and senkyunolide G) could cross the BBB. Molecular docking revealed that these components formed stable hydrogen bonds with the SIRT1 protein. SNSZRD treatment significantly ameliorated PCPA-induced anxiety-like behaviors and sleep latency/sleep duration, as well as reduced neuronal degeneration and Nissl body loss in the hypothalamus of treated rats. Additionally, SNSZRD elevated serum melatonin and hypothalamus ATP levels and upregulated the mRNA and protein expression levels of arylalkylamine N-acetyltransferase, SIRT1, PPARγ coactivator-1α, nuclear respiratory factor-1, and mitochondrial transcription factor A in the MT-SIRT1-mitochondrial biogenesis pathway.

CONCLUSION

SNSZRD might exert its therapeutic effects on insomnia by modulating MT-SIRT1 axis-regulated mitochondrial biogenesis in rats and might serve as an effective therapeutic agent for insomnia.

Key Words: Sini-Suanzaoren decoction; MT-SIRT1-mediated; Mitochondrial biogenesis; Insomnia rats

Core Tip: This study pioneers the scientific validation of Sini-Suanzaoren decoction (SNSZRD) for insomnia by bridging traditional Chinese medicine (TCM) theory with mitochondrial pathophysiology. We identify 8 blood-brain barrier-penetrating components (e.g., senkyunolide G) that activate the MT-SIRT1 pathway, reversing neuronal mitochondrial dysfunction via dose-dependent upregulation of PPARγ coactivator-1α/nuclear respiratory factor-1/mitochondrial transcription factor A. Crucially, we decode TCM principles: "Soothing liver depression" corresponds to SIRT1 stabilization, while "nourishing heart-spirit" aligns with ATP-dependent synaptic repair. This work establishes SNSZRD as a multi-target mitochondrial regulator, offering novel biomarkers (hypothalamic ATP) and lead compounds for insomnia therapeutics.



INTRODUCTION

Insomnia is a globally prevalent sleep disorder, with its pathogenesis involving multifactorial interactions, including neurotransmitter imbalance [e.g., GABA and central serotonin (5-HT) system dysregulation][1], oxidative stress damage[2], circadian rhythm disruption[3], and epigenetic regulation abnormalities[4]. Although benzodiazepines can alleviate insomnia symptoms in the short term, their risks of dependence, cognitive side effects, and interference with the MT signaling pathway limit their long-term use[5]. Consequently, the development of multitarget synergistic herbal formulas, particularly natural compounds modulating melatonin and its downstream signaling axis (e.g., SIRT1), has become a research focus.

Traditional Chinese medicine (TCM) offers a long history and unique advantages in insomnia treatment. Sini powder and Suanzaoren decoction are classic TCM formulations derived from Treatise on Fevers and Synopsis of the Golden Chamber, respectively, with the functions of soothing the liver and resolving depression, as well as nourishing the heart and calming the mind. Modern studies have demonstrated their potential in regulating neural function and improving sleep quality[6,7]. These formulations are often used in combination in clinical practice[8]. However, the specific mechanisms underlying their effects, particularly the molecular pathways related to sleep regulation, remain unclear, and their precise components and doses for treating insomnia require further elucidation.

The current understanding of insomnia mechanisms centers on the hypothalamic-pituitary-adrenal (HPA) axis[9], vagal nerve tension changes[10], reduced melatonin system function[11], inflammatory cytokine effects[12], central neurotransmitter imbalance[13], and abnormalities in the limbic-cortical circuit[14]. Attention has recently been focused on the role of MT and SIRT1 in the sleep-wake cycle. MT, a key regulator of the circadian rhythm[15], and SIRT1, a deacetylase involved in energy metabolism and neuroprotection[16], may modulate oxidative stress and inflammation, contributing to sleep disorder pathogenesis[17]. However, whether Sini-Suanzaoren decoction (SNSZRD) improves insomnia symptoms through the regulation of the MT-SIRT1 axis remains unreported.

This study aims to investigate the therapeutic effects of SNSZRD on an insomnia rat model, focusing on its regulation of the MT-SIRT1 axis to uncover potential mechanisms. By integrating TCM theory with modern molecular biology techniques, this research provides a scientific basis for the use of SNSZRD in treating insomnia and offers new insights for developing novel therapeutic strategies.

MATERIALS AND METHODS
Preparation of SNSZRD

All herbs were purchased from Beijing Tong Ren Tang Pharmaceutical Co., Ltd. The decoction was prepared by extracting the following herbs in the specified proportions: 9 g of Fructus Aurantii Immaturus, 15 g of Radix Paeoniae Alba, 9 g of Radix Bupleuri, 6 g of Radix Glycyrrhizae Preparata, 15 g of Semen Ziziphi Spinosae, 12 g of Rhizoma Chuanxiong, 12 g of Anemarrhenae Rhizoma, and 12 g of Poria. The herbs were soaked for 30 minutes and extracted twice with 10 times the volume of water for 1 hour each time. The combined extracts were lyophilized into powder.

Animal model preparation and grouping

A total of 72 specific pathogen-free-grade male Sprague-Dawley rats (body weight: 200 ± 20 g) were obtained from Beijing SPF Biotechnology Co., Ltd. (animal license: SCXK [Jing] 2024-0001). The animal study was approved by the Animal Ethics Committee of Beijing University of Chinese Medicine (No. BUCM-2024050806-2107). After three days of adaptive feeding, rats were randomly divided into six groups (n = 12 per group) to evaluate rigorously the efficacy of SNSZRD and its dose-response relationship. These groups were the DL-4-chlorophenylalanine (PCPA)-induced insomnia model; blank control; model control; positive drug (eszopiclone); and low-dose (4.02 g/kg), medium-dose (8.04 g/kg), and high-dose (16.08 g/kg) SNSZRD groups. Except for those in the blank control group, all rats received an intraperitoneal injection of PCPA (300 mg/kg, Macklin, batch No.: C16519676) once daily for three consecutive days to establish an insomnia model. PCPA acts as an irreversible inhibitor of tryptophan hydroxylase, depleting central serotonin (5-HT). In preclinical insomnia research, its continuous administration over three days is a widely validated standard regimen that allows sufficient time for the substantial and stable depletion of 5-HT, particularly in critical sleep-regulating areas like the hypothalamus[18,19]. Starting from day 3, the blank and model groups were administered distilled water via gavage daily; the positive drug group received eszopiclone (0.89 mg/kg) solution; and the SNSZRD treatment groups received SNSZRD at doses of 4.02, 8.04, and 16.08 g/kg via gavage for seven consecutive days[20,21].

