BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Exp Med. Dec 20, 2025; 15(4): 110757
Published online Dec 20, 2025. doi: 10.5493/wjem.v15.i4.110757
Ferula assafoetida induced colon cancer cells differentiation through JNK/MAPK signalling pathway activation
Hani M Abdelsalam, Aya M Abdelghany, Abdelaziz Abbas Diab, Department of Zoology, Zagazig University, Zagazig 44519, Egypt
Hani M Abdelsalam, Department of Science, Rustaq College of Education, University of Technology and Applied Sciences, Rustaq 329, Oman
Wafaa A Ahmed, Department of Cancer Biology, Cairo University, Giza 11796, Egypt
Mona S Abdellateif, Department of Cancer Biology, National Cancer Institute, Cairo University, Cairo 11796, Al Qāhirah, Egypt
Mona S Abdellateif, Medical Biochemistry and Molecular Biology, Galala University, Suez 15888, Egypt
ORCID number: Mona S Abdellateif (0000-0002-5510-4435).
Author contributions: Abdelghany AM contributed to investigation and resources; Abdelsalam HM contributed to visualization; Ahmed WA contributed to conceptualization, methodology, and supervision; Diab AA contributed to project administration; Abdellateif MS contributed to methodology, formal analysis, writing - review & editing.
Institutional review board statement: Not applicable, the study does not contain clinical data.
Institutional animal care and use committee statement: Not applicable, the study does not contain animal research.
Conflict-of-interest statement: All authors declare that they have no conflict of interest to disclose.
Data sharing statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
Corresponding author: Mona S Abdellateif, Department of Cancer Biology, National Cancer Institute, Cairo University, 1 Fom Elkhaligue, Cairo 11796, Al Qāhirah, Egypt. mona.sayed@nci.cu.edu.eg
Received: June 16, 2025
Revised: July 12, 2025
Accepted: November 3, 2025
Published online: December 20, 2025
Processing time: 188 Days and 9.3 Hours

Abstract
BACKGROUND

Colon cancer is a major health problem with increasing mortality rates worldwide.

AIM

To evaluate the ability of Ferula assafoetida (F. assafoetida) to induce differentiation of colon cancer cells to function as normal cells.

METHODS

The cytotoxic effect of F. assafoetida was assessed against Caco cells using the (3-(4,5-dimethylthiazol-2-yl)-2,5-diphe nyltetrazoliumbromide thiazolyl assay. Cell cycle analysis and apoptosis were assessed using CytellTM cell system. The total antioxidant (TA), glutathione (GSH), malondialdehyde (MDA) concentrations, and alkaline phosphatase (ALP) activity were also assessed. The c-Jun N-terminal kinases (JNKs) and mitogen-activated protein kinase (MAPK) expressions were evaluated using quantitative real-time polymerase chain reaction.

RESULTS

There was a significant increase in the cell number treated with F. assafoetida (53.85% ± 0.03%), and those treated with sodium butyrate (NaBT) (54.6% ± 0.10%) in sub-G1 phase, compared to the untreated cells (0.78% ± 0.03%, P < 0.001). Apoptosis was significantly increased in the Caco cells treated with F. assafoetida (49.1% ± 0.14%) compared to those treated with NaBT (27.3% ± 0.10%, P < 0.001), and untreated cells (11.1% ± 0.02%, P < 0.001). DNA degradation was observed in Caco cells treated with F. assafoetida in a dose-dependent manner, where complete degradation occurred at the dose of IC50 (342.9 μg/mL). F. assafoetida induced a significant increase in the TA concentration and GSH, while a significant decrease in the MDA levels (P < 0.001, for all). Also, there was a significant increase in ALP activity in Caco cells (0.53 ± 0.26 U/mL) compared to the control cells (0.05 ± 0.02 U/mL, P = 0.045). There was a significant upregulation of JNK and MAPK expression in Caco cells treated with F. assafoetida compared to the controls [2.59 ± 0.01 (P < 0.001), and 3.62 ± 0.01 (P < 0.001); respectively].

CONCLUSION

F. assafoetida is a potentially successful therapeutic and differentiating agent for colon cancer.

Key Words: Ferula assafoetida; Colorectal cancer; Differentiation; JNK; MAPK; Alkaline phosphatase

Core Tip: Ferula assafoetida (F. assafoetida) could be considered a potential differentiating agent for colon cancer cells through increasing the alkaline phosphatase activity, as well as upregulation of JNK and MAPK gene expression. Additionally, it has important implications for cancer therapy through arresting cells in the sub-G1 phase, inducing cytotoxicity, DNA fragmentation, and apoptosis in the cancer cells compared to those treated with sodium butyrate (NaBT), and untreated control cells. Moreover, F. assafoetida has a protective impact against the cellular oxidative stress revealed by the significant increase in the total antioxidant concentration and glutathione level, while a significant decrease in the malondialdehyde levels in the Caco cells compared to cells treated with NaBT, and the untreated control cells. F. assafoetida is a useful, efficient, inexpensive, and novel therapeutic medicinal herps for colon cancer patients.



INTRODUCTION

Colorectal cancer (CRC) is a malignant tumor arises from the colonic or rectal cells, where it affects about 150000 new individuals yearly[1]. It ranked third in cancer diagnosis and cancer mortality in the United States[2]. Despite the advances in the treatment strategies for CRC including chemotherapy, radiation therapy, surgery, and immunotherapy, the outcome of the patients is very poor. As most patients showed an increased incidence of metastasis, disease recurrence, drug resistance, and toxicity[3]. Therefore, extensive research to investigate for other treatment modalities for CRC patients is highly required, especially those developed from natural botanical compounds[4].

The colonic epithelium is continuously under rapid proliferation by the stem cells located in the base of the colonic crypts. The proliferated cells migrate to the upper part of the crypts where they differentiate to the terminal phenotype[5]. The colon cancer cells are characterized by lacking the differentiated phenotype as the cells were rapidly produced before reaching full differentiation. Alternatively, it was proposed that cancer cells can undergo dedifferentiation into cells with “stem-like” properties known as cancer stem cells (CSCs)[6,7]. These CSCs have self-renewal properties which are responsible for the low tumor grade, increased drug resistance, and poor patients’ prognosis[8,9]. Therefore, it was found that increased levels of CSCs molecular markers including OCT4, NANOG, and SOX2 associated with advanced tumor stage and inferior patients’ outcomes[10].

Indeed, the differentiation of colon cells depends on many factors including growth factors, vitamins, hormones, and the intestinal microbiota[11]. The intestinal microbiota secrete many metabolites such as sodium butyrate (NaBT) which is a short-chain fatty acid that is present abundantly in the colon lumen. It has an important role in colon cell proliferation and differentiation[12]. Additionally, it has an in vitro anticarcinogenic effect through suppressing the histone deacetylase activity and modulating the energy metabolism of the cells[13,14].

C-JUN N-terminal kinases (JNKs) are members of the mitogen-activated protein kinase (MAPK) signalling pathway. It is also called stress- activated protein kinase pathway, as it has a notable role in stress and inflammatory cascades in the body[15]. The JNK/MAPK pathway has been implicated in many cellular processes including cellular proliferation, migration, apoptosis, immunity regulation, wound healing, and metabolism[16-20]. Additionally, it was proved that the JNK/MAPK pathway has a pivotal role in tumorigenesis and embryonic cell development[21,22]. Moreover, the activated MAPK pathway was reported to associate with cancer cell resistance to the chemotherapeutic drugs as well as targeted therapies[23].

