Transmembrane channel-like 5 drives hepatocellular carcinoma progression by regulating epithelial-mesenchymal transition

Abstract

BACKGROUND

Hepatocellular carcinoma (HCC) is a difficult cancer to manage due to its highly invasive and metastatic nature.

AIM

To investigate the molecular function of transmembrane channel-like 5 (TMC5) in vitro and in vivo, with the objective of identifying novel diagnosis and treatment targets for HCC.

METHODS

The expression of TMC in cancer and normal tissues, along with its correlation with HCC prognosis, was analyzed using the GENT2, GEPIA database, and Human Protein Atlas. COX analysis was conducted to assess the relationship between TMC5 expression and overall survival in TCGA-LIHC patients. Further experiments were conducted to investigate the effect of TMC5 in cancer progression through loss- and gain-of-function assays in vitro and in vivo.

RESULTS

Bioinformatics revealed that TMC5 expression was generally higher in tumors than in normal tissues, and its expression was associated with poorer patient survival outcomes. TMC5 expression in HCC tissues and cells was consistent with the results of the bioinformatics analysis. Suppression of TMC5 expression reduced migration, invasion, and proliferation, while also decreasing the expression of epithelial-mesenchymal transition (EMT)-associated molecules in MHCC97-LM3 cells. Conversely, higher TMC5 expression significantly increased cell migration, invasion, proliferation, and EMT in MHCC97 L cells. TMC5 knockdown significantly decreased both the formation and spread of nodules in liver tissue, whereas TMC5 overexpression promoted them.

CONCLUSION

Our study provides compelling evidence that TMC5 is highly expressed in HCC and drives cancer progression through the activation of EMT-mediated invasion. TMC5 could represent a valuable molecular target for the diagnosis and treatment of HCC.

Key Words: Hepatocellular carcinoma; Transmembrane channel-like protein 5; Epithelial-mesenchymal transition; Bioinformatics; diagnosis; Prognosis

Core Tip: In this study, transmembrane channel-like 5 (TMC5), which is highly expressed in hepatocellular carcinoma (HCC) and associated with increased invasive migration ability, is proposed for the first time as a potential marker for HCC. Bioinformatics analysis and in vivo and in vitro experiments confirmed that TMC5 regulates epithelial-mesenchymal transition to promote invasive migration in HCC. TMC5 might be a valuable molecular target for HCC diagnosis and treatment.

INTRODUCTION

Hepatocellular carcinoma (HCC) is the most prevalent form of neoplasia, accounting for approximately 90% of primary liver cancer cases[1]. Currently, it ranks as the third leading cause of cancer-related deaths worldwide and the sixth most frequently diagnosed cancer[2]. World Health Organization projects more than 1 million deaths from liver cancer in 2023[3]. Most cases of HCC occur in patients with underlying liver disease, with risk factors including infection with hepatitis B or C viruses, excessive alcohol consumption, metabolic liver disease, and exposure to dietary toxins. HCC is a stealthy and aggressive disease, with most patients diagnosed in the mid-to-late stage, often exhibiting varying degrees of intrahepatic and extrahepatic metastasis. Surgical resection and liver transplantation are the preferred treatment for early-stage HCC; however, advanced HCC is highly invasive, prone to metastasis, and challenging to diagnose, leading to poor patient outcomes[4]. A comprehensive understanding of the molecular mechanism underlying HCC metastasis and the identification of more effective therapeutic targets is crucial to improving treatment outcomes and prolonging patient survival.

Epithelial-mesenchymal transition (EMT) is a critical cellular phenotype in the invasion and metastasis of HCC, playing a role in all phases of tumor progression, including tumor initiation, distant dissemination, tumor cell migration, intravascular metastasis, and malignant progression. EMT is a process in which epithelial cells acquire a mesenchymal phenotype through undergoing phenotypic and genotypic transformation[5]. During EMT, epithelial cells lose their polarity, functional adherens junctions, and detach from the basement membrane. EMT involves the reprogramming of epithelial gene expression. Snail is a prominent EMT transcription factor, which suppresses the expression of the cell surface protein E-cadherin and upregulates mesenchymal proteins, including N-cadherin and Vimentin proteins[6]. As EMT progresses, the transcription of junction proteins is repressed, which stabilizes the loss of epithelial junctions[7,8]. These EMT markers are associated with invasion, metastasis, and poor prognosis[9].