Behavioral observation

In this study, two behavioral tests were conducted to evaluate the effects of the treatment on rats: The open field test (OFT) and elevated plus-maze (EPM) test. OFT is a behavioral experiment that assesses anxiety levels by observing the activity patterns of experimental animals in open areas. The activity trajectories and areas of stay of animals in open spaces reflect the balance between their exploratory behavior and anxiety levels. EPM uses animals' exploratory behavior in new environments and their fear of high, open arms to examine their anxiety levels. The ratio of time spent on open arms to that on closed arms is used to assess anxiety levels.

OFT: OFT was used to observe the spontaneous behavior and anxiety levels of rats in a novel environment[22]. The behavioral laboratory was kept quiet and ventilated, with dim lighting provided by ceiling-mounted surgical lights. Experimenters maintained distance from the OFT analysis box to avoid visual interference with the animals. Rats were acclimatized to the measurement room for at least 10 minutes before testing. The OFT apparatus was divided into nine equal regions (five central and four peripheral) with colored numbering. During each trial, a rat's tail was gently inserted into region 5 from its base to center the animal. Activity was monitored for 5 minutes and was followed by the removal of feces and cleaning of the testing room with disinfectant and 75% ethanol. Each rat was tested once. At the end of the experiment, video and software statistical analyses were performed. The total distance traveled, average speed, number of entries into the central zone, time spent in the central zone, and rearing frequency were analyzed to assess the effects of SNSZRD on spatial exploration and anxiety/depressive-like behaviors in the insomnia rat model.

EPM test: The EPM test was conducted 12 hours after the final gavage to evaluate the anxiety state of the insomnia rat model[23]. Rats were placed in the center of the maze facing an open arm and allowed to explore for 5 minutes. The maze was connected to a computer system for data collection and analysis with SuperMaze and VisuTrack software. Parameters recorded included the number of entries into open arms (OE), time spent in open arms (OT), number of entries into closed arms (CE), and time spent in closed arms (CT). The percentage of open arm entries (OE%) and time (OT%) were calculated as follows: (1) OE% = [OE/(OE + CE)] × 100%; and (2) OT% = [OT/(OT + CT)] × 100%.

Pentobarbital-induced sleep test: The widely recognized pentobarbital-induced sleep test assesses the sedative-hypnotic effects of drugs[24]. One hour after administration, rats were intraperitoneally injected with pentobarbital sodium (30 mg/kg). Sleep latency (loss of righting reflex) and duration (recovery of righting reflex) were immediately observed. Sleep latency was defined as the time from injection to reflex loss, and sleep duration was calculated as the interval between the loss and recovery of the reflex.

Sampling method

Rats in each group were anesthetized with an appropriate dose of pentobarbital sodium the day after the final administration. Under anesthesia, blood was collected from the abdominal aorta into ordinary blood collection tubes, allowed to stand for 30 minutes, and then centrifuged at 10000 × g for 10 minutes. The supernatant serum was aliquoted and stored at -80 °C for subsequent analysis. Six rats from each group were then perfused transcardially with precooled saline followed by 4% paraformaldehyde. Brain tissues were harvested, fixed in 4% paraformaldehyde, dehydrated, cleared in xylene, embedded in paraffin, and sectioned to a thickness of 4 μm. Sections were flattened, baked, and stored. The hypothalami of six rats from each group were rapidly dissected on ice, snap-frozen in liquid nitrogen, and transferred to -80 °C for further analysis.

Component analysis and brain penetration of SNSZRD in rats

Sample pretreatment: Approximately 100 mg of lyophilized SNSZRD powder was weighed into a 1.5 mL centrifuge tube, then added with 1 mL of water containing a mixed internal standard (4 μg/mL). The mixture was vortexed for 1 minute, added with steel beads, and precooled in a -40 °C freezer for 2 minutes before being ground at 60 Hz for 2 minutes by using a grinder. After ultrasonic extraction in an ice-water bath for 60 minutes, the sample was centrifuged at 1000 rpm (4 °C) for 10 minutes. The supernatant was diluted 2-fold with water (containing 4 μg/mL of the mixed internal standard), and 200 μL of the diluted solution was transferred into a liquid chromatography-mass spectrometry (LC-MS) vial with an insert for analysis. For the preparation of hypothalamic samples, three rats from each group (model and high-dose groups) were euthanized, and 30 mg of hypothalamic tissue was weighed into a 1.5 mL Eppendorf tube containing two small steel beads. The tissue was then processed with 180 μL of methanol-water (4:1, v:v) containing the mixed internal standard, precooled in a -40 °C freezer for 2 minutes, and ground at 60 Hz for 2 minutes. After ultrasonication in an ice-water bath for 3 minutes, the sample was incubated at -40 °C for 2 hours and centrifuged at 12000 rpm (4 °C) for 10 minutes. A total of 120 μL of the resulting supernatant was transferred into a liquid chromatography vial with an insert and stored at -80 °C until LC-MS analysis.

LC-MS conditions: LC-MS was performed by using an ACQUITY UPLC I-Class HF system coupled with a QE high-resolution mass spectrometer. The chromatographic column was an ACQUITY UPLC HSS T3 (100 mm × 2.1 mm, 1.8 μm) with a column temperature of 45 °C. The mobile phases consisted of water with 0.1% formic acid (A) and acetonitrile (B), with a flow rate of 0.35 mL/min and an injection volume of 5 μL. PDA detection was set from 210 nm to 400 nm. The mass spectrometer was operated in HESI ionization mode with positive and negative ion scanning. Data were acquired by using DDA mode: Full MS/dd-MS2 (TOP 8).

Molecular docking

Brain-penetrating components were identified from the analysis, and molecular docking was performed by using AutoDockTools-1.5.7 software[25] to dock these components with SIRT1. The docking results were analyzed and visualized by employing PyMOL 3.1.4[26] and PLIP[27].

Haematoxylin and eosin staining and Nissl staining

Haematoxylin and eosin (HE) staining was conducted as follows: Sections were deparaffinized, covered with water, stained with hematoxylin for 3-8 minutes, and differentiated in hydrochloric acid alcohol solution. Subsequently, the sections were stained with eosin for 1-3 minutes, dehydrated in graded ethanol, treated with xylene, and sealed with neutral resin. Microscopic examination and image acquisition analysis were performed.

Nissl staining: Sections were deparaffinized and covered with water, stained with Nissl stain for 10-30 minutes, differentiated in Nissl differentiation solution for 1-3 minutes, dehydrated in graded ethanol, treated with xylene, and sealed with neutral resin. Microscopic examination and image acquisition analysis were performed.