Ferula assafoetida (F. assafoetida), is an oleo-gum-resin that is extracted from the stems of Ferula plants, which are members of the Umbelliferae family[24]. It is used as a flavouring additives, anticonvulsant and anti-inflammatory medicinal herpes in many countries including Central Asia, particularly West Afghanistan, Iraq, Turkey, Eastern Iran, Europe, and North Africa[25]. F. assafoetida has many biological functions, especially on gastrointestinal health such as promoting salivary glands secretion, bile acid production, and increased activity of the pancreatic and intestinal digestive enzymes[24,26]. It was also well recognized for its antioxidant[27], anti-diabetic[28], hypotensive, antispasmodic[29], antimicrobial[30], and neuroprotective effect[31].

Moreover, many studies reported the potent chemo-preventive effect of F. assafoetida against the development of different cancers including colon, breast, and cutaneous cancer using experimental animal models[32-34]. Based upon the previous series highlighted the anti-inflammatory, antioxidant, and anticarcinogenic effect of F. assafoetid[27-34]. We thought to assess its role in colon cancer cell differentiation. To the best of our knowledge, there were no reports in literature addressed the differentiating function of F. assafoetida on colon cancer. Therefore, we aimed to assess the role of F. assafoetida as a differentiating agent for colon cancer cells to normal functioning cells. This will be performed through investigating the efficacy of F. assafoetida in inhibiting the proliferation of colon cancer cells, induction of cell cycle arrest and apoptosis. Additionally, determination of alkaline phosphatase (ALP) as a colonocyte differentiation marker, and the effect of F. assafoetida on PI3K/AKT pathway. Moreover, assessing the role of F. assafoetida on cellular oxidative stress. The study will be performed in the human colon carcinoma cells (Caco) cell line, in comparison to Na. butyrate. This will provide a novel differentiating agent that could introduce another strategy for the treatment of colon cancer patients.

MATERIALS AND METHODS
Preparation of plant extract

The F. assafoetida was purchased from the Egyptian Company for Medical Herbs, Egypt. The resin was cut with a knife and crushed into small pieces by using a blender. Then, the resin was soaked in the extraction material either absolute ethanol or water. The F. assafoetida was extracted using the cold maceration method, where the resin was macerated in the solvent for three days on a shaker at room temperature. Then, the resin was filtered using 101 Double Rings filter paper. The diluted liquid extract was concentrated with a rotary evaporator to obtain a viscous liquid. This liquid was finally dried in the dryer for one day to remove the remaining traces of solvent.

Ethanol extract preparation

For the preparation of ethanolic extract, more than 100 gm of dried oleo-resin-gum was pulverized. Then 100 gm of the obtained powder was soaked in 1000 mL of 70% ethanol for 48 hours at room temperature. The solvent was filtered with Whatman filter paper (grade 40) and soaked in 70% ethanol again. This process was conducted four times. The solvent was evaporated using rotary evaporator and the collected extract was freeze dried and finally stored in the refrigerator at 4 °C until needed.

Water extract preparation

One hundred grams (100 g) of F. assafoetida was soaked in 600 mL distilled water for 72 hours at room temperature. Then, the extract was filtered and dried at 4 °C using a rotary evaporator.

Determination of total flavonoid content in F. assafoetida

Total flavonoid content of the F. assafoetida ethanolic extract was detected by the classical Aluminium chloride (AlCl3) colorimetric method[35]. In brief, 20 μL of 1% AlCl3 dissolved in ethanol was mixed with the same volume of the F. assafoetida. After incubation for 10 minutes, the absorption was detected at 490 nm against a blank sample formed of the same mixture without AlCl3. A standard calibration curve was plotted using different concentrations of quercetin (0-250 μg/mL), where the total flavonoids were measured as mg quercetin equivalent/g dry weight (DW).

Determination of total phenolic compounds in F. assafoetida

Total phenolics amount of the F. assafoetida ethanolic extract was assessed using Folin-Ciocalteu method[36]. Briefly, 100 μL sample of F. assafoetida ethanolic extract was mixed with 800 μL Na2CO3 (700 mmol/L) and 200 μL of 10% Folin–Ciocalteu. After incubation for two hours at 25 °C, the absorbance was measured at 765 nm. The phenolic content was expressed as gallic acid equivalent/g DW according to the standard calibration curve of gallic acid.

Gas chromatography-mass spectrometry analysis

The GC/MS analysis of F. assafoetida extract was performed using Agilent Technologies Gas Chromatography-Mass Spectrometry (GC-MS) 7890A spectrophotometer (Agilent, United States), equipped with autoinjector (Agilent 7693A Automatic liquid sampler). The mass selective detector [5975 Celsius (°C)] was operated in full scan mode. The ionization source was supplied with a voltage at 70 eV. The gas chromatograph (GC) was fused with silica capillary column; Hewlett-Packard 5MS (30 m × 0.25 mm; 0.25 μm film thickness). The oven temperature was held at 80 °C for two minutes and increased to 300 °C isothermally over 20 minutes. Helium was used as carrier gas with flow rate of 1.5 mL/minutes. Injector temperature was adjusted at 280 °C. The injected volume of F. assafoetida extract was prepared at one μL and was analysed by GC twice. The separated sample components were identified by comparing their mass spectra with those recorded standards data base in Agilent's own retention time locked libraries. The analysis was performed at the National Institute of Oceanography and Fisheries, Alexandria University Egypt.

Maintenance of the Caco cell line

The Caco-2 cells were obtained from the American Type Culture Collection ATCC, Manassas, VA, United States). The cells were maintained in the National Cancer Institute, Cairo, Egypt, by serial sub-culturing in RPMI-1640 medium (RPMI-1640, Sigma–Aldrich, United States), supplemented with antibiotic-free 10% foetal bovine serum (FBS, Sigma, United States), 100 U/mL penicillin, and 2- mg/mL streptomycin. The Caco-2 cells were subcultivated after trypsinization (Trypsin-EDTA, Cambrex Bioscience Verviers, Belgium) once or twice per week and re-suspended in a complete medium in a 1:5 split ratio to maintain it in the exponential growth phase. They were maintained as a monolayer in T75 cell culture flasks with filter screw caps (TPP, Trasadingen, Switzerland) at 37 °C in a humidified 5% CO2 incubator Revco, GS laboratory equipment, RCO 3000 TVBB, United States).

Cytotoxicity assay

The cell Viability and cytotoxicity of all extracts were done utilizing the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphe nyltetrazoliumbromide thiazolyl (MTT) assay[37]. Caco cells were seeded (5 × 103/well) in 96-well flat-bottomed microlitre plates in RPMI-1640 media supplemented with FBS and incubated overnight at 37 °C in a humidified 5% CO2 incubator. The cells were placed in a fresh medium containing serial dilutions of NaBT (0.65-10 mg/mL), ethanolic and water extracts of F. assafoetida (100-1600 μg/mL). The cells were incubated for 24 hours at 37 °C and 5% CO2. A 10 μL of MTT solution (5 mg/mL in PBS) was added to each well and Shaked for 5 minutes, then the mixture was incubated in the dark for 4 hours. The medium was then removed after centrifugation and 100 μL of isopropanol was added for the assessment of cell viability. The absorbance was measured by the ELISA reader (TECAN SunriseTM, Germany) at 570 nm. Cell viability was measured by dividing the absorbance of the treated cells by that of the untreated cell. All experiments were done in triplicate. The 50% inhibitory concentration (IC50) was calculated through the sigmoidal dose response curve-fitting equation using GraphPad Prism 8.4.2 (GraphPad Software, La Jolla, CA, United States), where the least IC50 was chosen.