Transmembrane channel-like (TMC) 5 is a member of the TMC gene family, which comprises eight members (TMC1 to TMC8). Previous studies have demonstrated the critical involvement of the TMC family in human cancer. Research indicates that mutations in TMC6 and TMC8 contribute not only to cervical cancer susceptibility[10] but are also associated with an increased risk of squamous cell carcinoma of skin[11]. The overexpression of TMC8 in HCC is associated with poor prognosis and may serve as a potential biomarker for HCC and head and neck squamous cell carcinoma[12,13]. TMC7 has been identified as a potential prognostic biomarker for pancreatic cancer[14], while TMC4 has been shown to predict breast cancer survival[15]. TMC5 is up-regulated in intrahepatic cholangiocarcinoma (ICC)[16] and prostatic carcinoma (PCa)[17], and its altered expression may serve as a diagnostic and prognostic biomarker to differentiate lung adenocarcinoma (LUAD) from lung squamous cell carcinoma (LUSC)[18-20]. TMC5 has also been strongly associated with acute myeloid leukemia (AML)[21] and chromophobe renal cell carcinoma[22]. Therefore, TMC5 is a promising molecular marker implicated in multiple types of cancer. Nevertheless, limited research explores the functional role of TMC5 in HCC.

In this study, we systematically examined the impact of TMC5 expression on the prognosis of various human cancers. Specifically, TMC5 expression was analyzed in HCC tissues and cell lines. Through functional assays and an orthotopic HCC mouse model, we investigated the functional role of TMC5 in HCC and the underlying molecular mechanisms. Our findings reveal the mechanisms by which TMC5 influences HCC progression and may provide a promising therapeutic target for the treatment of HCC.

MATERIALS AND METHODS

Bioinformatics and prognosis analyses of TMC5 expression

TMC5 expression differences between cancer and normal tissues, as well as its correlation with HCC prognosis, were analyzed using bioinformatics. TMC5 expression profiles were retrieved from the GENT2 (http://gent2.appex.kr/gent2/) and GEPIA (https://gepia2.cancer-pku.cn) databases, with GENT2 encompassing two microarray platforms, GPL570 and GPL96. Spatial expression of TMC5 protein in normal and tumor tissues was investigated using the Human Protein Atlas (HPA) database (https://www.proteinatlas.org/). The correlation between TMC5 expression and patient prognosis was analyzed using data from the TCGA-LIHC dataset. Correlations between clinical and prognostic characteristics, including gender, age, stage, and grade, and overall survival were evaluated using the log-rank test and Cox regression analysis. Proportional hazard models and cox regression analyses were conducted using the R package 'survival', while calibration analysis and visualization were performed with the R package 'rms'.

Clinical specimens and cell line

Paraffin-embedded tumor and normal tissues were collected from 10 HCC patients following histological and clinical diagnosis at The First People's Hospital of Yunnan Province. All samples were used after obtaining informed consent. The ethics committee of the First People's Hospital of Yunnan Province approved all protocols according to the Declaration of Helsinki.

Human HCC cell lines with high metastatic potential, MHCC97-LM3 (BNCC359345), and low metastatic potential, MHCC97 L (BNCC337741), were sourced from BeNa Culture Collection (China), while normal liver cell line LO2 (HL-7702) was acquired from Procell Life Science & Technology Co., Ltd (China). All cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; 10829, Gibco, Grand Island, NY, United States) supplemented with 10% (v/v) fetal bovine serum (FBS; 1902417, Gibco, Grand Island, NY, United States) at 37 °C under 5% CO₂.