ELISA for measuring melatonin levels in rat serum and ATP levels in the hypothalamus

ELISA was used to detect the levels of melatonin in the serum of each group of rats and the levels of ATP in the hypothalamus. The operation was conducted in accordance with the methods described in the kit instructions, and a standard curve was plotted. A double-antibody sandwich method was adopted to detect the cytokine content in the serum of each group through an enzyme-labeled assay.

Quantitative real-time PCR

Total RNA was extracted from rat hypothalamic samples by using HiPure Total RNA Mini Kit (R4111-02, Magen, China). Subsequently, in accordance with the manufacturer's protocol, cDNA was synthesized from RNA by using a first-strand cDNA synthesis mix kit (F0202, LABLEAD, China). The reaction conditions for quantitative real-time PCR were as follows: 95 °C for 30 seconds followed by 40 cycles at 95 °C for 10 seconds and 60 °C. Primer sequences are shown in Table 1. GAPDH was used as an internal reference to normalize data, and the relative expression levels of genes was measured. Three replicate wells were set for each experiment. Data were analyzed by employing ArchimedAnalyzer software provided with the instrument, and the final data were analyzed by applying the 2−Δct method.

Table 1 Primer sequence of internal reference gene in quantitative real-time PCR.
Gene
Forward primer (5′-3′)
Reverse primer (5′-3′)
Product length (bp)
AANATCCACCAGTGCGTTTGAGATTGACACAGGGTGAGGAAGTGC99
SIRT1AGGGAACCTCTGCCTCATCTTGGCATACTCGCCACCTAAC100
PGC1GTGCAGCCAAGACTCTGTATGGGTCCAGGTCATTCACATCAAGTTC121
NRF1TATGGCGGAAGTAATGAAAGACGCAACGTAAGCTCTGCCTTGTT101
TFAMATCAAGACTGTGCGTGCATCAAAGCCCGGAAGGTTCTTAG217
GAPDHCTGGAGAAACCTGCCAAGTATGGGTGGAAGAATGGGAGTTGCT138
CybATCTCACCCCCTATTCAAAATCATCGGTATCAGACGTGTAGTGTATTGC160
Immunohistochemistry

Paraffin sections of rat brain tissue were subjected to antigen retrieval. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide. The sections were then incubated with the primary antibodies against arylalkylamine N-acetyltransferase (AANAT; Proteintech, 17990-1-ap, 1:200), SIRT1 (WANLEI; WL02995, 1:300), PPARγ coactivator-1α (PGC-1α; Proteintech, 66369-1-lg, 1:500), nuclear respiratory factor-1 (NRF1; Epizyme, R013020, 1:200), and mitochondrial transcription factor A (TFAM; BOSTER, PB0413, 1:200) at 4 °C overnight. After being washed with PBS, sections were incubated with HRP-conjugated goat antirabbit IgG (SeraCare, 5220-0336, 1:500) or HRP-conjugated goat antimouse IgG (SeraCare, 5220-0341, 1:500) at 37 °C for 60 minutes. DAB staining was performed and was followed by hematoxylin counterstaining, dehydration, clearing, and mounting. Three high-magnification fields per section were randomly selected for observation.

Western blot analysis

Proteins were extracted from the hypothalamus and separated through SDS-PAGE. They were then transferred to a PVDF membrane, which was subsequently blocked with 5% nonfat milk at 4 °C overnight. Primary antibodies against AANAT (BIOSS, bs-3914R, 1:1000), SIRT1 (Abcam, ab110304, 1:2000), PGC-1α (Proteintech, 66369-1-lg, 1:20000), NRF1 (Proteintech, 66832-1-lg, 1:5000), and TFAM (Proteintech, 22586-1-AP, 1:5000) were diluted in blocking buffer and incubated with the membrane at room temperature for 2 hours. After being washed with TBST, the membrane was incubated with HRP-conjugated goat antirabbit IgG (Proteintech, SA00001-2, 1:2000) or HRP-conjugated goat antimouse IgG (Proteintech, SA00001-1-A, 1:2000) for 1 hour at 37 °C. Signals were detected by using ECL reagent and imaged.

Statistical analysis

All experimental data were analyzed with SPSS 19.0 software. Results are expressed as mean ± SD. One-way analysis of variance was performed to determine the statistical significance of intergroup differences, with P < 0.05 and P < 0.01 being considered significant.

RESULTS
Characterization of chemical components in SNSZRD by LC-MS

The chemical components of SNSZRD were analyzed through LC-MS. Figure 1 shows the ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS) base peak chromatograms (BPCs) obtained in positive and negative ion modes (Figure 1A and B). The detected components were compared with those in the reference database LuMet-CM 2.0 to identify compounds on the basis of accurate mass-to-charge ratio (m/z) values, secondary fragment patterns, and isotopic distributions. A total of 1574 compounds were identified. They included flavonoids, carboxylic acids and derivatives, phenylpropanoids, steroids, and others. Supplementary Table 1 provides detailed information on all identified compounds and their reference comparisons. Furthermore, Figure 1C and D illustrate the quantity and composition of chemical components. The results indicated that terpenoids, amino acids and peptides, phenylpropanoids, sugars and glycosides, and flavonoids are the major constituents of the formulation (Figure 1C and D).

Figure 1
Figure 1 Characterization of chemical constituents in Sini-Suanzaoren decoction and rat serum. Base peak chromatogram of Sini-Suanzaoren decoction (SNSZRD) obtained by liquid chromatography-mass spectrometry analysis. A: Negative-ion scan (a: Control serum, b: SNSZRD-containing serum, c: SNSZRD sample); B: Positive-ion scan (d: Control serum, e: SNSZRD-containing serum, f: SNSZRD sample); C: Distribution map of SNSZRD component classification content; D: Distribution map of SNSZRD component classification quantity. BPC: Base peak chromatogram; NEG: Negative-ion; POS: Positive-ion; TCM: Traditional Chinese medicine.
Characterization of the assimilated chemical prototype components in the hypothalamus

The qualitative analysis of the main components of SNSZRD revealed eight prototype compounds that are primarily absorbed into the bloodstream. Comparative studies between hypothalamic tissues treated with the formula and blank serum revealed the bioavailability and metabolic pathways of the compounds. Table 2 lists the detected components, as well as their theoretical and experimental m/z values, fragment ions, and molecular formulas. Figure 1 illustrates the UHPLC-MS BPCs of hypothalamic samples in positive and negative ion modes, highlighting the separation and detection of components. The findings suggest that the identified compounds contribute to the pharmacological effects of SNSZRD through their bioactive properties and metabolic transformations.

