BPG is committed to discovery and dissemination of knowledge
Observational Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Psychiatry. Nov 19, 2025; 15(11): 108964
Published online Nov 19, 2025. doi: 10.5498/wjp.v15.i11.108964
Polymorphic variants in GABA-A receptor and their association with epilepsy and drug resistance: A North Indian cohort study
Pradeep Kumar Dabla, Swati Singh, Aroop Viswas, Department of Biochemistry, Govind Ballabh Pant Institute of Postgraduate Medical Education and Research, New Delhi 110002, Delhi, India
Swapan Gupta, Department of Neurology, Govind Ballabh Pant Institute of Postgraduate Medical Education and Research, New Delhi 110002, Delhi, India
Manisha Yadav, Subash C Sonkar, Bidhan C Koner, Multi-disciplinary Research Unit, Maulana Azad Medical College, New Delhi 110002, Delhi, India
Bidhan C Koner, Department of Biochemistry, Maulana Azad Medical College, New Delhi 110002, Delhi, India
Nafija Serdarevic, Institute for Clinical Chemistry and Biochemistry, University of Sarajevo Clinics Center, Sarajevo 71000, Bosnia and Herzegovina
ORCID number: Pradeep Kumar Dabla (0000-0003-1409-6771); Nafija Serdarevic (0000-0001-7977-9819).
Author contributions: Dabla PK designed and supervised the study, provided facilities for biochemical testing, contributed in data interpretation and preparation and revision of the manuscript; Singh S performed data analysis and drafted the manuscript; Viswas A conducted the experiments and contributed in data collection; Gupta S provided the facility for the enrolment of patients; Yadav M and Sonkar SC helped in performing genetic analysis; Konar BC provided facility for molecular testing; Serdarevic N helped in critical review and data analysis; and all authors have reviewed the entire content of this manuscript and approved for the submission.
Institutional review board statement: This study was approved by the Medical Ethics Committee of Maulana Azad Medical College and Associated Hospitals, approval F1/IEC/MAMC/82/10/2020/No. 225.
Informed consent statement: Informed consent was obtained from all individual participants included in the study.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
STROBE statement: The authors have read the STROBE Statement-checklist of items, and the manuscript was prepared and revised according to the STROBE Statement-checklist of items.
Data sharing statement: Data is available from the corresponding author on request.
Corresponding author: Pradeep Kumar Dabla, MD, Professor, Department of Biochemistry, Govind Ballabh Pant Institute of Postgraduate Medical Education and Research, 1 Jawaharlal Nehru Marg, 64 Khamba, Raj Ghat, New Delhi 110002, Delhi, India. pradeep.dabla@gmail.com
Received: April 27, 2025
Revised: May 25, 2025
Accepted: September 1, 2025
Published online: November 19, 2025
Processing time: 191 Days and 20 Hours

Abstract
BACKGROUND

Gamma-aminobutyric acid type A receptor has long been acknowledged as a key target in the pathophysiology of epilepsy. The GABRA1 and GABRG2 genes encode the α1 and γ2 subunits of the gamma-aminobutyric acid type A receptor, a key protein implicated in the development of epilepsy. However, the specific association of the GABRA1 IVS11+15 A>G rs2279020 and GABRG2 G3145A rs211013 polymorphisms with antiepileptic drug resistance has been elucidated in only a limited number of investigations.

AIM

To elucidate the association between GABRA1 IVS11+15 A>G rs2279020 and GABRG2 G3145A rs211013 gene mutations and drug resistance in epilepsy patients.

METHODS

A total of 100 epilepsy patients (50 drug responsive and 50 drug resistant subjects) were recruited and rs2279020 - and rs211013 - polymorphism analyzed by restriction fragment length polymorphism - polymerase chain reaction technique.

RESULTS

For GABRA1 rs2279020 polymorphism, AG genotype exhibited risk association with an odds ratio of 0.966 (95% confidence interval = 0.346-2.698) with P value = 0.948; however, this association did not achieve statistical significance (P = 0.948). Additionally, a higher risk association was identified with the GG genotype, with an odds ratio of 1.808 (P = 0.382). GABRG2 rs211013 polymorphism revealed no significant association with drug resistance.

