BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2023. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastrointest Pharmacol Ther. Mar 5, 2023; 14(2): 4-21
Published online Mar 5, 2023. doi: 10.4292/wjgpt.v14.i2.4
Cinnamic acid regulates the intestinal microbiome and short-chain fatty acids to treat slow transit constipation
Jin-Guang Jiang, Qian Luo, Department of Colorectal and Anal Surgery, Suqian Hospital of Traditional Chinese Medicine, Suqian 223800, Jiangsu Province, China
Shuang-Shuang Li, Tian-Ying Tan, Kai Xiong, College of Clinical Medicine, Guizhou University of Traditional Chinese Medicine, Guiyang 550000, Guizhou Province, China
Tao Yang, Tian-Bao Xiao, Department of Colorectal and Anal Surgery, The First Affiliated Hospital of Guizhou University of Traditional Chinese Medicine, Guiyang 550000, Guizhou Province, China
ORCID number: Jin-Guang Jiang (0000-0001-7665-8755); Qian Luo (0000-0003-0096-1736); Shuang-Shuang Li (0000-0001-7408-5797); Tian-Ying Tan (0000-0003-2133-3886); Kai Xiong (0000-0002-4063-0627); Tao Yang (0000-0002-5787-2542); Tian-Bao Xiao (0000-0003-2622-948X).
Author contributions: Jiang JG and Luo Q conceived the project and wrote the manuscript; Luo Q performed the central part of the experiments and analyzed data, with contributions from Li SS, Tan TY, and Xiong K; Yang T and Xiao TB participated in the experimental design and manuscript draft preparation and revision; All authors read and approved the final manuscript.
Supported by the "333 Scientific Project" of Jiangsu Province in 2020, No. BRA2020237; and the Science and Technology Project of Suqian, Jiangsu Province in 2020, No. Z2020057.
Institutional animal care and use committee statement: All animal procedures were conducted in accordance with guidelines for laboratory animal care after approval by the Ethics Committee of Suqian Hospital of Traditional Chinese Medicine.
Conflict-of-interest statement: All authors of this manuscript state that they do not have any conflict of interests, and there is nothing to disclose.
Data sharing statement: No additional data are available.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Corresponding author: Tian-Bao Xiao, MD, Doctor, Department of Colorectal and Anal Surgery, The First Affiliated Hospital of Guizhou University of Traditional Chinese Medicine, No. 71 Baoshan North Road, Guiyang 550000, Guizhou Province, China. prof_xiaotianbao@163.com
Received: October 15, 2022
Peer-review started: October 15, 2022
First decision: January 3, 2023
Revised: January 10, 2023
Accepted: February 21, 2023
Article in press: February 21, 2023
Published online: March 5, 2023
Processing time: 139 Days and 2.6 Hours

Abstract
BACKGROUND

Slow transit constipation (STC) is a disorder with delayed colonic transit. Cinnamic acid (CA) is an organic acid in natural plants, such as Radix Scrophulariae (Xuan Shen), with low toxicity and biological activities to modulate the intestinal microbiome.

AIM

To explore the potential effects of CA on the intestinal microbiome and the primary endogenous metabolites-short-chain fatty acids (SCFAs) and evaluate the therapeutic effects of CA in STC.

METHODS

Loperamide was applied to induce STC in mice. The treatment effects of CA on STC mice were assessed from the 24 h defecations, fecal moisture and intestinal transit rate. The enteric neurotransmitters: 5-hydroxytryptamine (5-HT) and vasoactive intestinal peptide (VIP) were determined by the enzyme-linked immunosorbent assay. Hematoxylin-eosin and Alcian blue and Periodic acid Schiff staining were used to evaluate intestinal mucosa's histopathological performance and secretory function. 16S rDNA was employed to analyze the composition and abundance of the intestinal microbiome. The SCFAs in stool samples were quantitatively detected by gas chromatography-mass spectrometry.