Table 2 The binding ability of the specific brain-entry ingredients of Sini-Suanzaoren decoction to SIRT1.
Formula
Metabolites
Theoretical m/z
m/z
Retention time (min)
Binding energy (kcal/mol)
C48H72O21licoricesaponin a3985.4619985.46296.34-9.5
C12H16O3Senkyunolide G209.1170209.11718.02-8.1
C33H52O5Pachymic acid567.3542567.349412.43-7.8
C20H20O7Tangeretin373.1274373.12789.62-7.3
C12H16O5Senkyunolide-R239.0919239.09225.71-7.0
C18H35NO9-octadecenamide326.2679326.269012.53-6.2
C10H16N4O3Ophidine241.1285241.12900.84-5.4
C9H18N2O3L-alanyl-L-leucine203.1390203.13902.73-5.0
Targeted analysis of SNSZRD components binding to SIRT1 in the rat brain

A list of eight chemical components from the formulation was obtained through the analysis of the brain-penetrating components. By using AutoDockTools-1.5.7, these components were docked with SIRT1 (PDB ID: 4IF6), and their binding energies are recorded in Table 2. Binding energy < -5.0 kcal/mol indicates good binding activity, and binding energy < -9.0 kcal/mol indicates strong binding activity. As shown in Table 1, the brain-penetrating components of SNSZRD exhibited strong binding affinity for SIRT1. Six docking results were selected, and binding sites and bond lengths were analyzed by employing PyMOL 3.1.4 and PLIP (Figure 2). The results show that the LYS-328 residue of SIRT1 could form a stable hydrogen bonding force with pachymic acid (Figure 2A), the ASP-334 and LYS-335 residues of SIRT1 could form a stable hydrogen bonding force with senkyunolide R (Figure 2B), and the HIS-363 and GLN-345 residues of SIRT1 could form a stable hydrogen bonding force with senkyunolide G (Figure 2C). Moreover, the ARG-466, ASN-503, LYS-328, LEU-500, and CYS-502 residues of SIRT1 could form a stable hydrogen bonding force with licoricesaponin a3 (Figure 2D). The LYS-335 and GLN-357 residues of SIRT1 could form a stable hydrogen bonding force with tangeretin (Figure 2E). The PRO-271 residue of SIRT1 could form a stable hydrogen bonding force with 9-octadecenamide (Figure 2F).

Figure 2
Figure 2 Visualization of molecular docking between the brain-entering components of Sini-Suanzaoren decoction and SIRT1. A: Pachymic acid; B: Senkyunolide-R; C: Senkyunolide G; D: Licoricesaponin a3; E: Tangeretin; F: 9-octadecenamide.
SNSZRD improves behavioral and emotional symptoms in rats with PCPA-induced insomnia

The general status of rats was first observed to study the effect of SNSZRD on insomnia-related symptoms in rats. The control group exhibited good mental status, shiny fur, regular circadian rhythm, and gradual body weight gain. By contrast, the PCPA-induced model rats showed circadian rhythm disruption, increased daytime activity, irritability, and significant weight loss. Following seven-day interventions, eszopiclone and SNSZRD treatment (high/medium/Low dose) restored the weights of rats to 92%-97% of those in the blank control group (Figure 3A). These findings suggest that SNSZRD can improve insomnia-related symptoms in rats. Compared with blank group rats, model group rats showed significant reductions in total movement distance, average speed, central zone entry frequency, central zone dwell time, and rearing frequency (P < 0.001), indicating decreased spontaneous activity, impaired spatial exploration, and anxiety-like behaviors. By contrast, treatment with eszopiclone or SNSZRD (high/medium/Low dose) significantly increased these parameters (P < 0.05), with high-dose SNSZRD being the most effective treatment (Figure 3B-F). In addition, model group rats spent significantly less time in open arms and entered open arms less frequently than control group rats (P < 0.001). Rats treated with eszopiclone or SNSZRD showed significant increases in these values (Figure 3G and H; P < 0.05). The above results indicate that SNSZRD improved the spatial and environmental exploration abilities of rats with insomnia and reduced anxiety-like behavior. Compared with control group rats, model group rats had significantly prolonged sleep latency and reduced sleep duration (P < 0.01). Treatment with eszopiclone or SNSZRD (high/medium/Low doses) significantly shortened sleep latency and prolonged sleep duration (P < 0.05), confirming the hypnotic effects of the formula (Figure 3I and J). High-dose SNSZRD (16.08 g/kg) induced significantly greater improvements in sleep latency reduction and neuronal protection compared with medium-dose SNSZRD, confirming a robust dose-response relationship (Figure 3I and J). These findings collectively indicate that SNSZRD ameliorates PCPA-induced behavioral and physiological disruptions in a dose-responsive manner.

Figure 3
Figure 3 Effect of Sini-Suanzaoren decoction on body weight, behavioral assessments, serum melatonin levels, hypothalamic ATP content in rats. A: Body weight changes across all groups; B-F: Open field test results; G and H: Elevated plus maze test results; I and J: Pentobarbital-induced sleep test results; K: Serum melatonin content in each group; L: Hypothalamic ATP content in each group. aP < 0.001, model group vs control group; bP < 0.01, model group vs control group; cP < 0.05, positive group vs model group; dP < 0.01, positive group vs model group; eP < 0.001, positive group vs model group; fP < 0.05, Sini-Suanzaoren decoction (SNSZRD) low dose group vs model group; gP < 0.01, SNSZRD low dose group vs model group; hP < 0.001, SNSZRD low dose group vs model group; iP < 0.05, SNSZRD middle dose group vs model group; jP < 0.01, SNSZRD middle dose group vs model group; kP < 0.001, SNSZRD middle dose group vs model group; lP < 0.05, SNSZRD high dose group vs model group; mP < 0.01, SNSZRD high dose group vs model group; nP < 0.001, SNSZRD high dose group vs model group.
SNSZRD promotes serum melatonin and hypothalamic ATP levels in rats with PCPA-induced insomnia

Compared with control rats, model rats had significantly lower serum melatonin and hypothalamic ATP levels (P < 0.05). Treatment with SNSZRD (high/medium/Low dose) significantly restored these levels, illustrating clear dose dependency (Figure 3K and L; P < 0.05). Notably, the effects of high-dose SNSZRD exceeded those of eszopiclone. The above results suggest that SNSZRD may ameliorate insomnia by modulating energy metabolism and neuroendocrine function.