Establishment of stable transfectant

Lentiviruses expressing three short hairpin RNAs (shRNAs) and an overexpression lentivirus (OV) of TMC5, along with short hairpin negative control (shNC or vector), were designed and synthesized by GenePharma (China). The interfering vector was pGMLV-SC7 RNAi, with the following sequences: ShNC (TTCTCCGAACGTGTCACGT), shRNA1 (GCCT GTCGGAAATTCTGAATT), shRNA2 (GGACTTCACTGTCACTCATGA), shRNA3 (GCAACTGATCACAAGTC TTGG). The overexpression vector was anti-CMV-H_TMC5-PGK-Blasticidin. MHCC97-LM3 cells were infected with shNC and TMC5-shRNAs, while vector and OV-TMC5 were transfected into MHCC97 L cells using Lipofectamine 2000 (11668027, Invitrogen, Carlsbad, CA, United States). To establish cell lines with stable expression, cells (1 × 10⁵ cells/well) were seeded into a 12-well plate and transfected with shRNAs and overexpression lentivirus at a multiplicity of infection of approximately 10. Following a 48-hour transfection period, the efficiency of the fluorescently labeled lentiviral infection was assessed using fluorescence microscopy. When the infection efficiency reached 80%, puromycin was then used to select for stably transfected cells. Western blot and qPCR analysis were performed to confirm the efficiency of knockdown and overexpression.

Colony formation assay

Approximately 500 cells per well were plated onto 6-well plates. After a culture period of 2 weeks, the formed colonies were fixed in 4% paraformaldehyde for 30 minutes and subsequently stained with 0.1% crystal violet for 10 minutes, then washed with phosphate buffered saline (PBS). The colonies were counted using Image J software.

Transwell invasion and wound healing assay

In the transwell invasion assays, the transwell chambers were coated with 50 μL of Matrigel and incubated at 37 °C for 30 minutes. Cells (1 × 10⁵ cells/mL) per well were incubated in 500 μL of serum-free DMEM and seeded a 24-well transwell chamber with an 8 μm pore size (Corning, China), and 500 µL of medium containing 10% FBS was added to the lower chamber. After incubation for 48 hours at 37 °C, the cells that migrated through the lower chamber were fixed in 4% paraformaldehyde and stained with 0.5% crystal violet. Subsequently, cells were observed under light microscopy and counted using Image J software.

In the wound-healing assays, cells (2.5 × 10⁴ cells/mL) per well were seeded into ibidi culture-inserts, with both the left and right wells incubated for 24 hours. When the cells had reached 95% confluence, the ibidi culture-insert was removed. After washing with PBS, the cells were cultured for 24 hours in DMEM supplemented with varying concentrations of FBS (1%, 5%, and 10%). Cell movement toward the wound was recorded, and wound area measurements were performed using Image J software.

Total RNA extraction and quantitative RT-PCR

Total RNA from cells was isolated with TriReagent (15596026, Invitrogen, Carlsbad, CA), and reverse-transcribed into cDNA using FastKing RT Kit (With gDNase) from Tiangen Biotech (China). The PCR reaction for the TMC5 gene was performed using Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd, China) under the following PCR cycles: 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 15 seconds, 60 °C for 30 seconds, and 72 °C for 1 minute. Amplification of GAPDH served as an internal control. The target primers were as follows: TMC5 forward: AATAACTGGTCTGAGGAA, TMC5 reverse: CTGGAACATCTGGATAAC, GAPDH forward: TTGCCCTCAACGACCACTTT, GAPDH reverse: TGGTCCAGGGGTCTTACTCC. The relative mRNA expression level was calculated using the 2^−ΔΔCt method.