CONCLUSION

The GABRA1 rs2279020 genetic variation is associated with an increased risk for the AG and GG variants, although this association was not statistically significant. Limited investigations have explored the relevance of genetic variations in epilepsy and drug resistance. Longitudinal research is needed to better understand their significance in epilepsy management and to optimize therapeutic strategies.

Key Words: Epilepsy; Single nucleotide polymorphism; Drug-resistant epilepsy; Gamma-aminobutyric acid type A receptor; GABRA1 rs2279020; GABRG2 rs211013

Core Tip: The limited available data have shown association of gamma-aminobutyric acid (GABA) receptors as a key target in the pathophysiology of epilepsy. Prior studies have hypothesized that polymorphism in genes that encode the α1 and γ2 subunits of the GABA-A receptor protein, alters the channel’s structure-function, potentially leading to medication resistance. However, limited data is available on the relationship between GABA receptor variants and drug resistance in human subjects. In our present study, we aim to elucidate the role of GABA-A subunit variants in the development of anti-epileptic drug resistance, which could inform more personalized treatment strategies for individuals with epilepsy, ultimately improving their health outcomes.



INTRODUCTION

Epilepsy is the most prevalent heterogeneous neurological illness, affecting an estimated 42 million individuals worldwide[1,2]. Its global prevalence approximates 5-10 per 1000 individuals, with a disproportionately elevated incidence observed in developing countries. It has distinct symptoms, causes, prognoses, and therapies. The preponderance of epilepsy phenotypes arises from intricate gene-environment interactions[3,4].

Though significant single nucleotide polymorphisms (SNPs) were investigated in relation to multidrug resistance genes, sodium channel subunits, and gamma-aminobutyric acid type A (GABA-A) receptor, identifying its relation with drug resistance epilepsy remained challenging[5,6]. Notably, examining SNPs in the GABA-A receptor gene (GABRA1, GABRG2, GABRB3, GABRD), given its significance to anti-epileptic drugs (AEDs) that target ligand gated chloride channels, holds potential for unravelling drug-resistant epilepsy processes. The primary inhibitory neurotransmitter in the brain has been determined to be GABA. Ionotropic GABA-A, GABA-C, and metabotropic GABA-B receptors are the three receptor types via which it functions. The proteins represented by the α, β, γ, δ, ε, π, θ, and ρ subunit gene families make up the pentameric chloride ion channels known as GABA-A receptors. GABA-A receptors with the α1β2γ2 subunit combination are found most commonly[7]. Previous studies have shown that mutations in subunit-coding genes cause a reduction in the amplitude of GABA-evoked current[8]. Dysfunction of these subunits, due to SNPs in the GABRA1 gene, can impact ion channel gating, due to lower receptor protein surface expression, and cell surface trafficking[9,10]. GABRG2 gene polymorphism is associated with the effective dosage of carbamazepine, phenytoin, and carbamazepine non-responsiveness[11,12]. A previous study in Jordanian population, had shown a significant link between GABRA1 IVS11+15 A>G rs2279020 polymorphism and drug resistance[13]. GABRG2 G3145A rs211013 is a missense protein-coding polymorphism that alters the channel’s structure-function connection, potentially leading to medication resistance and a link to epilepsy[14]. When combined, these results suggest that GABA receptor gene alterations are a major contributor to the etiology and medication resistance of epilepsy. The association between GABA-A gene mutations and drug resistance has been extensively documented across a spectrum of its genetic variants[15]. However, the specific association of the GABRA1 IVS11+15 A>G rs2279020 and GABRG2 G3145A rs211013 polymorphisms with antiepileptic drug resistance has been elucidated in only a limited number of investigations. Furthermore, there exists a paucity of population-specific studies, particularly within the Indian demographic, to substantiate these findings. In our present study, we aim to elucidate the role of GABA-A subunit variants in the development of drug resistant epilepsy in the north Indian population.