Cell treatment

The Caco cells (5 × 105 cells/well) were divided into three groups; the first group which treated with the ethanolic extract of F. assafoetida (343.6 μg/mL), the second which treated with the NaBT (3.3 mg/mL), and the untreated cells were considered as a control group. All group of cells were incubated for 48 hours in humidified 5% CO2 incubator at 37 °C for further analysis.

Cell cycle analysis

The cell cycle analysis was determined using CytellTM cell cycle kit (GE Healthcare Japan, Tokyo, Japan), according to the manufacture instructions. The cell groups were incubated for 24 hours in a 5% CO2 incubator at 37 °C. The DNA content and the cell cycle phases were detected using CytellTM cell imaging system (GE Healthcare Japan).

Apoptosis assay

Apoptosis assay was determined using the Invitrogen™ Alexa Fluor™ 488 annexin V/Dead Cell Apoptosis Kit (Invitrogen™, ThermoFisher Scientific, United States) according to the manufacturer’s instruction. Briefly, all groups of cells (cells treated with F. assafoetida, NaBT, and untreated cells) were washed with cold PBS and centrifuged. Then cells were resuspended in 100 µL annexin-binding buffer (1 × 106 cells/mL), five µL Alexa Fluor 488 annexin V, and one µL (100 µg/mL) propidium iodide working solution. The cell groups were incubated for 15 minutes at room temperature, then 400 µL 1X annexin-binding buffer was added and the cells were kept on ice for detection of apoptotic cells using Cytell TM cell imaging system (GE Healthcare Japan).

DNA fragmentation assessment

Assessment of DNA fragmentation was performed based on the detection of DNA ladder appearance at late stage of apoptosis as described by Elmore et al[38], 2007. DNA was extracted from untreated Caco cells (as a control) and those treated with F. assafoetida. The DNA was prepared at a concentration of 300-600 ng/μL. Then it was run in pre-stained agarose gel electrophoresis 1.5%. The DNA was visualized and photographed under ultraviolet illumination.

Antioxidant activity

The total antioxidant (TA), glutathione reductase (GSH), and Malondialdehyde (MDA) concentrations in the treated and untreated Caco cells were assessed using Biodiagnostic kits (Cat.no. TA 25 13, GR25 11, and MD 25 29; respectively, Cairo, Egypt). According to the manufacture instructions. The TA, GSH, and MDA concentrations were measured calorimetrically at 505 nm, 405 nm, and 534 nm; respectively, using a spectrophotometer (UV-2505, LaboMed, inc. United States).

Effect of F. assafoetida on ALP activity

The ALP activity was determined in the Caco cell groups according to the instructions of the assay kit (Cat. No. E-BC-K091-M, Elabscience, United States). The samples were performed in triplicate and the absorbance was measured at 500-530 nm using microplate reader (TECAN SunriseTM, Germany).

Assessment of MAPK and JNK genes expression

Total RNA was purified from the treated and untreated Caco cells using Direct-zol RNA Miniprep Plus (Cat# R2072, ZYMO RESEARCH CORP. United States), in accordance with the manufacturer's instructions. The amount and the purity of the extracted RNA was detected using Beckman dual spectrophotometer (United States). Complementary DNA (cDNA) followed by quantitative real-time polymerase chain reaction was performed by utilizing the SuperScript IV One-Step RT-PCR system (Cat# 12594100, Thermo Fisher Scientific, Waltham, MA, United States) according to the manufacturer's instructions. The relative expression levels of MAPK and JNK using was determined relative to the GAPDH housekeeping gene. The primer sequences of the assessed genes were; MAPK “forward: TCTCCCGCACAAAAATAAGG, reverse: TCGTCCAACTCCATGTCAAA”, JNK: “forward: GCTGCCCTGTACCCACATCT, reverse: GCTGCACCTGTGCTAAAGGA”, and GAPDH: “forward: GAAAACGCTGACTCAGAACAC, reverse: TTTGCACTGGTACGTGTTGAT”. The quantitative polymerase chain reaction reactions were run in triplicate using the Step One Applied Biosystem machine (Foster city, United States). Data were analysed using the 2-ΔΔCt comparative approach according to the Schmittgen and Livak, 2001[39].

Statistical analysis

Data were analysed using IBM© SPSS© Statistics version 22 (IBM© Corp., Armonk, NY, United States). The results were expressed as mean and standard deviation (SD) according to the Kolmogorov-Smirnov and Shapiro-Wilk normality tests. Comparison between variables was done using the Student's t-test and the one-way analysis of variance with post hoc Tukey's test. Cytotoxicity curves were done using GraphPad Prism 8.4.2. (San Diego, CA, United States). All tests were performed as two-tailed, and the significant level was adjusted at P value ≤ 0.05. All experiment were done at triplicate.

RESULTS
Cytotoxicity assay of F. assafoetida on Caco cells

The cytotoxicity effect of F. assafoetida on Caco cells was determined according to the concentration-dependent decrease in the growth rate of the cells. Doses that inhibited cell growth to 50% (IC50) were 343.6 μg/mL for ethanol extract of F. assafoetida and 3.3 mg/mL for NaBT (Figure 1A).

Figure 1
Figure 1 Cytotoxicity and chemical analysis of Ferula assafoetida. A: Cytotoxicity assay of the ethanol and water extract of Ferula assafoetida (F. assafoetida), and on Caco cells using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphe nyltetrazoliumbromide thiazolyl assay; B: The GC-MS chromatogram of the ethanolic extract of F. assafoetida. Data were obtained in 3 biological replicates. F. assafoetida: Ferula assafoetida.
Determination of the total phenolic and flavonoid compounds of the F. assafoetida ethanolic extract

The total phenolic and flavonoid content present in the ethanolic extract of F. assafoetida extract were 3.101% and 0.797%, respectively.

Phytochemical analysis of the ethanolic extract of F. assafoetida using GC-MS

GC-MS analysis of the ethanolic extract of F. assafoetida revealed the presence of 26 phytochemical compounds. The identification of the phytochemical compounds was based on the peak area, retention time, and the molecular formula (Table 1, Figure 1B). The major compounds were coumarins (31.17%), Torreyol (δ-Cadinol) (7.63%), L-ascorbic acid 6-stearate (7.46%), 2-Mercapto-3,4-dimethyl-2,3dihydrothiophene (7.29%), Cadinene (4.22%), Aristolene (3.54%), 1-heptatriacotanol (3.18%), Vanillin (3.07%), beta-guaiene (3.03%), Dotriacontane (2.69%), Octadecanoic acid,4-hydroxy-methylester (2.45%), Dasycarpidan-1-methanol acetate (2.32%), 2-Mercapto-3,4-dimethyl-2,3-dihydrothiophene (2.29%), 3,4 Dimethyl-thiophene (2.28%), 2,4,4-Trimethyl-3-(3-methylbuta-1,3-dienyl) cyclohexanone (2.27%), Tetracosane 2,6,10,15,19,23-hexamethyl (2.13%), phenyl aziridine carboxylate (1.68%), isolongifolene (1.61%), Rhodopin (1.54%), Styrene (1.48%), N,N,N-Trimethyl-1,4-phenylenediamine (1.46%), 1-chloro Octadecane (1.23%), 3-Oxo-20-methyl-11-alpha-hydroxyconanine-1,4-diene (1%), 10,12-Tricosadiynoic acid methyl ester (1%), and Bicyclo{4,4,0}dec-1-ene, 2-isopropyle-5-methyl-9-methylene (0.92%).