SNSZRD improves brain tissue pathological damage and neuronal apoptosis in rats with PCPA-induced insomnia

HE staining showed that the blank control group exhibited intact neuronal architecture with plump somata and very few degenerated neurons (black arrows) within the field of view. In the model group, partial neuronal degeneration was evident in the hypothalamus, characterized by shrunken and deeply stained cell bodies (black arrows), along with an increased number of glial cells (blue arrows) and occasional neurophagocytosis (yellow arrows). The neurorestorative efficacy of SNSZRD exhibited strict dose dependency, with high-dose SNSZRD treatment (16.08 g/kg) achieving the near-complete reversal of PCPA-induced hypothalamic damage (Figure 4A). Nissl staining revealed evenly distributed neurons with abundant cytoplasm and clear Nissl bodies and no remarkable signs of cell degeneration or necrosis. The model group exhibited the disappearance of Nissl bodies in the cytoplasm, cell body atrophy, and deep staining (black arrows). Compared with the model group, the low-dose SNSZRD (4.02 g/kg) group demonstrated only mildly attenuated neuronal shrinkage and Nissl body dissolution. By contrast, the group under medium-dose SNSZRD treatment (8.04 g/kg) showed substantially restored cellular morphology and reduced glial activation, and that under high-dose SNSZRD treatment (16.08 g/kg) achieved near-complete neuronal preservation, exhibiting soma integrity and Nissl body organization comparable to those observed in blank controls (Figure 4B). Histopathological analysis demonstrated the distinct dose-dependent neuroprotective effects of SNSZRD on hypothalamic neurons.

Figure 4
Figure 4 Histological evaluation of the hypothalamus using haematoxylin and eosin staining and Nissl staining. A: Haematoxylin and eosin staining: Hypothalamic neurons exhibit shrunken and deeply stained cell bodies (indicated by black arrows), increased glial cell density (blue arrows), and occasional neurophagocytosis (yellow arrows); B: Nissl staining: Neuronal cell bodies are shrunken and deeply stained (black arrows), with loss of Nissl bodies in the cytoplasm. HE: Haematoxylin and eosin.
SNSZRD regulates the MT-SIRT1 pathway in rats with PCPA-induced insomnia

Molecular analyses revealed the consistent dose-responsive activation of the MT-SIRT1-mitochondrial biogenesis axis by SNSZRD. The immunohistochemical staining results demonstrated the marked suppression of AANAT, SIRT1, PGC-1α, NRF1, and TFAM in the hypothalamus of model rats, as evidenced by diminished brown deposits in neuronal soma (Figure 5A). Furthermore, low-dose SNSZRD initiated moderate receptor restoration, whereas medium and high doses of SNSZRD progressively enhanced expression to near-normal levels (Figure 5A). Concordantly, RT-qPCR showed that the mRNA expression levels of AANAT, SIRT1, PGC-1α, NRF1, TFAM, and mtDNA in the hippocampi of model rats were significantly lower than those in the control group (P < 0.01). By contrast, the mRNA expression levels of these genes were significantly upregulated in the high- and medium-dose SNSZRD groups, where PCPA-induced downregulation was fully reversed in the high-dose SNSZRD group (P < 0.01; Figure 5B-G). Western blot analysis further revealed that the protein expression levels of AANAT, SIRT1, PGC-1α, NRF1, and TFAM in the model group were significantly lower than those in the normal group (P < 0.05). However, treatment with different doses of SNSZRD significantly restored the levels of these proteins in a dose-dependent manner (Figure 5H). Collectively, these results establish SNSZRD’s capacity to rescue insomnia-associated mitochondrial dysfunction through the coordinated upregulation of the MT-SIRT1 pathway.

Figure 5
Figure 5 Immunohistochemical, PCR, and Western blot results of rats in each group. A: Immunohistochemical results; B-G: PCR detection of the mRNA expression of AANAT, SIRT1, PGC-1α, NRF1, TFAM and mtDNA in the hypothalamus; H: Western blot detection of the protein expression of AANAT, SIRT1, PGC-1α, NRF1, TFAM in the hypothalamus. aP < 0.001, model group vs control group; bP < 0.001, Sini-Suanzaoren decoction (SNSZRD) high dose group vs model group; cP < 0.001, SNSZRD middle dose group vs model group; dP < 0.01, positive group vs model group; eP < 0.01, SNSZRD middle dose group vs model group; fP < 0.05, SNSZRD low dose group vs model group; gP < 0.05, SNSZRD middle dose group vs model group.
DISCUSSION

This study systematically investigated the molecular mechanisms by which SNSZRD ameliorates insomnia through the regulation of the MT-SIRT1 axis, marking the first integration of TCM theories, such as "soothing the liver and relieving depression" and "nourishing the heart to calm the spirit", with modern biological concepts like mitochondrial biogenesis and circadian rhythm regulation. By combining LC-MS-based phytochemical analysis, molecular docking, and multiomics validation (behavioral, histopathological, and molecular biology assays), this study elucidated the core mechanisms through which SNSZRD rescues PCPA-induced behavioral deficits in insomnia rat models. This discovery fills a critical gap in the mechanistic research on TCM compound formulations and provides novel insights for the development of multitarget natural drugs.

Insomnia is a sleep disorder that is characterized by frequent and persistent difficulties in falling and maintaining sleep, leading to inadequate sleep satisfaction[28]. It affects 50% of primary care patients[29] and not only reduces sleep duration and depth but also fails to alleviate fatigue, impairing daytime functioning, such as work efficiency, and posing risks to physical and mental health, thereby burdening social and economic development[30,31]. Current pharmacological treatments primarily rely on benzodiazepine agonists like estazolam, diazepam, and zopiclone. However, these medications show limited efficacy in restoring daytime function[32]. Moreover, their long-term use can cause anxiety, dizziness, reduced deep sleep, and daytime fatigue[33,34]. A combined formulation of Sini powder and Sour Jujube decoction has demonstrated remarkable therapeutic effects on insomnia in clinical practice, positively regulating mitochondrial dynamics-related proteins[35]. Recent studies have shown that this decoction markedly improves the Pittsburgh Sleep Quality Index and Hamilton Depression Rating Scale scores of patients, with an overall effective rate of 91.11%[36]. The present study systematically elucidated the multifaceted mechanisms underlying the therapeutic effects of SNSZRD on insomnia through the integration of chemical analysis, behavioral experiments, and molecular biology techniques. LC-MS identified 1574 compounds in the decoction, among which eight prototype components (e.g., glycyrrhizic acid a3 and ligustrazine G) were demonstrated to penetrate the blood-brain barrier (BBB). Molecular docking confirmed the ability of these components to form stable hydrogen bonds with key active sites (e.g., LYS-328 and ASP-334) of SIRT1, suggesting the direct regulation of the MT-SIRT1 axis (binding energy ≤ -5.0 kcal/mol). High-dose SNSZRD treatment induced a 2.3-fold upregulation of SIRT1 and reduction of 76% in sleep latency. In comparison, low-dose SNSZRD treatment induced a 1.4-fold upregulation of SIRT1 and reduction of 28% in sleep latency. Behavioral assays revealed that low, medium, and high doses of SNSZRD markedly ameliorated PCPA-induced anxiety-like behaviors, as proven by the OFT and EPM test, and improved sleep quality in insomnia rat models, with high-dose SNSZRD being the most effective among treatments. Pathological analysis demonstrated reduced neuronal degeneration and preserved Nissl body structures in the hypothalamus, indicating neuroprotective effects.