RESULTS

CA ameliorated the symptoms of STC and treated STC effectively. CA ameliorated the infiltration of neutrophils and lymphocytes, increased the number of goblet cells and acidic mucus secretion of the mucosa. In addition, CA significantly increased the concentration of 5-HT and reduced VIP. CA significantly improved the diversity and abundance of the beneficial microbiome. Furthermore, the production of SCFAs [including acetic acid (AA), butyric acid (BA), propionic acid (PA) and valeric acid (VA)] was significantly promoted by CA. The changed abundance of Firmicutes, Akkermansia, Lachnoclostridium, Monoglobus, UCG.005, Paenalcaligenes, Psychrobacter and Acinetobacter were involved in the production of AA, BA, PA and VA.

CONCLUSION

CA could treat STC effectively by ameliorating the composition and abundance of the intestinal microbiome to regulate the production of SCFAs.

Key Words: Slow transit constipation; Cinnamic acid; Intestinal microbiome; Short-chain fatty acids; Intestinal motility

Core Tip: Studies on the gut microbiome and its metabolites are increasingly in slow transit constipation (STC). In this study, we found that Cinnamic acid (CA) improved and treated STC effectively by ameliorating intestinal mucosa's histopathological performance and secretory function in STC mice induced by loperamide, with alpha and beta diversity significantly decreased. Meanwhile, CA ameliorated the composition and abundance of the intestinal microbiome.



INTRODUCTION

Slow transit constipation (STC) is one of the most boresome disorders in the digestive system and characterized by delayed colonic transit, caused by either myopathy or neuropathy[1]. The severity of slow transit may be severe enough to cease spontaneous bowel movements completely. The proportion of STC in chronic idiopathic constipation was estimated at 42%[2]. STC has curtailed the quality of life, burdened psychological distress, and significantly increased the social and economic burden[3,4].

It is very hard to manage and treat STC clinically because of the unknown pathophysiologic mechanisms. Abnormalities of the enteric nervous system and neurotransmitters [such as vasoactive intestinal peptide (VIP), substance P (SP), nitric oxide synthase (NOS)], imbalance of intestinal microbiome and decreased number of interstitial cells of Cajal have been described as the slow transit colon in the STC patients[5-7]. Alterations of the intestinal microbiome in patients with chronic constipation are characterized by a relative decrease in beneficial bacteria and a parallel increase of potentially pathogenic or opportunistic microbiome[8]. Previous studies have revealed the intimate association between STC and altered abundance of the interstitial microbiome. A cross-sectional pilot study using 16S rRNA gene pyrosequencing indicated that the abundances of Bacteroidetes were decreased and the abundances of genera Blautia, Coprococcus and Ruminococcus were increased significantly in constipated patients[6]. When analyzed at the phylum level, a previous study revealed that the Firmicutes, Bacteroidetes, Proteobacteria, and Actinobacteria were increased significantly in patients with chronic constipation[9]. Using culture-based methods, it was also indicated that Faecalibacterium, Roseburia and Coprococcus were increased significantly in constipated patients[10]. All these alterations of the intestinal microbiome influenced intestinal motility and metabolic function by changing the number of metabolites and the metabolic environment of the gut[11]. Short-chain fatty acids (SCFAs), the primary endogenous metabolites, were produced from the fermentation of undigested carbohydrates by intestinal bacteria. SCFAs could enhance the absorption of fluid and sodium absorption potentially aggravate STC symptoms[12]. A case-control study indicated that butyrate, acetate, and propionate levels were significantly lower in constipated patients[13]. Furthermore, a previous study demonstrated that the administration of SCFAs with 100-200 mM directly into rats stimulated colonic motility and accelerated colonic transit[14]. In these regards, the regulation of regulating crobiome and the metabolism of SCFAs via interventional drugs may be essential to treat STC.