Total protein extraction and Western blotting assays

Total protein samples were extracted from cells using RIPA buffer (Beyotime, China), and 60 μg of protein per well were separated by 10% SDS-PAGE gels and electroblotted onto a PVDF membrane. The membranes were then blocked with 5% nonfat dry milk and treated with primary antibodies: anti-TMC5 (1:2000; PA5-95696, Invitrogen, Carlsbad, CA, United States), anti-snail (1:2000; PA5-85493, Invitrogen, Carlsbad, CA, United States), anti-E-cadherin (1:1000; MA5-12547, Invitrogen, Carlsbad, CA, United States), anti-N-Cadherin (1:2000; PA5-19486, Invitrogen, Carlsbad, CA, United States), anti-Zo-1 (1:1000; PA5-28858, Invitrogen, Carlsbad, CA, United States), and anti-β-actin (1:4000; TA-09, ZSGB-bio, China) overnight at 4 °C. The membranes were washed three times with TBST and subsequently incubated with HRP-labeled secondary antibodies at room temperature for 2 hours. Protein signal was detected using a multi-electroluminescence detection system (Tanon Science & Technology, China) with β-actin as the loading control proteins.

HCC mouse model and in vivo imaging analysis

Female BALB/C-(nu/nu) nude mice aged 5-6 weeks and weighting 20-25 g were obtained from Kunming Medical University. All mice were treated in accordance with the guidelines for the care and use of laboratory animals of the National Institutes of Health. The ethics committee of Kunming Medical University approved all protocols according to the ARRIVE. Mice were anesthetized and fixed on a sterilized experiment board. Following sterilization with 70% alcohol, a transverse incision measuring 2 mm in depth and 1 to 1.5 cm in length was made below the xiphoid, perpendicular to the midline. The left lobe of the liver was carefully excised from the peritoneal cavity using a sterile cotton swab. MHCC97 L cells (1 × 10⁶ cells in 0.1 mL PBS) transfected with LV-OV-TMC5, LV-vector, LV-shNC, or LV-sh-TMC5 were injected into the left liver lobe of each mouse.

After three weeks, cancer progression was imaged in the mice by intraperitoneal injection of 10 μL/g of D-fluorescein. The mice were anesthetized with an intraperitoneal injection of 10 μL/g of pentobarbital solution. After imaging, the experimental animals were sacrificed using an overdose of 2% sodium pentobarbital (0.5 mL). Animals were dissected with medical scissors and tweezers to observe the lungs, liver, and other organs, which were excised for the assessment of biological changes and subsequent immunohistochemistry (IHC).

IHC

For the IHC staining, liver tissue samples were embedded in paraffin and sectioned into 5-μm-thick sections. These sections were baked at 60 °C for 30 minutes, deparaffinized in xylene, and rehydrated through a graded ethanol series to distilled water. The sections were then placed in citrate buffer for antigen retrieval and subjected to microwave for 20 minutes. The sections were treated with 3% H₂O₂ in methanol to quench endogenous peroxidase activity. Then, 5% sheep serum albumin was applied to block non-specific binding. Anti-E-cadherin antibody (1:200; ab231303, Abcam, Cambridge, MA, United States), anti-N-cadherin antibody (1:250; ab98952, Abcam, Cambridge, MA, United States), anti-ZO-1 antibody (1: 150; ab216880, Abcam, Cambridge, MA, United States), and anti-Snail antibody (1:100; PA5-23482, Invitrogen, Carlsbad, CA, United States) were incubated with the sections overnight at 37 °C. Horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG was then added as the secondary antibody (PV-9000, ZSGB-bio, China). Finally, the section was visualized using fluorescence microscope (BX53, Olympus, Japan).

Statistical analysis

Statistical analysis was conducted using GraphPad version 8.0. Data were expressed as the mean ± SE from at least three independent experiments. t-test was used to compare means between two samples, and ANOVA was used to compare means between multiple groups. Differences were considered statistically significant at P < 0.05.

RESULTS

HCC with higher TMC5 expression is associated with worse prognosis

TMC5 expression was analyzed across various human cancers and their corresponding normal tissues using GENT2 and GEPIA databases. The results indicated that TMC5 was expressed in multiple malignancies, including breast, esophageal, ovarian, pancreas, and lung cancers (Figure 1A-C). Specifically, there was a significant upregulation of TMC5 mRNA in HCC tissues compared to normal tissues (Figure 1D). Furthermore, IHC staining from HPA databases revealed higher TMC5 protein levels in HCC compared to normal liver tissues (Figure 1E).