Melatonin plays multiple regulatory roles in organisms. These roles include synchronizing biological clocks, regulating sleep, maintaining endocrine system stability, enhancing immune function, and delaying aging processes. Among these functions, its role in sleep regulation is particularly prominent, with considerable therapeutic effects on delayed sleep syndrome, jet lag, and shift work sleep disorder[37]. Studies have shown that melatonin promotes mitochondrial biogenesis[38]. Furthermore, research has found that melatonin concentrations in mitochondria are significantly higher than those in the cytoplasm, cerebrospinal fluid, and peripheral blood. Melatonin protects mitochondrial morphology and function by enhancing mitochondrial biogenesis, dynamics, and autophagy[39]. The SIRT1 signaling pathway regulates mitochondrial biogenesis by deacetylating PGC-1α, thereby influencing mitochondrial function[40]. The circadian clock, which is composed of core clock genes, regulates downstream protein expression rhythmically to execute physiological functions[41]. SIRT1, as an energy sensor mediating the interaction between energy metabolism and the circadian rhythm, interacts with the core clock genes CLOCK and BMAL1 to affect insomnia[42,43]. PGC-1α regulates clock gene expression and is modulated by its interactions. Mitochondrial biogenesis relies on two key proteins, namely, Nrf-1 and TFAM. Nrf-1, a nuclear transcription factor, binds to TFAM's promoter region with PGC-1α to regulate mitochondrial respiratory function genes. The knockout of Nrf-1 in rats leads to mitochondrial DNA instability and early embryonic death[44]. TFAM enhances DNA transcription, replication, and mitochondrial ATP production, acting as a protective factor against oxidative stress-induced mitochondrial damage and responding to Nrf-1 and PGC-1α to promote mitochondrial biogenesis[45]. Therefore, mitochondrial biogenesis regulated by the SIRT1 pathway may be an important mechanism for sleep regulation.

In TCM theory, insomnia due to “liver depression transforming into fire” and “heart spirit disquiet” directly corresponds to mitochondrial dysfunction. Critically, Sini Powder resolves “liver depression” by modulating SIRT1, a redox sensor governing mitochondrial energetics[40], whereas Suanzaoren decoction calms “disquieted spirit” through the MT-mediated protection of mitochondrial crista structure[39]. The synergy of this herb pair explains SNSZRD's unique efficacy in reversing insomnia-associated mitochondrial fragmentation and respiratory chain defects, phenomena that are never observed with eszopiclone (GABA receptor monotherapy). Additionally, SNSZRD markedly elevated serum melatonin levels and hypothalamic ATP content; upregulated the mRNA and protein expression levels of AANAT, SIRT1, and PGC-1α; and protected neurons while enhancing mitochondrial function. These findings not only validate the core mechanism of MT-SIRT1 axis-mediated mitochondrial regulation but also highlight the potential of SNSZRD to improve synaptic plasticity and provide neuroprotection.

The limitations of this study primarily stem from the gap between animal models and clinical realities: Rodent models fail to replicate human insomnia's psychosocial factors (e.g., chronic anxiety), and the PCPA model only reflects 5-HT depletion-induced insomnia, neglecting other insomnia subtypes like those based on HPA axis hyperactivity or gut microbiome dysbiosis. Additionally, the decoction's compositional complexity (1574 compounds) complicates the elucidation of synergistic/antagonistic interactions and in vivo metabolic pathways of core active components (e.g., ligustrazine R). Future research should prioritize clinical randomized controlled trials combined with polysomnography and MT-SIRT1 biomarkers (e.g., serum melatonin and hypothalamic ATP) to validate therapeutic efficacy. Simultaneously, systems pharmacology (PK/PD models) and organoid-on-a-chip technologies should be employed to screen key components and optimize dosing ratios. Expanding studies to gut-brain axis regulation (e.g., short-chain fatty acid-mediated microbiome-neural interactions) and epigenetic modifications (SIRT1's long-term effects on CLOCK/BMAL1 oscillations) will comprehensively delineate SNSZRD’s action network.

CONCLUSION

In conclusion, this study elucidates that SNSZRD ameliorates insomnia by activating MT-SIRT1-mediated mitochondrial biogenesis, wherein eight identified BBB-penetrating components (e.g., senkyunolide G and pachymic acid) directly target SIRT1's catalytic domain to restore the AANAT-SIRT1-PGC-1α-NRF1-TFAM axis in a dose-dependent manner. This effect thereby reverses hypothalamic neuronal damage and normalizes sleep-wake cycles, validating the TCM principles of "Shū Gān Jiě Yù" (soothing “liver depression” through SIRT1 stabilization) and "Yǎng Xīn Ān Shén" (nourishing the “heart spirit” via mitochondrial homeostasis). Moreover, this work provides multitarget lead compounds and identifies hypothalamic ATP as a translatable effective biomarker for future clinical development.