Table 1 Gas chromatography-mass spectrometry analysis of Ferula assafoetida.
Peak
Start
RT
End
Height
Area
Area sum%
16.2986.3646.49622498772.4488089253.381.48
26.5696.636.76433712112.64135582595.72.28
310.75110.79610.881229575459.3433407688.47.29
411.36711.41311.45154389802.0699747389.21.68
511.52411.55911.65563690724.73136167153.22.29
613.9714.01714.11539755587.5686992339.551.46
715.55915.59915.67776754848.19182782284.73.07
817.31317.35717.39532499207.8173471573.951.23
917.60817.64917.69655787146.11134806328.92.27
1018.42318.47518.5519150006.1959501652.431
1119.47619.53419.60538150321.8795613565.051.61
1219.77719.83819.891102881932.4251143438.24.22
1319.96420.02320.05816820686.4754989078.490.92
1420.05820.09620.19462933211.08180144133.63.03
1520.19720.25620.31283412539.12210483780.73.54
1620.31520.39720.498137156094454085546.17.63
1721.21421.27121.37442629280.75126638986.72.13
1824.82524.90525.00537562228.59160270758.82.69
1925.52325.58425.74142875903.91189247260.73.18
2025.90526.00226.13413007043.9491607631.951.54
2128.11928.22428.36718108916.43146045394.82.45
2228.46928.54128.678127694373.1443921740.57.46
2328.77128.84428.90812715424.9659626235.191
2432.86432.93233.03316868028.3162024054.581.04
2533.17233.24433.351539173.281382738232.32
2635.1837.25937.32239808341.25185454757831.17
Effect of F. assafoetida on the cell cycle

There was a significant increase in the cell number treated with F. assafoetida (53.85% ± 0.03%), and those treated with NaBT (54.6% ± 0.10%) in the sub-G1 phase, compared to the untreated control cells (0.78% ± 0.03%, P < 0.001). While there was a significant deference in the number of cells in the other cycle phases for those treated with F. assafoetida (G0/G1 phase (29.27% ± 0.03%), S phase: 12.76 ± 0.05%, G2/M: 2.9% ± 0.04%, and > 4n: 1.17% ± 0.03%, P < 0.001), and those treated with NaBT (G0/G1 phase 25.6% ± 0.01%), S phase: 10.65% ± 0.01%, G2/M: 8.7% ± 0.01%, and > 4n: 0.17% ± 0.20%, P < 0.001), compared to the control cells [G0/G1 phase (67.41% ± 0.02%), S phase: 30.73% ± 0.11%, G2/M: 0.79% ± 0.01%, and > 4n: 0.24% ± 0.01%; Table 2, Figure 2A-C].

Figure 2
Figure 2 Cell cycle analysis. A: Untreated control Caco cells; B: Caco cells treated with Na. butyrate; C and D: Caco cells treated with Ferula assafoetida (F. assafoetida). Apoptosis analysis (C) in Caco cells without treatment (D); E: Caco cells treated with Na. butyrate; F: Caco cells treated with F. assafoetida. The cell cycle analysis and apoptosis were detected with Cytell Cell Imaging system; G and H: Histogram charts showed the percentage of (G) live cells and (H) apoptotic cells in Caco cells. Data were obtained in 3 biological replicates. aP < 0.001, bP < 0.01.
Table 2 Cell cycle analysis of Caco cells treated with Ferula assafoetida against sodium butyrate.
Variable
Untreated cells
Sodium butyrate
F. assafoetida
P value
F1
Count of nuclei1246 ± 22117.3 ± 2.081442.7 ± 2.08P < 0.001148390.4
Sub-G1 phase < 2n (%)0.78 ± 0.03a54.6 ± 0.1053.85 ± 0.03P < 0.001106456.5
G0/G1 (%)67.41 ± 0.02a25.6 ± 0.01b29.27 ± 0.03 P < 0.0014138051.9
S (%)30.73 ± 0.11a10.65 ± 0.01b12.76 ± 0.05 P < 0.001135812.9
G2/M (%)0.79 ± 0.01a8.7 ± 0.01a2.9 ± 0.04 P < 0.00114260.9
> 4n (polyploid cells %)0.24 ± 0.01a0.17 ± 0.20a1.17 ± 0.03 P < 0.00169.3
Effect of F. assafoetida on apoptosis

Apoptosis was significantly increased in the Caco cells treated with F. assafoetida (49.1% ± 0.14%) in comparison to those treated with NaBT (27.3% ± 0.10 %, P < 0.001), and the untreated cells (11.1% ± 0.02%, P < 0.001, F = 113152.6, df = 2). While the number of live cells in each group represented 50.9% ± 0.12% in the Caco cell treated with F. assafoetida, 72.7% ± 0.10% in those treated with NaBT, compared to 88.9% ± 0.10% in control cells (P < 0.001, F = 95649.6, df = 2; Figure 2D-H).

DNA fragmentation assessment

The results of DNA fragmentation analysis showed complete DNA degradation in Caco cells treated with the ethanolic extract of F. assafoetida with the dose of IC50 (342.9 μg/mL). While at the dose of half and forth of IC50, there were slight DNA degradation when compared with untreated cells (Figure 3).

Figure 3
Figure 3 DNA fragmentation assessment. A: Microscopic examination of untreated Caco cells; B: Those treated with Ferula assafoetida (F. assafoetida) showing the cytotoxic effect of F. assafoetida on the cells (magnification 20 ×); C: Electropherogram for DNA fragmentation of Caco cells treated with ethanol extracts of F. assafoetida at conc (1/4 IC50, 1/2 IC50, and the IC50) μg/mL. M: DNA marker. Data were obtained in 3 biological replicates.
Role of F. assafoetida on cellular oxidative stress

There was a significant increase in the total antioxidant concentration in Caco cells treated with F. assafoetida (0.625 ± 0.009 nmol/mL) in comparison to those treated with NaBT (0.387 ± 0.015 nmol/mL), and untreated controls (0.138 ± 0.001 nmol/mL, P < 0.001, F = 1833.6, df = 2; Figure 4A). Additionally, there was a significant increase in the GSH concentration in Caco cells after treatment with F. assafoetida (0.036 ± 0.005 nmol/mL) or Na butyrate (0.038 ± 0.004 nmol/mL), in comparison to the untreated cells (0.019 ± 0.001 nmol/mL, P < 0.001, F = 40.3, df = 2; Figure 4B). On the other hand, there was a significant decrease in the MDA concentration in Caco cells treated with F. assafoetida (0.370 ± 0.004 nmol/mL) in comparison to the control cells (0.886 ± 0.005 nmol/mL), however, it is higher than those treated with NaBT (0.242 ± 0.031 nmol/mL, P < 0.001, F = 1044, df = 2; Figure 4C).