Figure 1 Bioinformatics and prognosis analyses of transmembrane channel-like 5 expression. A and B: The expression profile of transmembrane channel-like 5 (TMC5) in different cancers and normal tissues was determined using GENT2; C: Pan-cancer analysis of TMC5 mRNA expression using the GEPIA database; D: Expression of TMC5 between hepatocellular carcinoma (HCC) and paired normal liver tissues based on the GEPIA database; E: Immunohistochemistry showing TMC5 expression in normal liver tissues from The Human Protein Atlas database; F: Overall survival curve of TMC5 in HCC patients in GEPIA dataset; G: Construction and validation of the nomogram based on TMC5 expression and clinical characteristics (gender, age, stage, T stage, N stage, and M stage); H: Calibration analysis based on the nomogram. ^aP < 0.05; ^bP < 0.01. TMC5: Transmembrane channel-like 5.

To further assess the clinical significance of TMC5, we performed a correlation analysis between TMC5 expression and patient prognosis. Higher TMC5 expression was progressively correlated with advanced tumor stage and T stage in HCC (Table 1). Both the log-rank and Cox univariate analyses demonstrated that elevated TMC5 expression was associated with a worse prognosis (Figure 1F and Table 2). To better understand the clinical relevance of TMC5, a prognostic nomogram was constructed, incorporating variables such as sex, age, tumor stage, T stage, N stage, M stage, and TMC5 expression (Figure 1G and Table 2). The calibration curve closely mirrored the ideal curve, indicating that model's predictions aligned well with actual outcomes (Figure 1H). Collectively, these findings indicate that TMC5 is highly expressed in HCC and that elevated TMC5 expression is associated with poor survival outcomes.

Table 1 Baseline information table for transmembrane channel-like 5 expression, n (%).

Characteristics	Low expression of TMC5 (n = 187)	High expression of TMC5 (n = 187)	P value
Gender			0.036
Female	51 (13.64)	70 (18.72)
Male	136 (36.36)	117 (31.28)
Age			0.499
≤ 60	92 (24.60)	85 (22.73)
> 60	95 (25.40)	101 (27.01)
Stage			0.029
I	99 (26.47)	74 (19.79)
II	40 (10.70)	12.57 (12.57)
III	41 (10.96)	44 (11.76)
IV	0	5 (1.34)
T stage			0.023
T1	101 (27.01)	82 (34)
T2	42 (11.23)	53 (16.3)
T3	39 (10.43)	41 (10.96)
T4	2 (0.53)	11 (2.94)
N stage			1.000
N0	134 (35.83)	120 (32.09)
N1	2 (0.27)	2 (0.27)
M stage			0.120
M0	139 (37.17)	129 (34.49)
M1	0	4 (1.07)

TMC5: Transmembrane channel-like 5.

Table 2 Association of transmembrane channel-like 5 expression and clinical characteristics with prognosis in hepatocellular carcinoma patients by uni- and multivariate COX analysis.

Characteristics	Total (n)	Univariate analysis		Multivariate analysis
		HR (95%CI)	P value	HR (95%CI)	P value
Gender	373
Female	121	0.79 (0.56-1.13)	0.200
Male	252
Age	373
≤ 60	177	1.21 (0.85-1.71)	0.295
> 60	196
Stage	349
I	173	1.42 (0.868-2.312)	0.164		0.994
II	86
III	85	2.734 (1.792-4.172)	< 0.001	4.803 (0.641-35.997)	0.127
IV	5	5.597 (1.726-18.148)	0.004		0.999
T stage	370
T1	183	1.431 (0.902-2.268)	0.128		0.994
T2	94
T3	80	2.674 (1.761-4.060)	< 0.001	0.673 (0.091-4.997)	0.699
T4	13	5.386 (2.690-10.784)	< 0.001	1.091 (0.120-9.930)	0.938
N stage	258
N0	254	2.03 (0.50-8.28)	0.324
N1	4
M stage	272
M0	268	4.077 (1.281-12.973)	0.017
M1	4
TMC5	373
Low	187	1.499 (1.059-2.122)	0.023	1.210 (0.772-1.895)	0.406
High	186

TMC5: Transmembrane channel-like 5.