Cinnamic acid (CA) is an organic acid in natural plants, such as Radix Scrophulariae (Xuan Shen), that has low toxicity and with a broad spectrum of biological activities. A previous study showed that CA restrained gram-positive (Staphylococcus aureus) and gram-negative (Escherichia coli) bacteria effectively[15]. Furthermore, another study indicated that CA ameliorated lipopolysaccharide-induced inflammation and oxidative stress in mice[16]. However, a rare study clarified the therapeutic effects of CA in STC. In this study, we intend to explore the potential effects of CA on the intestinal microbiome and SCFAs and evaluate the therapeutic effects of CA in STC.

MATERIALS AND METHODS
Reagents

CA (CAS: 140-10-3) was purchased from Chroma Biotechnology Co. Ltd. (Chengdu, China) with HPLC purity ≥ 98%. Prucalopride (PRU) was purchased from Jiangsu Haosen pharmaceutical group Co., Ltd (Cat. No. H20183482). Loperamide was obtained from Xi'an Janssen Pharmaceutical Co., Ltd (Cat. No. LFJ8574). When applied to mice, all drugs were dissolved in sodium chloride injection (NS 0.9%).

Loperamide-induced STC mice and grouping

The model using loperamide-induced mice with STC was previously reported[17]. Briefly, specific pathogen-free (SPF), Balb/c mice (n = 50, 25 was male and 25 was female, weight: 20 ± 2 g, age: 4-6 wk) were purchased from Beijing Huahukang Animal Breeding Center (permission No. SCXK-(jing) 2019–0008). All mice were maintained under SPF conditions in a shelter sustained facility and provided with sterile food and water. All mice were randomly divided into the control group, model group, PRU group, CA with low-dose and high-dose groups (n = 10 per group) respectively. The mice in the model group were given loperamide at a dose of 9.6 mg/kg, once per day via oral gavage for 4 consecutive weeks. Mice in the positive group received 0.26 mg/kg·d-1 PRU (the equivalent doses of the clinic). Mice in the low-dose and high-dose CA group received 40 mg/kg·d-1 and 80 mg/kg·d-1 CA respectively, according to the study of Yan et al[18] and Wang et al[19]. PRU and CA were orally administered once daily for four weeks. The serum samples, stool samples in the intestine and colon tissues were collected when all mice were sacrificed on the 29th day. All collected samples were kept at -80 °C condition and then taken for further experiments.

Assessment of 24 h defecations, fecal moisture and intestinal transit rate

At the end of experiment, all mice were housed individually in metallic cages to collect feces once an hour for 24 h, and the feces number and weight were recorded. The fecal water content was calculated after drying the feces in a desiccator at 60 °C for 12 h, according to the equation: (wet weight-dry weight)/wet weight ×100%. To evaluate the intestinal transit rate, all mice in each group were gavaged with 0.2 mL Indian ink after 2 h at the end of the last treatment. After 24 h, mice were sacrificed. The intestinal transit rate was calculated according to the equation: traveled distance of Indian ink in the intestine (cm)/full length of intestine (cm) × 100%.

Measurement of 5-HT and VIP concentration

Two main enteric neurotransmitters: 5-hydroxytryptamine (5-HT) and VIP were determined by the enzyme-linked immunosorbent assay (ELISA). The serum concentration of 5-HT and the VIP content in the colon tissue was detected by the ELISA kits. ELISA kits of 5-HT (Cat No.: JYM0433Mo) and VIP (Cat No.: JYM0436Mo) were purchased from Colorful-Gene Biotechnology Co., Ltd. (www.jymbio.com, Wuhan, China). All assays were performed rigorously according to the manufacturer’s instructions. The Synergy H1 Hybrid Reader (Biotech, United States) was applied to measure the relative optical density of 5-HT and VIP spectrophotometrically at a wavelength of 450 nm.