MATERIALS AND METHODS
Study population

The study was carried out in the Department of Biochemistry, Govind Ballabh Pant Institute of Postgraduate Medical Education and Research, a referral neurological disease centre facility situated in New Delhi, India. Our cohort included a total of 100 age and sex-matched cases, divided into two groups: 50 patients with drug-resistant epilepsy (group A) and 50 drug-responsive epilepsy patients (group B) respectively. The consented patients were enrolled from the inpatient and outpatient department of the Department of Neurology, Govind Ballabh Pant Institute of Postgraduate Medical Education and Research, New Delhi. The patients underwent diagnosis and classification according to the guidelines provided by the International League against Epilepsy. Epilepsy patients who remained completely seizure-free for at least one year from their last follow-up visit were classified as drug-responsive. Drug resistant epilepsy did not respond to at least two appropriately chosen and adequately used AEDs, whether as monotherapy or in combination (bi- or polytherapy), and failed to achieve full seizure control for a duration of 1 year. Detailed history of ethnicity, seizure frequency, duration of seizures, and drug compliance were recorded[16]. Patients with severe adverse drug reactions, poor compliance with AEDs, or an unreliable record of seizure frequency were excluded from the study. The study was conducted in compliance with the Declaration of Helsinki of the World Medical Association (revised October 2013). The approval was granted by the Institutional Ethical Committee of Maulana Azad Medical College, New Delhi, India (F1/IEC/MAMC/82/10/2020/No. 225), and protocols were established to protect participant confidentiality and ensure adherence to ethical research standards.

Laboratory protocol

5 mL of peripheral whole blood was collected from each individual in an ethylenediaminetetra-acetic acid vacutainer. DNA extraction was performed using the ReliaPrepTM Blood gDNA Miniprep system. For the analysis of rs2279020 and rs211013 polymorphisms, the relevant region of the GABA gene was amplified using polymerase chain reaction (PCR) with specific primers and conditions, following the manufacturer’s recommended guidelines (Table 1). The subsequent step involved restriction fragment length polymorphism analysis, with digestion reaction conditions carried out according to the manufacturer’s instructions. The digested products were resolved using electrophoresis in a 3% agarose gel. Visualization and documentation of the results was done using Alpha Imager gel documentation system.

Table 1 Primers for single nucleotide polymorphism analysis of rs2279020 A/G and rs211013 A/G polymorphism.
SNP
Primers
Sequence
Restriction enzyme
rs2279020 A/GForward primer5’ GCTATGGATTGGTTTATTGCCGTGTG 3’Ava II
Reverse primer5’ ATAATATTGATGTACTACAGGGAC 3’
rs211013 A/GForward primer5’ AGAAATTTACCAACTGGTCTAGCCGG 3’Nci I
Reverse primer5’ AAATCAAATATTGTGTCATGCTTAGT 3’
Statistical analysis

Statistical Package for the Social Sciences (Version 25.0) was used to conduct the statistical analysis. The χ2 test was used to compare the distribution of GABRA1 IVS11+15 A>G rs2279020 and GABRG2 G3145A rs211013 gene polymorphism. Due to the non-normal distribution of the GABRA1 IVS11+15 A>G rs2279020 drug responsiveness data, the results were presented as a median with an interquartile range. The association between various rs2279020 genotypes and drug resistance was investigated using binary logistic regression analysis. P values less than 0.05 were deemed statistically significant.

RESULTS
Distribution of GABRA1 rs2279020 and GABRG2 rs211013 gene polymorphism

Our investigation for the GABRA1 IVS11+15 A>G rs2279020 polymorphism revealed that within the drug-resistant group, AA, AG, and GG genotypes were found in 60%, 26%, and 14% of individuals, respectively. In contrast, within the drug-responsive group, 66.7% exhibited the AA genotype, 15.6% had the AG genotype, 11.1% bore the GG genotype. Additionally, no significant difference was identified on examination of the distribution of GABRA1 IVS11+15 A>G rs2279020 genotypes across both the study cohorts (P value = 0.448) (Table 2). Furthermore, with regard to the GABRG2 G3145A rs211013 polymorphism, the genotypic frequencies between both study groups did not differ. Additionally, GABRA1 rs2279020 and GABRG2 rs211013 gene variants have not been previously studied in epileptic population, and the present study provides novel genotyping data. Therefore, the results cannot be directly compared to those from studies conducted in other South Asian populations.