The expression of TMC5 in HCC specimens and cells

To investigate the correlation between TMC5 and HCC, we conducted IHC to examine TMC expression in 10 pairs of HCC and matched para-cancerous tissues. The results indicated that TMC5 expression was significantly stronger in tumor tissue compared to para-cancerous tissues (Figure 2A). Additionally, we evaluated TMC5 expression in HCC cell lines, finding that TMC5 expression was increased in low-metastatic HCC cell line MHCC-97H, while the high-metastatic HCC cell line MHCC97-LM3 demonstrated particularly high TMC5 expression levels (Figure 2B). These findings indicate that TMC5 may play an important role in the development of HCC.

Figure 2 Expression of transmembrane channel-like 5 in hepatocellular carcinoma tissue and cell lines. A: Immunohistochemistry analysis of transmembrane channel-like 5 (TMC5) expression in Hepatocellular carcinoma tumor and paracancerous tissues (n = 10). Original magnification, 20 ×, scale bar = 100 μm; B: RT-qPCR was performed to detect the expression of TMC5 in LO2, MHCC-97H and MHCC97-LM3 (n = 3). HCC: Hepatocellular carcinoma; IHC: Immunohistochemistry; TMC5: Transmembrane channel-like 5. ^aP < 0.01.

TMC5 promotes proliferation, migration, and invasion of HCC in vitro

Based on TMC5 expression in HCC cells, three LV-TMC5-shRNAs were infected into MHCC97-LM3 cells to knock down TMC5, and LV-OV-TMC5 was transfected into MHCC-97H to overexpress TMC5. The efficacy of TMC5 knockdown and overexpression was confirmed by qRT-PCR and Western blot (Figure 3A). LV-TMC5-shRNA3 resulted in a significant reduction of the TMC5 expression in MHCC97-LM3 cells, while LV-TMC5-shRNA1 and LV-TMC5-shRNA2 slightly reduced TMC5 expression. In contrast, LV-OV-TMC5 induced a significant increase in TMC5 expression in MHCC-97H cells. Colony formation, transwell invasion and wound healing assays demonstrated that TMC5 expression influenced the proliferative, migratory, and invasive abilities of HCC cells. Colony formation assays showed that TMC5 depletion in MHCC97-LM3 corresponded to reduced cell proliferative, while overexpressing TMC5 in MHCC-97H noticeably increased cell proliferation (Figure 3B). In addition, transwell invasion assay and wound healing analysis revealed that TMC5 knockdown significantly weakened the capability of migration and invasion in MHCC97-LM3 as compared with that of shNC (Figure 3C). Overexpression of TMC5 in MHCC97H enhanced the migration and invasion ability of MHCC-97H as compared with the control empty vector-transfected cell (Figure 3D). Thus, TMC5 promotes proliferation, migration, and invasion of HCC cells.

Figure 3 Transmembrane channel-like 5 promotes cell invasion, migration and proliferation. A: MHCC97-LM3 were transfected with three short hairpin RNAs (shRNAs) lentivirus, and MHCC-97H were transfected with transmembrane channel-like 5 (TMC5) overexpression lentivirus, conformed by qRT-PCR and western blot (n = 3); B: Colony formation formation assay of MHCC97-LM3 was transfected with three shRNAs lentivirus, MHCC-97H were transfected with TMC5 overexpression lentivirus (n = 3), scale bar = 500 μm; C: Transwell invasion assay of MHCC97-LM3 was transfected with three shRNAs lentivirus, MHCC-97H was transfected with TMC5 overexpression lentivirus, scale bar = 500 μm (n = 3); D: Wound healing assay of MHCC97-LM3 was transfected with three shRNAs lentivirus, MHCC-97H was transfected with TMC5 overexpression lentivirus (n = 3), scale bar = 200 μm. ^aP < 0.05; ^bP < 0.01. TMC5: Transmembrane channel-like 5; shNC: Short hairpin negative control; shRNA: Short hairpin RNA; OV: Overexpression lentivirus.