Hematoxylin-eosin and Alcian blue/periodic acid-Schiff staining of colon tissue

Mice were sacrificed at the end of the experiment. Parts of the colons were fixed in 4% paraformaldehyde cleared in xylene, embedded in paraffin, and cut into 5 mm thick slices. The histopathological performance of colon tissue was stained with hematoxylin-eosin (HE). Furthermore, the mucous cells in the colon were stained with Alcian blue/periodic acid-Schiff (AB/PAS). All experiment processes were performed according to the manufacturer's instructions.

Intestinal microbiome analysis by 16S rDNA

The total DNA in stool samples was extracted with a stool DNA kit (Omega Bio-Tek, Norcross, GA, United States). Then, the V3-4 hypervariable region of the bacterial 16S rRNA gene was amplified with the universal primers, forward (5′-3′): ACTCCTACGGGAGGCAGCAG and reverse (5′-3′): GGACTACHVGGGTWTCTAAT (806R). The PCR products were purified using a QIAquick Gel Extraction Kit (QIAGEN, Germany), quantified using RT-PCR, and sequenced. The deep sequencing was performed on Miseq platform. After the run, image analysis, base calling and error estimation were performed using Illumina Analysis Pipeline Version 2.6. The raw data were screened and sequences were removed if they were shorter than 200 bp, had a low-quality score (≤ 20), contained ambiguous bases or did not match primer sequences and barcode tags. Finally, the dataset analysis was performed using the online platform of Majorbio Cloud Platform (www.majorbio.com).

Quantitative detection of SCFAs by gas chromatography-mass spectrometry

The SCFAs in stool samples were quantitatively detected by gas chromatography-mass spectrometry (GC-MS). All of the seven SCFAs, including acetic acid (AA), butyric acid (BA), caproic acid (CA-1), isobutyric acid (IBA), isovaleric acid (IVA), propionic acid (PA) and valeric acid (VA), were extracted as previously described[18]. Briefly, 50 mg of stool sample was used for metabolite extraction with 400 μL methanol-acetonitrile and 30 μL L-2-chlorophenyl alanine. After homogenization and ultrasonic extraction, the samples were incubated at -20 °C for 30 min and centrifuged for 10 min at 12000 rpm at 4 °C. Finally, 20 μL of supernatant from each sample was transferred to a vial for GC-MS analysis. The condition of GC-MS referred to the previous study[19]. All samples were evaluated in duplicate.

Statistics analysis

All data were presented as mean ± standard deviation and analyzed with the SPSS software program (version 21.0). Data were presented using one-way ANOVA followed by an LSD test. P < 0.05 was considered statistically significant and P < 0.01 was highly significant. R software (version 4.0.4) and GraphPad Prism software for Windows (version 8.02; Inc., San Diego, United States) were utilized for the visible presentation of all results.

RESULTS
CA increased 24 h defecations, fecal moisture and intestinal transit rate of STC mice

The pharmacological effects of CA on STC were evaluated from the 24 h defecations, fecal moisture and intestinal transit rate aspects. As presented in Figure 1A and B, mice in the STC model group showed more feces remaining in the colon and shorter length than the control group. Meanwhile, the 24 h defecations in the STC model group was significantly decreased (Figure 1C). After treated by CA with 40 mg/kg·d-1 and 80 mg/kg·d-1, the number of fecal remnants in the colon (Figure 1B) was significantly decreased and 24 h defecations (Figure 1C) was significantly increased when compared with the STC model group. In addition, the fecal water content also was significantly increased by the CA treatment, especially in the CA with high doses group (Figure 1D). Parallelly, the intestinal transit rate was significantly higher in the CA with high doses group compared with the STC model group (Figure 1E). Those results indicated that CA could ameliorate the symptoms of STC and treat STC effectively.