Table 2 Distribution of rs2279020 polymorphism in patients with drug responsive vs drug resistant epilepsy, n (%).
Genotype
Drug responsive (n = 50)
Drug resistant (n = 45)
χ2
P value
AA30 (60)30 (66.7)1.6080.488
AG13 (26)7 (15.6)
GG7 (14)5 (11.1)
Risk analysis of drug resistance associated with rs2279020 genotypes

A risk analysis elucidating the link between rs2279020 polymorphic variants and drug resistance was performed. The AG genotype revealed a marginal risk association, as evidenced by an odds ratio (OR) of 0.966 (P value = 0.948). In contrast, the GG genotype demonstrated a stronger association with increased risk, reflected by an OR of 1.808 (P value = 0.382) (Table 3).

Table 3 Risk of drug resistance associated with rs2279020 genotype, n (%).
Genotype
Drug responsive (n = 50)
Drug resistant (n = 45)
Odds ratio (95%CI)
P value
AA30 (60)30 (66.7)ReferenceReference
AG13 (26)7 (15.6)0.966 (0.346-2.698)0.948
GG7 (14)5 (11.1)1.808 (0.480-6.817)0.382
AG13 (26)7 (15.6)ReferenceReference
GG7 (14)5 (11.1)1.667 (0.693-4.004)0.253
DISCUSSION

In this investigation conducted within a tertiary healthcare institution, we attempted to elucidate the role of genetic polymorphisms in the GABA-A receptor genes rs2279020 and rs211013. We investigated to gain a better understanding of the clinical associations of genetic polymorphisms, as limited data is available for the Indian population. In our study we observed that GABRA1 IVS11+15 A>G rs2279020 polymorphism exhibited higher risk association for AG and GG variants with an OR of 0.966 and 0.948 respectively; however, this association did not achieve statistical significance. These findings are aligned with similar studies that have endeavored to delineate the association between GABRA1 IVS11+15 A>G rs2279020 polymorphism to epilepsy susceptibility[13]. In our investigation, the connection between the GABRA1 rs2279020 gene variation and intractable phenotype could be ascribed to variations in inhibitory GABA receptor structure and function. Alterations in GABA receptor conformation may contribute to excessive glutamate excitation and the activation of drug resistance[17]. Additionally, loss of GABA-A receptor protein function could also result from reduced expression or deactivation of the genes involved in epilepsy causation[18].

The GABRA1 gene, located on chromosome 5q34, encodes the receptor α1 subunit, highly expressed in the brain. Epilepsy-related mutations in this gene were reported mostly as de novo autosomal dominant missense variants. Literature showed association with other neurological disorders such as Ohtahara syndrome, infantile spasm, Lennox-Gastaut syndrome, developmental and epileptic encephalopathy, Dravet syndrome, idiopathic generalized epilepsy and childhood absence epilepsy.

Very few studies have been conducted that establishes the link between GABRA1 IVS11+15 A>G rs2279020 polymorphism and drug resistance in epilepsy patients. A study conducted among North Indian population by Kumari et al[19] reported that the GABRA1 IVS11+15 A>G rs2279020 polymorphism conferred high risk for multiple drug resistance in epileptic patients harbouring homozygous “GG” variant (P = 0.031, OR = 1.84) and carriers of G allele (P = 0.020, OR = 1.43). The GABRA1 gene, located on chromosome 5q34, encodes the receptor α1 subunit, highly expressed in the brain[20]. Epilepsy-related mutations in this gene were reported mostly as de novo autosomal dominant missense variants[21]. It has been proposed that though GABRA1 IVS11+15 A>G rs2279020 is an intronic polymorphism that, owing to its localization within a non-coding intronic sequence, exerts no effect on the primary amino acid sequence of the encoded protein but this may affect the conformation of mature protein by influencing alternative splicing[6]. However, several earlier studies, in Asian and Arab populations, had reported no association of this synonymous variant with drug resistance[22-24]. Overall, these findings suggest that other factors may play a more significant role in inter-individual variations in response to AEDs.