TMC5 expression influenced the EMT

To elucidate the mechanisms by which TMC5 regulates HCC proliferation, migration and invasion, we performed western blotting analysis of protein expression. Knockdown of TMC5 in MHCC97-LM3 cell resulted in a corresponding downregulation of EMT transcription factor Snail and mesenchymal marker N-cadherin, along with an upregulation of the epithelial markers E-cadherin and ZO-1 (Figure 4). Conversely, increased expression levels of Snail and N-cadherin, along with decreased expression levels of the E-cadherin and ZO-1, were observed in MHCC-97H after upregulation of TMC5 expression (Figure 4). These results suggest that TMC5 plays a potential role in regulating EMT, and further highlight its potential as a therapeutic target for cancer treatment.

Figure 4 Protein expression of epithelial-mesenchymal transition-related markers was detected by Western blotting. Band intensity analysis was performed MHCC97-LM3 cells were transfected with short hairpin negative control and short hairpin RNAs lentivirus, MHCC-97H transfected with overexpression transmembrane channel-like 5 lentivirus (n = 3). ^aP < 0.05; ^bP < 0.01. shNC: Short hairpin negative control; shRNA: Short hairpin RNA; OV: Overexpression lentivirus.

TMC5 enhances metastatic potential of HCC in vivo

To investigate whether TMC5 promotes tumor metastasis in vivo, we injected MHCC97-LM3 cells with stable TMC5 knockdown and MHCC-97H cells with stable TMC5 overexpression into the left lobe of nude mice, using cells carrying an empty vector as a control. After two weeks, we found that, compared to hepatic tumors initiated by empty vector-expressing cells, tumors initiated by TMC5-overexpressing cells produced significantly more metastatic nodules in the lung and liver. In vivo imaging analysis confirmed the presence of both liver tumors and metastatic lung tumors in the mice (Figure 5). To further explore the correlation between TMC5 expression and EMT, IHC staining was used to identify proteins associated with EMT in liver samples of mice (Figure 6). The results indicate that liver tissue from mice injected with MHCC-97H overexpressing TMC5 exhibited higher positive staining for Snail and N-cadherin, while positive staining for E-cadherin and ZO-1 was lower compared to the vector group. Conversely, liver tissue from mice receiving MHCC97-LM3 with TMC5 knockdown showed that TMC5 inhibition reduced the positive staining area of Snail and N-cadherin, while increasing the positive staining area of E-cadherin and ZO-1. These findings suggest that TMC5 overexpression significantly enhances the development of both intrahepatic and distal pulmonary metastatic tumors.

Figure 5 Tumor growth and metastasis were examined by IVIS imaging system and quantified by bioluminescence intensity, and representative images were shown (n = 6). shNC: Short hairpin negative control; shRNA: Short hairpin RNA; OV: Overexpression lentivirus. ^aP < 0.01.

Figure 6 Mouse liver was collected and immunohistochemistry analysis of snail, E-cadherin, N-cadherin and ZO-1, and representative images were shown (n = 6). Original magnification, 20 ×, scale bar = 100 μm. ^aP < 0.05; ^bP < 0.01. IHC: Immunohistochemistry; shNC: Short hairpin negative control; shRNA: Short hairpin RNA; OV: Overexpression lentivirus.