References
1.  Bruni O, Ferini-Strambi L, Giacomoni E, Pellegrino P. Herbal Remedies and Their Possible Effect on the GABAergic System and Sleep. Nutrients. 2021;13:530.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 36]  [Cited by in RCA: 71]  [Article Influence: 14.2]  [Reference Citation Analysis (0)]
2.  Zheng Y, Zhang L, Bonfili L, de Vivo L, Eleuteri AM, Bellesi M. Probiotics Supplementation Attenuates Inflammation and Oxidative Stress Induced by Chronic Sleep Restriction. Nutrients. 2023;15:1518.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 55]  [Cited by in RCA: 45]  [Article Influence: 15.0]  [Reference Citation Analysis (0)]
3.  Sun SY, Chen GH. Treatment of Circadian Rhythm Sleep-Wake Disorders. Curr Neuropharmacol. 2022;20:1022-1034.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 48]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
4.  Palagini L, Geoffroy PA, Gehrman PR, Miniati M, Gemignani A, Riemann D. Potential genetic and epigenetic mechanisms in insomnia: A systematic review. J Sleep Res. 2023;32:e13868.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 26]  [Cited by in RCA: 32]  [Article Influence: 10.7]  [Reference Citation Analysis (0)]
5.  Shaha DP. Insomnia Management: A Review and Update. J Fam Pract. 2023;72:S31-S36.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 17]  [Article Influence: 5.7]  [Reference Citation Analysis (0)]
6.  He X, Zhang R, Li Z, Yao Z, Xie X, Bai R, Li L, Zhang X, Zhang S, Shen Y, Li S, Hui Z, Liu R, Chen J. Sini powder with paroxetine ameliorates major depressive disorder by modulating circadian rhythm: A randomized, double-blind, placebo-controlled trial. J Pineal Res. 2022;73:e12832.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 12]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
7.  Du H, Liu JX, Yan Y, Du CH. [Mechanism of Suanzaoren Decoction in improving insomnia rats by integrating metabolomics and intestinal flora analysis]. Zhongguo Zhong Yao Za Zhi. 2022;47:6741-6752.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
8.  Liu T, Wang Q, Yao K. Huoxue Wentong Formula ameliorates myocardial infarction in rats through inhibiting CaMKII oxidation and phosphorylation. Chin Med. 2020;15:3.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 10]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
9.  Dressle RJ, Feige B, Spiegelhalder K, Schmucker C, Benz F, Mey NC, Riemann D. HPA axis activity in patients with chronic insomnia: A systematic review and meta-analysis of case-control studies. Sleep Med Rev. 2022;62:101588.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 104]  [Article Influence: 26.0]  [Reference Citation Analysis (1)]
10.  Wang L, Wang Y, Wang Y, Wang F, Zhang J, Li S, Wu M, Li L, Rong P. Transcutaneous auricular vagus nerve stimulators: a review of past, present, and future devices. Expert Rev Med Devices. 2022;19:43-61.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 56]  [Article Influence: 14.0]  [Reference Citation Analysis (0)]
11.  Poza JJ, Pujol M, Ortega-Albás JJ, Romero O; Insomnia Study Group of the Spanish Sleep Society (SES). Melatonin in sleep disorders. Neurologia (Engl Ed). 2022;37:575-585.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 40]  [Article Influence: 6.7]  [Reference Citation Analysis (1)]
12.  Zielinski MR, Gibbons AJ. Neuroinflammation, Sleep, and Circadian Rhythms. Front Cell Infect Microbiol. 2022;12:853096.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 165]  [Article Influence: 41.3]  [Reference Citation Analysis (0)]
13.  Huang L, Zhu W, Li N, Zhang B, Dai W, Li S, Xu H. Functions and mechanisms of adenosine and its receptors in sleep regulation. Sleep Med. 2024;115:210-217.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 24]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
14.  Aquino G, Benz F, Dressle RJ, Gemignani A, Alfì G, Palagini L, Spiegelhalder K, Riemann D, Feige B. Towards the neurobiology of insomnia: A systematic review of neuroimaging studies. Sleep Med Rev. 2024;73:101878.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 19]  [Cited by in RCA: 35]  [Article Influence: 17.5]  [Reference Citation Analysis (0)]
15.  Vasey C, McBride J, Penta K. Circadian Rhythm Dysregulation and Restoration: The Role of Melatonin. Nutrients. 2021;13:3480.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 284]  [Cited by in RCA: 223]  [Article Influence: 44.6]  [Reference Citation Analysis (0)]
16.  Manjula R, Anuja K, Alcain FJ. SIRT1 and SIRT2 Activity Control in Neurodegenerative Diseases. Front Pharmacol. 2020;11:585821.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 62]  [Cited by in RCA: 126]  [Article Influence: 25.2]  [Reference Citation Analysis (0)]
17.  Wei RM, Zhang YM, Zhang KX, Liu GX, Li XY, Zhang JY, Lun WZ, Liu XC, Chen GH. An enriched environment ameliorates maternal sleep deprivation-induced cognitive impairment in aged mice by improving mitochondrial function via the Sirt1/PGC-1α pathway. Aging (Albany NY). 2024;16:1128-1144.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 11]  [Reference Citation Analysis (0)]
18.  Wang L, Qi X, Wang S, Tian C, Zou T, Liu Z, Chen Q, Chen Y, Zhao Y, Li S, Yang M, Chai N. Banxia-Yiyiren alleviates insomnia and anxiety by regulating the gut microbiota and metabolites of PCPA-induced insomnia model rats. Front Microbiol. 2024;15:1405566.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 6]  [Reference Citation Analysis (0)]
19.  Yu H, Yu H, Si L, Meng H, Chen W, Wang Z, Gula A. Influence of warm acupuncture on gut microbiota and metabolites in rats with insomnia induced by PCPA. PLoS One. 2022;17:e0267843.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 24]  [Article Influence: 6.0]  [Reference Citation Analysis (0)]
20.  Wang Z, Li D, Chen M, Yu X, Chen C, Chen Y, Zhang L, Shu Y. A comprehensive study on the regulation of Compound Zaoren Granules on cAMP/CREB signaling pathway and metabolic disorder in CUMS-PCPA induced insomnia rats. J Ethnopharmacol. 2024;332:118401.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 20]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
21.  Yan X, Zhang Z, Xu F, Li Y, Zhu T, Ma C, Liu A. Effect of Sini San freeze-dried powder on sleep-waking cycle in insomnia rats. J Tradit Chin Med. 2014;34:572-575.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 6]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
22.  Chang J, Yang H, Shan X, Zhao L, Li Y, Zhang Z, Abankwah JK, Zhang M, Bian Y, Guo Y. Bergamot essential oil improves CUMS-induced depression-like behaviour in rats by protecting the plasticity of hippocampal neurons. J Cell Mol Med. 2024;28:e18178.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 19]  [Article Influence: 9.5]  [Reference Citation Analysis (0)]
23.  Tang L, Liu J, Yang H, Zhao HQ, Hu C, Ma SJ, Qing YH, Yang L, Zhou RR, Zhang SH. Microbiome Metabolomic Analysis of the Anxiolytic Effect of Baihe Dihuang Decoction in a Rat Model of Chronic Restraint Stress. Drug Des Devel Ther. 2024;18:2227-2248.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 3]  [Reference Citation Analysis (0)]