In the present investigation, GABRG2 G3145A rs211013 was not found to be associated with drug resistance in north Indian epilepsy subjects. To the best of our knowledge and with limited data available, this is the first study to investigate the relationship between GABRG2 G3145A rs211013 polymorphism and drug resistance in epilepsy patients. The A-allele has been linked to an increased frequency of dissocial (antisocial) personality disorder in individuals with alcoholism, as well as epilepsy susceptibility and drug resistance. Research by Jones et al[14] linked the GABRG2 G3145A rs211013 polymorphism to alcohol use and Korsakoff psychosis, with a greater prevalence of the A-allele. Alcohol dependency and epilepsy exhibit similarities, including linkages to GABAergic neurotransmission[25]. Epilepsy linked to GABRA2 mutations is often associated with poor prognosis. In an earlier study, around 50% of patients develop drug-resistant epilepsy, with some experiencing sudden death from seizures or pneumonia. Affected individuals frequently exhibit growth retardation, cognitive deficits, with severe cases also presenting significant motor impairments[26]. In addition, in animal models of epilepsy and epileptic patients, dysregulated histone acetylation has been implicated in the molecular mechanisms underlying epileptogenesis. Extended seizure activity further modulates chromatin architecture through alterations in histone acetylation, thereby affecting chromatin compaction and gene expression[27]. Notably, other genetic polymorphisms have also been reported to be the key targets for AEDs. Kahlig et al[28] examined the SCN1A T825M variant’s effects on channel function and drug response in cellular models.

Taken together, our findings support the hypothesis that the α subunits of GABA receptors are implicated in the development of resistance in epilepsy. In our current study, we expanded and picked more relevant genes implicated in epilepsy susceptibility. In our prior investigation, we analyzed the association between SCN1A rs10167228 genetic polymorphism and epilepsy drug resistance. AA and AT genotypes are significantly associated with an increased risk of developing drug resistance[29]. Notably, genetic screening of these polymorphisms related to drug metabolism, transport, and targets offers valuable potential for optimizing AED therapy. Variants in genes like SCN1A, GABRA1, and ABCB1 influence drug response and side effects. For instance, SCN1A variants affect sensitivity to sodium channel blockers, while ABCB1 polymorphisms impact AED transport across the blood-brain barrier. Identifying these variants can inform dose adjustments, drug selection, and minimize ineffective treatments[5,28,30].

Acknowledging the limitations and inherent biases of association studies, we seek to reinforce our findings through additional independent large size population samples. While PCR-restriction fragment length polymorphism is a simple and cost-effective method for detecting specific mutations, its low throughput and sensitivity limit its utility for larger sample size[31]. Quantitative PCR or next-generation sequencing could be employed for subsequent high-throughput investigations. Additionally, reporter assays can evaluate the effects of regulatory region variants on transcriptional activity. Future studies could explore the functional implications of these polymorphisms. Quantitative real time-PCR, Western blotting, and immunocytochemistry can be used to assess whether polymorphisms affect transcriptional expression, translation efficiency, or subcellular localization of GABRA1[26,27,32]. Additionally, computational tools can also be devised to anticipate genomic variants with the potential to affect pre-mRNA splicing mechanisms, although this area remains largely unexplored[33].

CONCLUSION

To conclude, our findings imply that structural and functional alterations of GABA receptors disrupt their membrane trafficking and contribute to increased seizure susceptibility and thus, may impact medication response to AEDs. Our findings suggest that the GABRA1 IVS11+15 A>G rs2279020 polymorphism is associated with a higher risk for the AG and GG variants, although this association was not statistically significant. Limited literature data is available to correlate the relevance of genetic variations in epilepsy and resistance to AEDs especially in the Indian population. Additional investigations are warranted in larger cohorts to better elucidate the underlying mechanisms for personalized treatment approach in drug resistance epilepsy.

ACKNOWLEDGEMENTS

Thanks to the Multidisciplinary Research Unit, Maulana Azad Medical College, New Delhi for providing molecular analysis research facilities and support.