DISCUSSION

TMC5 is observed to be differentially expressed in various cancers. Previous studies have demonstrated that TMC5 is highly expression in lung cancer[18,23], liver cancer[23,24], ICC[16,23], oral squamous cell carcinoma[19,20], and prostate cancer[17,23]. Additionally, TMC5 could serve as a sensitive and specific marker to distinguish LUAD from LUSC[19]. The role of TMC5 in PCa has been shown to PCa cell proliferation by regulating the cell cycle[17]. The expression level of TMC5 has also been correlated with a poor prognosis in LUSC, AML, and renal clear cell carcinoma[20,21,25]. Previous studies have only revealed that TMC5 is highly expressed in HCC. However, the prognostic value and function of TMC5 in HCC are unknown. In this study, HCC samples were immunohistochemically stained for TMC5, and the results showed higher TMC5 expression in HCC tissues compared to adjacent tissues, with a positive correlation between intracellular expression and metastatic potential. Notably, high expression of TMC5 predicted a possible reduction in survival in HCC patients, and the TMC5-associated nomogram model predicted HCC survival outcomes that were similar to the actual results. This suggests that TMC5 is an effective prognostic biomarker for HCC. The results of univariate COX analysis showed that TMC5 was significantly associated with the prognosis of HCC patients, but the results of multivariate COX analysis were not statistically significant. This suggests that TMC5 is not an independent prognostic factor in HCC and that its effect is masked or attenuated by other prognostic variables (age, gender, and tumor stage). Furthermore, TMC5 significantly enhanced cells proliferation, migration, invasion and metastasis in both in vitro and in vivo models. Taken together, our study demonstrates that TMC5 plays an oncogenic role in HCC.

EMT plays a crucial role in HCC tumor metastasis. EMT was first observed in mouse model of HCC and was found to result from the functional synergy between oncogenic H-Ras and TGF-β[26-29]. In a cohort of 323 patients with HCC, downregulation of E-cadherin and nuclear translocation of β-catenin, both of which are associated with microvascular invasion and metastasis, were identified[30]. Collectively, EMT plays a critical role in initiating the metastatic cascade in tumors, and its upregulation is essential for promoting metastatic growth[31]. During EMT, tumor cells lose their apical-basal polarity, leading to decreased E-cadherin expression and increased N-cadherin expression, which reduces cell adhesion and enhances motility. TMC5 has emerged as a key regulator of HCC aggressiveness and metastasis. In line with these results, TMC5 expressed at higher levels corresponding to more aggressive HCC cell. In this study, we observed that TMC5 is required to induce mesenchymal markers and suppress epithelial markers in malignant HCC cells. These findings confirm the involvement of EMT in HCC metastases and provide new insights into the role of TMC5 in HCC progression, though its precise regulatory mechanism remains unclear. These results suggest a mechanism through which TMC5 contributes to HCC cell invasion and metastasis.

Abnormal expression of the genes within the TMC protein family has been observed in several different types of cancer. TMCs are ion channels that transport various ions and are involved in development and progression of disease[32]. Mechanistic studies of TMC family members have focused exclusively on TMC1 and TMC2, which are critical for auditory conduction by contributing to mechano transduction currents in hair cells, regulating the resting membrane potential and background Na-leak conductance[33]. TMC4 acts as an anion channel, facilitating Cl^- currents that help generate action potentials in taste cells in response to salt stimulation[34]. Other proteins in the same family may have regulatory role in tumorigenesis, but the exact mechanisms have yet to be determined. TMC5 may function as a multi-functional intracellular ion channel protein. TMC5 regulates cell differentiation, migration, and proliferation by acting as a transporter that imports anterior gradient proteins from cells and mediates outward-inward signal transduction events[35,36]. Mutations and altered expression of ion channels, pumps, and binding proteins in cancer cells facilitate EMT, which facilitates proliferation and malignancy[37]. Therefore, we hypothesize that TMC5 regulates EMT via mediating ion transport. However, further research is needed to elucidate its molecular mechanism in HCC development.

CONCLUSION

In summary, we reviewed the role of TMC5 in HCC, including its expression profile, prognostic value, biological functions, and regulatory mechanisms. The common overexpression of TMC5 in HCC renders it a valuable prognostic indicator, but not an independent prognostic factor. TMC5 is highly expressed in HCC and promotes the activation of EMT, contributing to pro-tumorigenic activity. As a significant oncogene, TMC5 has emerged as a potential target for therapeutic intervention strategies in HCC.