Figure 1
Figure 1 Pharmacological effects of cinnamic acid on slow transit constipation mice. A: Number of fecal remnants in the colon of mice in each group (n = 8); B: Number of fecal remnants in the colon of mice in each group (n = 8); C: 24 h defecations of mice in each group (n = 8); D: Fecal water content of mice in each group (n = 8); E: Intestinal transit rate of mice in each group (n = 8). aP < 0.05 and bP < 0.01 versus the control group; cP < 0.05 and dP < 0.01 versus the slow transit constipation model group. NS: Not significant. PRU: Prucalopride; CA-low: Cinnamic acid with low dose; CA-high: Cinnamic acid with high dose.
CA ameliorated the histopathological performance and secretory function of intestinal mucosa in STC mice

As presented in Figure 2A, mice in the control group showed the mucosa, muscular and goblet cells were normal. However, the model group showed that the thickness of the mucosa and muscular was significantly thinner. The mucosal integrity was compromised and chronic inflammation was observed in the mucosa, presented with a large number of eosinophilic infiltration, mainly in the lamina propria. Furthermore, the number of goblet cells was significantly reduced. Compared with the model group, the thickness of the mucosa and muscular were increased significantly, inflammatory cell infiltration was reduced, mucosa was smoother, and the structure of glandular was gradually restored and arranged more neatly in the PRU group. The CA group with low and high doses showed smoother mucosa, more intact morphology and structure of glandular (secreting mucus, lubricating the intestinal tract, and facilitating bowel movements), less infiltration of neutrophils and lymphocytes, and higher numbers of phagocytes compared to the PRU group (Figure 2A).

Figure 2
Figure 2 Hematoxylin-eosin and Alcian blue/periodic acid-Schiff staining of each group of mice. A: HE staining of each group of mice; B: Alcian blue/periodic acid-Schiff staining of each group of mice. PRU: Prucalopride; CA-low: Cinnamic acid with low dose; CA-high: Cinnamic acid with high dose.

Then, the secretory function of goblet cells in the mucosa was tested. As presented in Figure 2B, the secretion of acidic mucus (the blue part) was significantly decreased in the model group compared with the control group. The acidic mucus secreted by the goblet cells in the PRU group increased slightly. Conversely, the secretion of acidic mucus was significantly increased in the CA group, especially in the CA with high doses group.

CA increased the concentration of 5-HT and reduced VIP

As presented in Table 1 and Figure 3A, the serum concentration of 5-HT was significantly decreased in the STC model group, which was significantly lower than the control group (P < 0.01). In the PRU group, 5-HT concentration was significantly increased, even higher than the control group. In the CA group with low and high doses, 5-HT concentration was significantly increased compared with the STC model group (P < 0.01, Table 1 and Figure 3A). On the contrary, the VIP concentration in the colon tissue was increased significantly in the STC model group (Table 1 and Figure 1B). After treated by CA with low and high doses, the content of VIP was significantly decreased compared with the STC model group (P < 0.01, Table 1 and Figure 3B).

Figure 3
Figure 3 Effects of Cinnamic acid on the concentration of 5-HT and vasoactive intestinal peptide. A: Serum concentration of 5-hydroxytryptamine in each group of mice (n = 8); B: Content of vasoactive intestinal peptide in the colon of mice in each group (n = 8). bP < 0.01 versus the control group; dP < 0.01 versus the slow transit constipation model group. PRU: Prucalopride; CA-low: Cinnamic acid with low dose; CA-high: Cinnamic acid with high dose.
Table 1 Concentration of 5-hydroxytryptamine and vasoactive intestinal peptide in each group of mice.
Groups (n = 8)
5-HT (ng/mL)
VIP (ng/mL)
Control66.83 ± 4.5014.64 ± 2.08
STC Model53.48 ± 4.23b30.73 ± 3.70b
PRU67.69 ± 5.00d18.18 ± 1.92d
CA-low65.31 ± 4.44d19.28 ± 1.30d
CA-high66.00 ± 5.93d19.31 ± 1.75d
CA improved the alpha diversity of intestinal microbiome in STC mice

The Shannon index, one of the diversity indices for estimating microbial diversity, was applied to evaluate the alpha diversity of the intestinal microbiome in different groups.