References
1.  Depondt C. The potential of pharmacogenetics in the treatment of epilepsy. Eur J Paediatr Neurol. 2006;10:57-65.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 40]  [Cited by in RCA: 42]  [Article Influence: 2.1]  [Reference Citation Analysis (0)]
2.  Ahmad Bhat M, Ahmad Guru S, Mir R, Ahmad Waza A, Zuberi M, Sumi M, Bodeliwala S, Samadhiya A, Puri V, Saxena A. Role of SCN1A and SCN2A Gene Polymorphisms in Epilepsy Syndromes-A Study from India. J Neurol Neurosci. 2018;09.  [PubMed]  [DOI]  [Full Text]
3.  Hauser WA. The prevalence and incidence of convulsive disorders in children. Epilepsia. 1994;35 Suppl 2:S1-S6.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 443]  [Cited by in RCA: 425]  [Article Influence: 13.3]  [Reference Citation Analysis (0)]
4.  Hauser WA, Annegers JF, Kurland LT. Incidence of epilepsy and unprovoked seizures in Rochester, Minnesota: 1935-1984. Epilepsia. 1993;34:453-468.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1415]  [Cited by in RCA: 1364]  [Article Influence: 41.3]  [Reference Citation Analysis (0)]
5.  Lakhan R, Kumari R, Misra UK, Kalita J, Pradhan S, Mittal B. Differential role of sodium channels SCN1A and SCN2A gene polymorphisms with epilepsy and multiple drug resistance in the north Indian population. Br J Clin Pharmacol. 2009;68:214-220.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 67]  [Article Influence: 3.9]  [Reference Citation Analysis (0)]
6.  Lu Y, Wang X. Genes associated with idiopathic epilepsies: a current overview. Neurol Res. 2009;31:135-143.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 28]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
7.  Fritschy JM. Epilepsy, E/I Balance and GABA(A) Receptor Plasticity. Front Mol Neurosci. 2008;1:5.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 176]  [Cited by in RCA: 221]  [Article Influence: 12.3]  [Reference Citation Analysis (0)]
8.  Riaz M, Abbasi MH, Sheikh N, Saleem T, Virk AO. GABRA1 and GABRA6 gene mutations in idiopathic generalized epilepsy patients. Seizure. 2021;93:88-94.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 18]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
9.  Cossette P, Liu L, Brisebois K, Dong H, Lortie A, Vanasse M, Saint-Hilaire JM, Carmant L, Verner A, Lu WY, Wang YT, Rouleau GA. Mutation of GABRA1 in an autosomal dominant form of juvenile myoclonic epilepsy. Nat Genet. 2002;31:184-189.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 483]  [Cited by in RCA: 433]  [Article Influence: 18.0]  [Reference Citation Analysis (0)]
10.  Benarroch EE. GABAA receptor heterogeneity, function, and implications for epilepsy. Neurology. 2007;68:612-614.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 59]  [Article Influence: 3.1]  [Reference Citation Analysis (0)]
11.  Reid CA, Berkovic SF, Petrou S. Mechanisms of human inherited epilepsies. Prog Neurobiol. 2009;87:41-57.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 142]  [Cited by in RCA: 148]  [Article Influence: 8.7]  [Reference Citation Analysis (0)]
12.  Maruyama K, Sugano S. Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene. 1994;138:171-174.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 387]  [Cited by in RCA: 396]  [Article Influence: 12.4]  [Reference Citation Analysis (0)]
13.  Al-Eitan LN, Al-Dalala IM, Elshammari AK, Khreisat WH, Nimiri AF, Alnaamneh AH, Aljamal HA, Alghamdi MA. Genetic Association of Epilepsy and Anti-Epileptic Drugs Treatment in Jordanian Patients. Pharmgenomics Pers Med. 2020;13:503-510.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 9]  [Article Influence: 1.5]  [Reference Citation Analysis (0)]
14.  Jones JD, Comer SD, Kranzler HR. The pharmacogenetics of alcohol use disorder. Alcohol Clin Exp Res. 2015;39:391-402.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 45]  [Cited by in RCA: 48]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