Figure 4
Figure 4 Effect of Ferula assafoetida on cellular oxidative stress. A: Total antioxidant; B and C: Glutathione reductase, and malondialdehyde concentrations in Caco cells treated with Ferula assafoetida (F. assafoetida), sodium butyrate against untreated control Caco cells; D: Alkaline phosphatase activity in Caco cells treated with F. assafoetida against untreated control Caco cells. Data were obtained in 3 biological replicates. aP < 0.001, bP < 0.01. MDA: Malondialdehyde; GSH: Glutathione reductase.
Effect of F. assafoetida on ALP activity

There was a significant increase in ALP activity in Caco cells treated with F. assafoetida (0.53 ± 0.26 king unit/mL) in comparison to those untreated control cells (0.05 ± 0.02 king unit/mL, P = 0.045; Figure 4D).

Impact of F. assafoetida on JNK/ MAPK signalling pathway

There was a significant upregulation of JNK expression in Caco cells treated with F. assafoetida compared to the untreated control cells, with a foldchange of 2.59 ± 0.01 (P < 0.001). Also, the MAPK expression was significantly upregulated in Caco cells treated with F. assafoetida relative to the controls, with a foldchange of 3.62 ± 0.01 (P < 0.001; Figure 5).

Figure 5
Figure 5 Relative expression of JNK and MAPK in Caco cells treated with Ferula assafoetida against control untreated cells. Data were obtained in 3 biological replicates.
DISCUSSION

The CRC is a major health problem with increasing mortality rates worldwide. This is due to the presence of the dedifferentiated colon cancer cells which are responsible for the emergence of disease recurrence and resistance to the conventional chemotherapeutic drugs[40,41]. Therefore, new strategies aiming at modulating the differentiation capabilities of cancer cells can be a promising line of successful treatment for colon cancer patients[42]. The current study showed that F. assafoetida has a potential anticancer activity through reprograming and induction of colon cancer cell differentiation into functioning normal calls. This was supported with the significant increase in the ALP activity in Caco cells treated with F. assafoetida in comparison to those untreated cells. The ALP has been reported to be a well-established indicator for colon cell differentiation[43]. Moreover, Caco cells treated with F. assafoetida showed a significant upregulation of JNK and MAPK expression compared to the control cells. The JNK/MAPK signalling pathway is an important regulatory trigger for the differentiation of colon cells through the crosstalk with the Wnt/β-catenin pathway[44,45]. The WNT/β-catenin pathway has a pivotal function in maintaining stemness and differentiation of intestinal cancer cells (ISCs)[46]. Activation of JNK/C-JUN pathway results in increased expression of WNT/β-catenin downstream genes, such as Ccdn1, Axin2, and Lgr5, that leads to proliferation and differentiation of ISCs[45]. Additionally, MAPK signalling triggers p38 activation, which is known as a crucial regulator of embryonic stem cell differentiation[47,48]. The activation of p38MAPKs pathway results in phosphorylation and inactivation of glycogen synthase kinase 3β (GSK3β), that leads to accumulation of the β-catenin[15,49].

Chen and his colleagues found that ferulic acid (FA; a component of F. assafoetida) inhibited colon cancer proliferation both in vitro and in BALB/c mice CRC model through the activation of JNK and ERK gene expression, which lead to stimulation of BCL-2 and BAX required for the apoptosis pathway[50]. Similarly, Ren et al[51], demonstrated that the activation of MAPK-JNK/c-Jun pathway results in apoptosis stimulation in colon cancer cells. Therefore, the JNK/MAPK signalling pathway could be a potential useful target for colon cancer therapy. However, these data should be validated in protein expression levels.

Sodium butyrate was recognized as an efficient epigenetic modulator and differentiating agent for colon cancer cells[14]. Therefore, we used it to assess the efficacy of F. assafoetida in colon cancer cell differentiation. The present data showed that the number of Caco cells treated with F. assafoetida arrested at the sub-G1 phase that represents the cells undergoing apoptosis were significantly increased, compared to those treated with Na butyrate, and untreated control cells. Also, there was a significant decrease in the cell number treated with F. assafoetida in the S. (DNA synthesis) phase, compared to the control cells. Incomparable with these findings, Janicke et al[52] concluded that ferulic acid exerts antiproliferative effects on Caco-2 cells through upregulating RABGAP1 and CEP2 gene expression, which were implicated in centrosome assembly, as well as the gene involved in S-phase checkpoint protein SMC1 L1. While Bagheri et al[53] found that F. assafoetida produces cell cycle arrest at G0/G1 phase that was responsible for its neuroprotective effect.

The current results showed that the efficacy of F. assafoetida to induce apoptosis in Caco cells was significantly higher than that of NaBT, compared to the untreated control cells. Additionally, there was a complete DNA degradation (which is a histological sign of apoptosis) in the Caco2 cells treated with the dose of IC50 of F. assafoetida. These data are consistent with that of Elarabany et al[54], who informed that F. assafoetida exhibited an antitumor effect against colon cancer cells through decreasing cell viability and induction of apoptosis. Zhang et al[55], also reported that the antiproliferative effect of ferulic acid on breast cancer cells was accomplished through the induction of apoptosis. Similarly, Efati et al[56], found that F. assafoetida L. extract zinc nanoparticles, exerts antiapoptotic and antioxidant functions on CRC and breast cancer cell lines through upregulating Bax and downregulating BCL-2 gene expression.

Regarding the impact of F. assafoetida on Cellular Oxidative Stress, the present data showed that F. assafoetida induced a significant increase in the total antioxidant concentration in Caco cells in comparison to those treated with NaBT, and untreated control cells. Also, it exhibited a significant increase in the GSH concentration in Caco cells similar to that treated with Na butyrate, in comparison to the untreated control cells. While it induced a significant decrease in MDA concentration in Caco cells compared to the untreated control cells. In consistence with these results, Mallikarjuna et al[33], proved that F. assafoetida has a chemo-preventive activity against N-methyl-N-nitrosourea -induced mammary tumor in rats through increasing GSH, catalase, and superoxide dismutase antioxidant levels, that consequently, avert the process of carcinogenesis. Though F. assafoetida showed results superior to a well-known differentiating agent NaBT, however the data obtained were performed in vitro on a single cell line (Caco cells). Accordingly, these data should be validated in in-vivo model with different cancer cell types to properly assess the differentiating capabilities of F. assafoetida.

Moreover, the phytochemical analysis of the ethanolic extract of F. assafoetida revealed a large amount of phenolic and flavonoid content which proved to have antioxidant, anti-inflammatory, and antitumor effects[54,57,58]. This was illustrated by the presence of high amount of some beneficial components including e.g., coumarin (31.17%), L-ascorbic acid 6-stearate (7.46%), Cadinene (4.22%), as well as many sulfur-containing compounds. All these components have been reported to exhibit potent antioxidant, antimicrobial, neuroprotective, and anticancer functions[53,54,59,60].

The cytotoxicity assay of F. assafoetida showed that the concentration which inhibited the growth of Caco cells to 50% (IC50) was 343.6 μg/mL. These data are relevant to other series commonly used doses in rats ranged from low concentration of 10-100 mg/kg for the treatment of colon cancer, to a high concentration of 200-400 mg/kg as an adjuvant for dementia therapy[32,61,62]. Indeed, F. assafoetida is widely used in many countries as flavouring additives because it has a good bioavailability, however, its use in infants should be cautioned as it can cause lethal methemoglobinemia[63]. On the other hand, Goudah et al[64] reported that F. assafoetida is a safe gum extract at a dose of 250 mg/kg for a short-term administration up to 28 days. Also, a single oral dose up to 5000 mg/kg did not cause any toxicological effect in rats. Therefore, F. assafoetida could be utilized as a naturel remedy without obvious side effects in adults, however, further clinical studies are highly needed.