The higher the Shannon index, the greater the community’s diversity in the intestinal microbiome. As presented in Figure 4A and B, the Shannon index was significantly decreased at the operational taxonomic units (OTU) level compared with the control group (P < 0.05) and the CA with doses group (P < 0.01). In addition, the Shannon index also decreased significantly in the model group at the phylum (Figure 4C and D) and genus level (Figure 4E and F). After CA treatment, the Shannon index was upgraded significantly. Altogether, these results indicated that CA could improve the alpha diversity of the intestinal microbiome in STC mice.

Figure 4
Figure 4 Alpha diversity of intestinal microbiome in each group of mice (n = 8). A: Shannon index evaluation of each group of mice at the OTU level; B: Difference test of Shannon index at the OTU level; C: Shannon index evaluation of each group of mice at the phylum level; D: Difference test of Shannon index at the phylum level; E: Shannon index evaluation of each group mice at the genus level; F: Difference test of Shannon index at the genus level; aP < 0.05 and bP < 0.01. PRU: Prucalopride; CA-low: CA with low dose; CA-high: CA with high dose.
CA increased the beta diversity of intestinal microbiome in STC mice

Principal coordinates analysis (PCoA) of Bray-Curtis distance matrices was carried out for beta diversity determination among different groups. As shown in Figure 5A, evident separation of the microbiome was observed on the two-dimensional PCoA plots among different groups. The microbiome separated significantly from the control and CA in the model group with the high doses group. The Venn plots (Figure 5B) indicated the co-species number in all groups was 506. In the model group, the species number was lower than in the remaining four groups (the control, PRU, CA-low and CA-high groups). A hierarchical clustering analysis at the OUT (Figure 5C), phylum (Figure 5D) and genus level (Figure 5E) showed significant differences between each group. The CA-treated samples were clustered separately from the model group but close to the control group, indicating that CA could alleviate the distribution of species in microbial beta diversity.

Figure 5
Figure 5 Beta diversity of intestinal microbiome in each group of mice (n = 8). A: PcoA plot at the operational taxonomic units (OTU) level; B: Venn plot at the OTU level; C: Hierarchical clustering tree at the OTU level; D: Hierarchical clustering tree at the phylum level; E: Hierarchical clustering tree at the genus level; PRU: Prucalopride; CA-low: Cinnamic acid with low dose; CA-high: Cinnamic acid with high dose.
CA promoted the composition and abundance of the intestinal microbiome in STC mice

The species difference analysis was conducted to identify the specific microbiome in different groups. The linear discriminant analysis effect size (LefSe) (Figure 6A) based on the linear discriminant analysis showed the abundance of p__Bacteroidota.c__Bacteroidia.o__Bacteroidales was significantly increased in the model group. The abundance of p__Proteobacteria.c__Gammaproteobacteria.o__Pseudomonadales. f__Moraxellaceae.g__Acinetobacter was significantly increased in the PRU group. After being treated by CA, the abundance of p__Firmicutes.c__Clostridia.o__Eubacteriales was increased significantly in the low doses of CA group. In addition, the abundance of p__Firmicutes.c__Clostridia and p__Verrucomicrobiota. c__Verrucomicrobiae. o__Verrucomicrobiales were increased significantly in the high doses of CA group (Figure 6A). In terms of bacterial composition at the OTU level, OTU 398 and OTU 694 were significantly increased in the model group than in the remaining four groups. After being treated by CA, OTU646, OTU 352, OTU 671 and OTU 653 were significantly increased (Figure 6B). Then, we identified the specific microbiome at the genus level. Overall, the significantly statistically significant species were norank_f__Muribaculaceae, Colidextribacter, Ruminococcus, Lachnospiraceae_NK4A136_group, Alloprevotella, Bacteroides and Prevotellaceae_UCG-001 (Figure 6C). When compared the model group with the low doses of CA group, the g_Rikenella, g_Monoglobus and g_Anaerofustis were significantly increased (Figure 6D). When compared with the high doses of CA group, the Lachnospiraceae_NK4A136_group, g_Akkermansia, norank_f__Desulfovibrionaceae, g_Lachnoclostridium, g_Monoglobus and g_Acinetobacter were increased significantly (Figure 6E).