15.  Ragozzino D, Palma E, Di Angelantonio S, Amici M, Mascia A, Arcella A, Giangaspero F, Cantore G, Di Gennaro G, Manfredi M, Esposito V, Quarato PP, Miledi R, Eusebi F. Rundown of GABA type A receptors is a dysfunction associated with human drug-resistant mesial temporal lobe epilepsy. Proc Natl Acad Sci U S A. 2005;102:15219-15223.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 45]  [Cited by in RCA: 52]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
16.  Kwan P, Arzimanoglou A, Berg AT, Brodie MJ, Allen Hauser W, Mathern G, Moshé SL, Perucca E, Wiebe S, French J. Definition of drug resistant epilepsy: consensus proposal by the ad hoc Task Force of the ILAE Commission on Therapeutic Strategies. Epilepsia. 2010;51:1069-1077.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3999]  [Cited by in RCA: 3329]  [Article Influence: 208.1]  [Reference Citation Analysis (1)]
17.  Krampfl K, Maljevic S, Cossette P, Ziegler E, Rouleau GA, Lerche H, Bufler J. Molecular analysis of the A322D mutation in the GABA receptor alpha-subunit causing juvenile myoclonic epilepsy. Eur J Neurosci. 2005;22:10-20.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 51]  [Cited by in RCA: 52]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
18.  Cavalleri GL, Weale ME, Shianna KV, Singh R, Lynch JM, Grinton B, Szoeke C, Murphy K, Kinirons P, O'Rourke D, Ge D, Depondt C, Claeys KG, Pandolfo M, Gumbs C, Walley N, McNamara J, Mulley JC, Linney KN, Sheffield LJ, Radtke RA, Tate SK, Chissoe SL, Gibson RA, Hosford D, Stanton A, Graves TD, Hanna MG, Eriksson K, Kantanen AM, Kalviainen R, O'Brien TJ, Sander JW, Duncan JS, Scheffer IE, Berkovic SF, Wood NW, Doherty CP, Delanty N, Sisodiya SM, Goldstein DB. Multicentre search for genetic susceptibility loci in sporadic epilepsy syndrome and seizure types: a case-control study. Lancet Neurol. 2007;6:970-980.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 146]  [Cited by in RCA: 138]  [Article Influence: 7.3]  [Reference Citation Analysis (0)]
19.  Kumari R, Lakhan R, Kalita J, Misra UK, Mittal B. Association of alpha subunit of GABAA receptor subtype gene polymorphisms with epilepsy susceptibility and drug resistance in north Indian population. Seizure. 2010;19:237-241.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 38]  [Cited by in RCA: 41]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
20.  Fisher JL. The alpha 1 and alpha 6 subunit subtypes of the mammalian GABA(A) receptor confer distinct channel gating kinetics. J Physiol. 2004;561:433-448.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 20]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
21.  Ding L, Feng HJ, Macdonald RL, Botzolakis EJ, Hu N, Gallagher MJ. GABA(A) receptor alpha1 subunit mutation A322D associated with autosomal dominant juvenile myoclonic epilepsy reduces the expression and alters the composition of wild type GABA(A) receptors. J Biol Chem. 2010;285:26390-26405.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 32]  [Cited by in RCA: 38]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
22.  Zhang T, Yang Y, Sima X. No association of GABRA1 rs2279020 and GABRA6 rs3219151 polymorphisms with risk of epilepsy and antiepileptic drug responsiveness in Asian and Arabic populations: Evidence from a meta-analysis with trial sequential analysis. Front Neurol. 2022;13:996631.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 5]  [Reference Citation Analysis (0)]
23.  Tang HX, Ho MD, Vu NP, Cao HV, Ngo VA, Nguyen VT, Nguyen TD, Nguyen TD. Association between Genetic Polymorphism of SCN1A, GABRA1 and ABCB1 and Drug Responsiveness in Vietnamese Epileptic Children. Medicina (Kaunas). 2024;60:637.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 5]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