CONCLUSION

In conclusion, the present study provided evidence that F. assafoetida could be considered a potential differentiating agent for colon cancer cells through increasing the ALP activity, as well as upregulation of JNK and MAPK gene expression. Additionally, it has important implications for cancer therapy through arresting cells in the sub-G1 phase, inducing cytotoxicity, DNA fragmentation, and apoptosis in the cancer cells compared to those treated with NaBT, and untreated control cells. Moreover, F. assafoetida has a protective impact against the cellular oxidative stress indicated by the significant increase in the TA concentration and GSH level, while a significant decrease in the MDA levels in the Caco cells compared to cells treated with NaBT, and the control cells. Therefore, more research should be directed to F. assafoetida as a useful, efficient, inexpensive, and novel therapeutic medicinal herps for colon cancer patients.

References
1.  Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin. 2022;72:7-33.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13024]  [Cited by in RCA: 12193]  [Article Influence: 3048.3]  [Reference Citation Analysis (8)]
2.  Siegel RL, Miller KD, Jemal A. Cancer statistics, 2020. CA Cancer J Clin. 2020;70:7-30.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14385]  [Cited by in RCA: 15482]  [Article Influence: 2580.3]  [Reference Citation Analysis (11)]
3.  Yan H, Talty R, Johnson CH. Targeting ferroptosis to treat colorectal cancer. Trends Cell Biol. 2023;33:185-188.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 130]  [Cited by in RCA: 113]  [Article Influence: 37.7]  [Reference Citation Analysis (0)]
4.  Newman DJ, Cragg GM. Natural Products as Sources of New Drugs from 1981 to 2014. J Nat Prod. 2016;79:629-661.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4982]  [Cited by in RCA: 3883]  [Article Influence: 388.3]  [Reference Citation Analysis (4)]
5.  Barker N. Adult intestinal stem cells: critical drivers of epithelial homeostasis and regeneration. Nat Rev Mol Cell Biol. 2014;15:19-33.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1164]  [Cited by in RCA: 1021]  [Article Influence: 85.1]  [Reference Citation Analysis (5)]
6.  Reya T, Morrison SJ, Clarke MF, Weissman IL. Stem cells, cancer, and cancer stem cells. Nature. 2001;414:105-111.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7553]  [Cited by in RCA: 6871]  [Article Influence: 274.8]  [Reference Citation Analysis (4)]
7.  Friedmann-Morvinski D, Verma IM. Dedifferentiation and reprogramming: origins of cancer stem cells. EMBO Rep. 2014;15:244-253.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 438]  [Cited by in RCA: 388]  [Article Influence: 32.3]  [Reference Citation Analysis (0)]
8.  Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A, Weinberg RA. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet. 2008;40:499-507.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2112]  [Cited by in RCA: 2039]  [Article Influence: 113.3]  [Reference Citation Analysis (4)]
9.  Amini S, Fathi F, Mobalegi J, Sofimajidpour H, Ghadimi T. The expressions of stem cell markers: Oct4, Nanog, Sox2, nucleostemin, Bmi, Zfx, Tcl1, Tbx3, Dppa4, and Esrrb in bladder, colon, and prostate cancer, and certain cancer cell lines. Anat Cell Biol. 2014;47:1-11.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 95]  [Cited by in RCA: 121]  [Article Influence: 10.1]  [Reference Citation Analysis (0)]
10.  Yang F, Zhang J, Yang H. OCT4, SOX2, and NANOG positive expression correlates with poor differentiation, advanced disease stages, and worse overall survival in HER2(+) breast cancer patients. Onco Targets Ther. 2018;11:7873-7881.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 32]  [Cited by in RCA: 43]  [Article Influence: 5.4]  [Reference Citation Analysis (0)]
11.  Kaiko GE, Ryu SH, Koues OI, Collins PL, Solnica-Krezel L, Pearce EJ, Pearce EL, Oltz EM, Stappenbeck TS. The Colonic Crypt Protects Stem Cells from Microbiota-Derived Metabolites. Cell. 2016;165:1708-1720.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 575]  [Cited by in RCA: 529]  [Article Influence: 52.9]  [Reference Citation Analysis (6)]
12.  Gonçalves P, Martel F. Butyrate and colorectal cancer: the role of butyrate transport. Curr Drug Metab. 2013;14:994-1008.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 113]  [Cited by in RCA: 142]  [Article Influence: 11.8]  [Reference Citation Analysis (4)]
13.  Eckschlager T, Plch J, Stiborova M, Hrabeta J. Histone Deacetylase Inhibitors as Anticancer Drugs. Int J Mol Sci. 2017;18:1414.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1040]  [Cited by in RCA: 936]  [Article Influence: 104.0]  [Reference Citation Analysis (0)]
14.  Klepinina L, Klepinin A, Truu L, Chekulayev V, Vija H, Kuus K, Teino I, Pook M, Maimets T, Kaambre T. Colon cancer cell differentiation by sodium butyrate modulates metabolic plasticity of Caco-2 cells via alteration of phosphotransfer network. PLoS One. 2021;16:e0245348.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 6]  [Cited by in RCA: 22]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
15.  Wagner EF, Nebreda AR. Signal integration by JNK and p38 MAPK pathways in cancer development. Nat Rev Cancer. 2009;9:537-549.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2164]  [Cited by in RCA: 2046]  [Article Influence: 120.4]  [Reference Citation Analysis (3)]
16.  Gururajan M, Chui R, Karuppannan AK, Ke J, Jennings CD, Bondada S. c-Jun N-terminal kinase (JNK) is required for survival and proliferation of B-lymphoma cells. Blood. 2005;106:1382-1391.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 123]  [Cited by in RCA: 134]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
17.  Huang Z, Yan DP, Ge BX. JNK regulates cell migration through promotion of tyrosine phosphorylation of paxillin. Cell Signal. 2008;20:2002-2012.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 45]  [Cited by in RCA: 54]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
18.  Dhanasekaran DN, Reddy EP. JNK-signaling: A multiplexing hub in programmed cell death. Genes Cancer. 2017;8:682-694.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 191]  [Cited by in RCA: 295]  [Article Influence: 32.8]  [Reference Citation Analysis (0)]
19.  Koehler K, Mielke K, Schunck M, Neumann C, Herdegen T, Proksch E. Distinct roles of JNK-1 and ERK-2 isoforms in permeability barrier repair and wound healing. Eur J Cell Biol. 2011;90:565-571.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 8]  [Cited by in RCA: 11]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
20.  Tuncman G, Hirosumi J, Solinas G, Chang L, Karin M, Hotamisligil GS. Functional in vivo interactions between JNK1 and JNK2 isoforms in obesity and insulin resistance. Proc Natl Acad Sci USA. 2006;103:10741-10746.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 297]  [Cited by in RCA: 274]  [Article Influence: 13.7]  [Reference Citation Analysis (4)]