24.  Kim M, Kim Y, Lee HW, Jung JC, Oh S. Chrysanthemum morifolium and Its Bioactive Substance Enhanced the Sleep Quality in Rodent Models via Cl(-) Channel Activation. Nutrients. 2023;15:1309.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 11]  [Reference Citation Analysis (0)]
25.  Gaillard T. Evaluation of AutoDock and AutoDock Vina on the CASF-2013 Benchmark. J Chem Inf Model. 2018;58:1697-1706.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 129]  [Cited by in RCA: 304]  [Article Influence: 38.0]  [Reference Citation Analysis (0)]
26.  Wang J, Zhao P, Cheng P, Zhang Z, Yang S, Wang J, Wang X, Zhu G. Exploring the effect of Anshen Dingzhi prescription on hippocampal mitochondrial signals in single prolonged stress mouse model. J Ethnopharmacol. 2024;323:117713.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 16]  [Reference Citation Analysis (0)]
27.  Adasme MF, Linnemann KL, Bolz SN, Kaiser F, Salentin S, Haupt VJ, Schroeder M. PLIP 2021: expanding the scope of the protein-ligand interaction profiler to DNA and RNA. Nucleic Acids Res. 2021;49:W530-W534.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 170]  [Cited by in RCA: 1304]  [Article Influence: 260.8]  [Reference Citation Analysis (0)]
28.  Sutton EL. Insomnia. Ann Intern Med. 2021;174:ITC33-ITC48.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 27]  [Cited by in RCA: 199]  [Article Influence: 39.8]  [Reference Citation Analysis (0)]
29.  Perlis ML, Posner D, Riemann D, Bastien CH, Teel J, Thase M. Insomnia. Lancet. 2022;400:1047-1060.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 253]  [Article Influence: 63.3]  [Reference Citation Analysis (0)]
30.  Kay-Stacey M, Attarian H. Advances in the management of chronic insomnia. BMJ. 2016;354:i2123.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 124]  [Cited by in RCA: 100]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
31.  Kayaba M, Matsushita T, Enomoto M, Kanai C, Katayama N, Inoue Y, Sasai-Sakuma T. Impact of sleep problems on daytime function in school life: a cross-sectional study involving Japanese university students. BMC Public Health. 2020;20:371.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 26]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
32.  Ebert B, Wafford KA, Deacon S. Treating insomnia: Current and investigational pharmacological approaches. Pharmacol Ther. 2006;112:612-629.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 106]  [Cited by in RCA: 115]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
33.  Atkin T, Comai S, Gobbi G. Drugs for Insomnia beyond Benzodiazepines: Pharmacology, Clinical Applications, and Discovery. Pharmacol Rev. 2018;70:197-245.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 327]  [Cited by in RCA: 247]  [Article Influence: 30.9]  [Reference Citation Analysis (0)]
34.  Rosenberg R, Citrome L, Drake CL. Advances in the Treatment of Chronic Insomnia: A Narrative Review of New Nonpharmacologic and Pharmacologic Therapies. Neuropsychiatr Dis Treat. 2021;17:2549-2566.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 9]  [Cited by in RCA: 45]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
35.  Lin BQ, Ma J, Liu Y, Yu X, Fan AR, Zhang WY, Dai N, Zhang W, Liu M, Wen JY, Li F. [Effect of Sini-Suanzaoren Formula on GABAARα1, GABAARγ2 and NKCC1 of Hippocampus in Rats with Insomnia]. Zhongyiyao Xuebao. 2018;46:49-53.  [PubMed]  [DOI]  [Full Text]
36.  Wang Q. [Clinical observation on 90 cases of insomnia treated with Sini Powder and Suanzaoren Decoction]. Guiyang Zhongyi Xueyuan Xuebao. 2017;39:62-63 + 77.  [PubMed]  [DOI]  [Full Text]
37.  Hardeland R, Poeggeler B, Srinivasan V, Trakht I, Pandi-Perumal SR, Cardinali DP. Melatonergic drugs in clinical practice. Arzneimittelforschung. 2008;58:1-10.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 26]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
38.  Teng YC, Tai YI, Huang HJ, Lin AM. Melatonin Ameliorates Arsenite-Induced Neurotoxicity: Involvement of Autophagy and Mitochondria. Mol Neurobiol. 2015;52:1015-1022.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 25]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
39.  Panmanee J, Nopparat C, Chavanich N, Shukla M, Mukda S, Song W, Vincent B, Govitrapong P. Melatonin regulates the transcription of βAPP-cleaving secretases mediated through melatonin receptors in human neuroblastoma SH-SY5Y cells. J Pineal Res. 2015;59:308-320.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 39]  [Cited by in RCA: 57]  [Article Influence: 5.2]  [Reference Citation Analysis (0)]
40.  Jäger S, Handschin C, St-Pierre J, Spiegelman BM. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc Natl Acad Sci U S A. 2007;104:12017-12022.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2142]  [Cited by in RCA: 2002]  [Article Influence: 105.4]  [Reference Citation Analysis (4)]
41.  Gekakis N, Staknis D, Nguyen HB, Davis FC, Wilsbacher LD, King DP, Takahashi JS, Weitz CJ. Role of the CLOCK protein in the mammalian circadian mechanism. Science. 1998;280:1564-1569.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1714]  [Cited by in RCA: 1560]  [Article Influence: 55.7]  [Reference Citation Analysis (0)]
42.  Um JH, Pendergast JS, Springer DA, Foretz M, Viollet B, Brown A, Kim MK, Yamazaki S, Chung JH. AMPK regulates circadian rhythms in a tissue- and isoform-specific manner. PLoS One. 2011;6:e18450.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 90]  [Cited by in RCA: 108]  [Article Influence: 7.2]  [Reference Citation Analysis (4)]
43.  Foteinou PT, Venkataraman A, Francey LJ, Anafi RC, Hogenesch JB, Doyle FJ 3rd. Computational and experimental insights into the circadian effects of SIRT1. Proc Natl Acad Sci U S A. 2018;115:11643-11648.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 49]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
44.  Nanjaiah H, Vallikannan B. Lutein upregulates the PGC-1α, NRF1, and TFAM expression by AMPK activation and downregulates ROS to maintain mtDNA integrity and mitochondrial biogenesis in hyperglycemic ARPE-19 cells and rat retina. Biotechnol Appl Biochem. 2019;66:999-1009.  [PubMed]  [DOI]  [Full Text]
45.  Li PA, Hou X, Hao S. Mitochondrial biogenesis in neurodegeneration. J Neurosci Res. 2017;95:2025-2029.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 148]  [Cited by in RCA: 295]  [Article Influence: 32.8]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Psychiatry

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade B, Grade C

Novelty: Grade B, Grade B

Creativity or Innovation: Grade B, Grade C

Scientific Significance: Grade C, Grade C

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Ghayour-Mobarhan M, PhD, Iran; O'Driscoll C, Assistant Professor, United Kingdom S-Editor: Lin C L-Editor: A P-Editor: Wang CH

Write to the Help Desk