24.  Zhou L, Cao Y, Long H, Long L, Xu L, Liu Z, Zhang Y, Xiao B. ABCB1, ABCC2, SCN1A, SCN2A, GABRA1 gene polymorphisms and drug resistant epilepsy in the Chinese Han population. Pharmazie. 2015;70:416-420.  [PubMed]  [DOI]
25.  Leach JP, Mohanraj R, Borland W. Alcohol and drugs in epilepsy: pathophysiology, presentation, possibilities, and prevention. Epilepsia. 2012;53 Suppl 4:48-57.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 62]  [Cited by in RCA: 66]  [Article Influence: 4.7]  [Reference Citation Analysis (0)]
26.  Hernandez CC, Tian X, Hu N, Shen W, Catron MA, Yang Y, Chen J, Jiang Y, Zhang Y, Macdonald RL. Dravet syndrome-associated mutations in GABRA1, GABRB2 and GABRG2 define the genetic landscape of defects of GABA(A) receptors. Brain Commun. 2021;3:fcab033.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 33]  [Article Influence: 6.6]  [Reference Citation Analysis (0)]
27.  Citraro R, Leo A, Santoro M, D'agostino G, Constanti A, Russo E. Role of Histone Deacetylases (HDACs) in Epilepsy and Epileptogenesis. Curr Pharm Des. 2017;23:5546-5562.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 26]  [Cited by in RCA: 43]  [Article Influence: 6.1]  [Reference Citation Analysis (0)]
28.  Kahlig KM, Lepist I, Leung K, Rajamani S, George AL. Ranolazine selectively blocks persistent current evoked by epilepsy-associated Naν1.1 mutations. Br J Pharmacol. 2010;161:1414-1426.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 57]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
29.  Viswas A, Dabla PK, Gupta S, Yadav M, Tanwar A, Upreti K, Koner BC. SCN1A Genetic Alterations and Oxidative Stress in Idiopathic Generalized Epilepsy Patients: A Causative Analysis in Refractory Cases. Indian J Clin Biochem. 2025;40:105-110.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11]  [Cited by in RCA: 3]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
30.  Magadmi R, Alyoubi R, Moshrif T, Bakhshwin D, Suliman BA, Kamel F, Jamal M, Burzangi AS, Basit S. Polymorphisms in the Drug Transporter Gene ABCB1 Are Associated with Drug Response in Saudi Epileptic Pediatric Patients. Biomedicines. 2023;11:2505.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 11]  [Reference Citation Analysis (0)]
31.  Ayadi W, Smaoui F, Gargouri S, Ferjani S, Hamzaoui Z, Taktak A, Chtourou A, Skouri-Gargouri H, Sassi AH, Sassi MB, Trabelsi S, Gargouri A, Boubaker IB, Karray-Hakim H, Mokdad-Gargouri R, Feki-Berrajah L. Use of allele-specific qPCR and PCR-RFLP analysis for rapid detection of the SARS-CoV-2 variants in Tunisia: A cheap flexible approach adapted for developing countries. PLoS One. 2025;20:e0321581.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
32.  Fatemi SH, Reutiman TJ, Folsom TD, Rustan OG, Rooney RJ, Thuras PD. Downregulation of GABAA receptor protein subunits α6, β2, δ, ε, γ2, θ, and ρ2 in superior frontal cortex of subjects with autism. J Autism Dev Disord. 2014;44:1833-1845.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 58]  [Cited by in RCA: 70]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
33.  Jian X, Boerwinkle E, Liu X. In silico prediction of splice-altering single nucleotide variants in the human genome. Nucleic Acids Res. 2014;42:13534-13544.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 389]  [Cited by in RCA: 410]  [Article Influence: 34.2]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Invited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Psychiatry

Country of origin: India

Peer-review report’s classification

Scientific Quality: Grade A, Grade A, Grade C, Grade C

Novelty: Grade A, Grade A, Grade C

Creativity or Innovation: Grade A, Grade B, Grade C

Scientific Significance: Grade A, Grade A, Grade C

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Miao CH, MD, China; Sinuhaji TRF, Researcher, Indonesia; Xu Y, PhD, China S-Editor: Bai Y L-Editor: A P-Editor: Zhao YQ

Write to the Help Desk