21.  Koveitypour Z, Panahi F, Vakilian M, Peymani M, Seyed Forootan F, Nasr Esfahani MH, Ghaedi K. Signaling pathways involved in colorectal cancer progression. Cell Biosci. 2019;9:97.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 345]  [Cited by in RCA: 295]  [Article Influence: 42.1]  [Reference Citation Analysis (5)]
22.  Kim CG, Lee JJ, Jung DY, Jeon J, Heo HS, Kang HC, Shin JH, Cho YS, Cha KJ, Kim CG, Do BR, Kim KS, Kim HS. Profiling of differentially expressed genes in human stem cells by cDNA microarray. Mol Cells. 2006;21:343-355.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 54]  [Cited by in RCA: 9]  [Article Influence: 0.5]  [Reference Citation Analysis (0)]
23.  Lee S, Rauch J, Kolch W. Targeting MAPK Signaling in Cancer: Mechanisms of Drug Resistance and Sensitivity. Int J Mol Sci. 2020;21:1102.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 664]  [Cited by in RCA: 604]  [Article Influence: 100.7]  [Reference Citation Analysis (6)]
24.  Amalraj A, Gopi S. Biological activities and medicinal properties of Asafoetida: A review. J Tradit Complement Med. 2017;7:347-359.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 47]  [Cited by in RCA: 56]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
25.  Sahebkar A, Iranshahi M. Biological activities of essential oils from the genus Ferula (Apiaceae). Asian Biomed. 2010;4:835-847.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 45]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
26.  Mahendra P, Bisht S. Ferula asafoetida: Traditional uses and pharmacological activity. Pharmacogn Rev. 2012;6:141-146.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 91]  [Cited by in RCA: 98]  [Article Influence: 7.0]  [Reference Citation Analysis (1)]
27.  Kavoosi G, Rowshan V. Chemical composition, antioxidant and antimicrobial activities of essential oil obtained from Ferula assa-foetida oleo-gum-resin: effect of collection time. Food Chem. 2013;138:2180-2187.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 73]  [Cited by in RCA: 86]  [Article Influence: 6.6]  [Reference Citation Analysis (0)]
28.  Abu-Zaiton AS. Anti-diabetic activity of Ferula assafoetida extract in normal and alloxan-induced diabetic rats. Pak J Biol Sci. 2010;13:97-100.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 46]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
29.  Fatehi M, Farifteh F, Fatehi-Hassanabad Z. Antispasmodic and hypotensive effects of Ferula asafoetida gum extract. J Ethnopharmacol. 2004;91:321-324.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 71]  [Cited by in RCA: 63]  [Article Influence: 2.9]  [Reference Citation Analysis (0)]
30.  Divya K, Ramalakshmi K, Murthy PS, Jagan Mohan Rao L. Volatile oils from Ferula asafoetida varieties and their antimicrobial activity. LWT - Food Sci Technol. 2014;59:774-779.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 23]  [Article Influence: 1.9]  [Reference Citation Analysis (0)]
31.  Tayeboon GS, Tavakoli F, Hassani S, Khanavi M, Sabzevari O, Ostad SN. Effects of Cymbopogon citratus and Ferula assa-foetida extracts on glutamate-induced neurotoxicity. In Vitro Cell Dev Biol Anim. 2013;49:706-715.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 22]  [Article Influence: 1.7]  [Reference Citation Analysis (0)]
32.  Panwar R, Rana S, Dhawan DK, Prasad KK. Chemopreventive efficacy of different doses of Ferula asafoetida oleo-gum-resin against 1,2-dimethylhydrazine (DMH) induced rat colon carcinogenesis. J Phytopharmacol. 2016;4:282-286.  [PubMed]  [DOI]  [Full Text]
33.  Mallikarjuna GU, Dhanalakshmi S, Raisuddin S, Rao AR. Chemomodulatory influence of Ferula asafoetida on mammary epithelial differentiation, hepatic drug metabolizing enzymes, antioxidant profiles and N-methyl-N-nitrosourea-induced mammary carcinogenesis in rats. Breast Cancer Res Treat. 2003;81:1-10.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 36]  [Article Influence: 1.6]  [Reference Citation Analysis (1)]
34.  Saleem M, Alam A, Sultana S. Asafoetida inhibits early events of carcinogenesis: a chemopreventive study. Life Sci. 2001;68:1913-1921.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 64]  [Cited by in RCA: 55]  [Article Influence: 2.2]  [Reference Citation Analysis (0)]
35.  Abdo W, Hirata A, Shukry M, Kamal T, Abdel-Sattar E, Mahrous E, Yanai T. Calligonum comosum extract inhibits diethylnitrosamine-induced hepatocarcinogenesis in rats. Oncol Lett. 2015;10:716-722.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 17]  [Cited by in RCA: 28]  [Article Influence: 2.5]  [Reference Citation Analysis (0)]
36.  Ainsworth EA, Gillespie KM. Estimation of total phenolic content and other oxidation substrates in plant tissues using Folin-Ciocalteu reagent. Nat Protoc. 2007;2:875-877.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1404]  [Cited by in RCA: 1501]  [Article Influence: 79.0]  [Reference Citation Analysis (0)]
37.  Denizot F, Lang R. Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods. 1986;89:271-277.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4061]  [Cited by in RCA: 3537]  [Article Influence: 88.4]  [Reference Citation Analysis (1)]
38.  Elmore S. Apoptosis: a review of programmed cell death. Toxicol Pathol. 2007;35:495-516.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 11096]  [Cited by in RCA: 9789]  [Article Influence: 515.2]  [Reference Citation Analysis (6)]
39.  Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-408.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 158539]  [Cited by in RCA: 140317]  [Article Influence: 5612.7]  [Reference Citation Analysis (9)]
40.  Phi LTH, Sari IN, Yang YG, Lee SH, Jun N, Kim KS, Lee YK, Kwon HY. Cancer Stem Cells (CSCs) in Drug Resistance and their Therapeutic Implications in Cancer Treatment. Stem Cells Int. 2018;2018:5416923.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 760]  [Cited by in RCA: 697]  [Article Influence: 87.1]  [Reference Citation Analysis (0)]
41.  Pattabiraman DR, Weinberg RA. Tackling the cancer stem cells - what challenges do they pose? Nat Rev Drug Discov. 2014;13:497-512.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 849]  [Cited by in RCA: 811]  [Article Influence: 67.6]  [Reference Citation Analysis (1)]
42.  Ordóñez-Morán P, Dafflon C, Imajo M, Nishida E, Huelsken J. HOXA5 Counteracts Stem Cell Traits by Inhibiting Wnt Signaling in Colorectal Cancer. Cancer Cell. 2015;28:815-829.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 141]  [Cited by in RCA: 181]  [Article Influence: 16.5]  [Reference Citation Analysis (4)]
43.  Shin J, Carr A, Corner GA, Tögel L, Dávalos-Salas M, Tran H, Chueh AC, Al-Obaidi S, Chionh F, Ahmed N, Buchanan DD, Young JP, Malo MS, Hodin RA, Arango D, Sieber OM, Augenlicht LH, Dhillon AS, Weber TK, Mariadason JM. The intestinal epithelial cell differentiation marker intestinal alkaline phosphatase (ALPi) is selectively induced by histone deacetylase inhibitors (HDACi) in colon cancer cells in a Kruppel-like factor 5 (KLF5)-dependent manner. J Biol Chem. 2014;289:25306-25316.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 52]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
44.  Semba T, Sammons R, Wang X, Xie X, Dalby KN, Ueno NT. JNK Signaling in Stem Cell Self-Renewal and Differentiation. Int J Mol Sci. 2020;21:2613.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 39]  [Cited by in RCA: 72]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
45.  Sancho R, Nateri AS, de Vinuesa AG, Aguilera C, Nye E, Spencer-Dene B, Behrens A. JNK signalling modulates intestinal homeostasis and tumourigenesis in mice. EMBO J. 2009;28:1843-1854.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 117]  [Cited by in RCA: 133]  [Article Influence: 7.8]  [Reference Citation Analysis (3)]
46.  Krausova M, Korinek V. Wnt signaling in adult intestinal stem cells and cancer. Cell Signal. 2014;26:570-579.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 255]  [Cited by in RCA: 298]  [Article Influence: 22.9]  [Reference Citation Analysis (0)]
47.  Ventura JJ, Tenbaum S, Perdiguero E, Huth M, Guerra C, Barbacid M, Pasparakis M, Nebreda AR. p38alpha MAP kinase is essential in lung stem and progenitor cell proliferation and differentiation. Nat Genet. 2007;39:750-758.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 249]  [Cited by in RCA: 246]  [Article Influence: 12.9]  [Reference Citation Analysis (0)]
48.  Aouadi M, Bost F, Caron L, Laurent K, Le Marchand Brustel Y, Binétruy B. p38 mitogen-activated protein kinase activity commits embryonic stem cells to either neurogenesis or cardiomyogenesis. Stem Cells. 2006;24:1399-1406.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 89]  [Cited by in RCA: 86]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
49.  Thornton TM, Pedraza-Alva G, Deng B, Wood CD, Aronshtam A, Clements JL, Sabio G, Davis RJ, Matthews DE, Doble B, Rincon M. Phosphorylation by p38 MAPK as an alternative pathway for GSK3beta inactivation. Science. 2008;320:667-670.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 389]  [Cited by in RCA: 395]  [Article Influence: 21.9]  [Reference Citation Analysis (0)]
50.  Chen S, Zhao D, Luan C, Zheng J, Liu W, Feng Z, Luo R, Han X, Wang D. Ferulic Acid Induces Autophagy and Apoptosis in Colon Cancer CT26 Cells via the MAPK Pathway. Molecules. 2023;28:6014.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 16]  [Reference Citation Analysis (0)]
51.  Ren Y, Lv C, Zhang J, Zhang B, Yue B, Luo X, Yu Z, Wang H, Ren J, Wang Z, Dou W. Alantolactone exhibits antiproliferative and apoptosis-promoting properties in colon cancer model via activation of the MAPK-JNK/c-Jun signaling pathway. Mol Cell Biochem. 2021;476:4387-4403.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 24]  [Article Influence: 4.8]  [Reference Citation Analysis (3)]
52.  Janicke B, Hegardt C, Krogh M, Onning G, Akesson B, Cirenajwis HM, Oredsson SM. The antiproliferative effect of dietary fiber phenolic compounds ferulic acid and p-coumaric acid on the cell cycle of Caco-2 cells. Nutr Cancer. 2011;63:611-622.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 136]  [Cited by in RCA: 128]  [Article Influence: 8.5]  [Reference Citation Analysis (0)]
53.  Bagheri SM, Maghsoudi MJ, Yadegari M. Preventive Effect of Ferula asafoetida Oleo Gum Resin on Histopathology in Cuprizone-Induced Demyelination Mice. Int J Prev Med. 2020;11:179.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 10]  [Reference Citation Analysis (1)]
54.  Elarabany N, Hamad A, Alzamel NM. Antitumor and Phytochemical Properties of Ferula assa-foetida L. Oleo-Gum-Resin against HT-29 Colorectal Cancer Cells In Vitro and in a Xenograft Mouse Model. Molecules. 2023;28:8012.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 6]  [Reference Citation Analysis (0)]
55.  Zhang X, Lin D, Jiang R, Li H, Wan J, Li H. Ferulic acid exerts antitumor activity and inhibits metastasis in breast cancer cells by regulating epithelial to mesenchymal transition. Oncol Rep. 2016;36:271-278.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 85]  [Cited by in RCA: 132]  [Article Influence: 13.2]  [Reference Citation Analysis (0)]
56.  Efati Z, Shahangian SS, Darroudi M, Amiri H, Hashemy SI, Aghamaali MR. Green chemistry synthesized zinc oxide nanoparticles in Lepidium sativum L. seed extract and evaluation of their anticancer activity in human colorectal cancer cells. Ceram Int. 2023;49:32568-32576.  [PubMed]  [DOI]  [Full Text]
57.  Surai PF, Earle-Payne K, Kidd MT. Taurine as a Natural Antioxidant: From Direct Antioxidant Effects to Protective Action in Various Toxicological Models. Antioxidants (Basel). 2021;10:1876.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 110]  [Article Influence: 22.0]  [Reference Citation Analysis (0)]
58.  Kürbitz C, Heise D, Redmer T, Goumas F, Arlt A, Lemke J, Rimbach G, Kalthoff H, Trauzold A. Epicatechin gallate and catechin gallate are superior to epigallocatechin gallate in growth suppression and anti-inflammatory activities in pancreatic tumor cells. Cancer Sci. 2011;102:728-734.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 63]  [Cited by in RCA: 76]  [Article Influence: 5.1]  [Reference Citation Analysis (0)]
59.  Meščić Macan A, Gazivoda Kraljević T, Raić-Malić S. Therapeutic Perspective of Vitamin C and Its Derivatives. Antioxidants (Basel). 2019;8:247.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 45]  [Cited by in RCA: 78]  [Article Influence: 11.1]  [Reference Citation Analysis (1)]
60.  Hui LM, Zhao GD, Zhao JJ. δ-Cadinene inhibits the growth of ovarian cancer cells via caspase-dependent apoptosis and cell cycle arrest. Int J Clin Exp Pathol. 2015;8:6046-6056.  [PubMed]  [DOI]
61.  Sirizi MAG, Alizadeh Ghalenoei J, Allahtavakoli M, Forouzanfar H, Bagheri SM. Anticancer potential of Ferula assa-foetida and its constituents, a powerful plant for cancer therapy. World J Biol Chem. 2023;14:28-39.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 16]  [Reference Citation Analysis (1)]
62.  Vijayalakshmi, Adiga S, Bhat P, Chaturvedi A, Bairy KL, Kamath S. Evaluation of the effect of Ferula asafoetida Linn. gum extract on learning and memory in Wistar rats. Indian J Pharmacol. 2012;44:82-87.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 31]  [Cited by in RCA: 36]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
63.  Kelly KJ, Neu J, Camitta BM, Honig GR. Methemoglobinemia in an infant treated with the folk remedy glycerited asafoetida. Pediatrics. 1984;73:717-719.  [PubMed]  [DOI]  [Full Text]
64.  Goudah A, Abdo-El-Sooud K, Yousef MA. Acute and subchronic toxicity assessment model of Ferula assa-foetida gum in rodents. Vet World. 2015;8:584-589.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 8]  [Cited by in RCA: 10]  [Article Influence: 0.9]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Invited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Biochemistry and molecular biology

Country of origin: Egypt

Peer-review report’s classification

Scientific Quality: Grade B

Novelty: Grade C

Creativity or Innovation: Grade C

Scientific Significance: Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Uddin MR, Senior Researcher, Senior Scientist, Bangladesh S-Editor: Liu JH L-Editor: A P-Editor: Xu ZH

Write to the Help Desk