Figure 6
Figure 6 The composition and abundance of the intestinal microbiome in each group of mice (n = 8). A: LefSe analysis of the significantly differential microbiome in each group; B: Differential comparison between multiple groups at the operational taxonomic units level; C: Differential comparison between multiple groups at the genus level; D: Differential comparison between model and CA-low group at the genus level; E: Differential comparison between model and CA-high group at the genus level. aP < 0.05, bP < 0.01 and eP < 0.001. PRU: Prucalopride; CA-low: Cinnamic acid with low dose; CA-high: Cinnamic acid with high dose.
CA changed the phenotypes and functions of the intestinal microbiome in STC mice

The BugBase was applied to predict the phenotypes based on the relative abundance of samples in different groups. Results indicated the phenotypes of stress-tolerant, aerobic, containing mobile elements and potentially pathogenic were predicted in different groups. The phenotypes of potentially pathogenic were increased significantly in the model group. Conversely, the phenotypes of aerobic and containing mobile elements were significantly increased in the high doses of CA group (Figure 7A). Then, the PICRUSt package of 16S amplification sequencing results was used to predict the biological functions. Results revealed that the functions of energy production and conversion, amino acid transport and metabolism, carbohydrate transport and metabolism, transcription were significantly improved by CA treatment (Figure 7B). Conclusively, CA mainly changed the phenotypes of aerobic and containing mobile elements and improved the biological functions of energy production and conversion, amino acid transport, and metabolism to regulate intestinal microbiome diversity.

Figure 7
Figure 7 Prediction of phenotypes and biological functions for the significantly differential microbiome in each group. A: Prediction of phenotypes for the significantly differential microbiome in each group; B: Prediction of biological functions for the significantly differential microbiome in each group. aP < 0.05. PRU: Prucalopride; CA-low: Cinnamic acid with low dose; CA-high: Cinnamic acid with high dose.
CA upregulated the content of SCFAs via the intestinal microbiome in STC mice

A previous study indicated that the level of SCFAs in the stool could be involved in STC development[20-22]. Thus, the SCFAs in stool samples were quantitatively detected by GC-MS. The comparison between multiple groups showed that the content of SCFAs was decreased in the model group (Figure 8A). After being treated by CA, the content of AA and BA was increased (Figure 8A). The comparison between the model group and the low doses of CA group showed that the content of SCFAs was not increasing except for the BA (Figure 8B). However, the content of AA, BA and VA was increased in the high doses of CA group (Figure 8C). Then, the correlation between the dominant microbiome and SCFAs was analyzed by Spearman methods. Results indicated all content of SCFAs were negatively correlated with g_Parabacteroides and positively correlated with g_Corynebacterium (Figure 8D). The AA level was significantly decreased with the higher abundance of g_Parabacteroides (P < 0.05). The level of PA was significantly increased with the higher abundance of g_Paenalcaligenes (P < 0.01, Figure 8D) and g_Psychrobacter (P < 0.05, Figure 8D). In addition, the g_Rikendlla regulated by low doses of CA significantly increased the level of AA (Figure 8E). In the high doses of CA, most SCFAs levels were increased with the specific microbiome regulated by high doses of CA. The level of BA and VA was significantly increased with g_UCG.005 (P < 0.05, Figure 8F), but the level of CA-1 was significantly decreased with g__norank_f__Rs-E47_termite_group (P < 0.01, Figure 8F). All mentioned results identified that CA could ameliorate the composition and abundance of the intestinal microbiome to regulate the content and production of SCFAs in STC mice.

Figure 8
Figure 8 Quantitative analysis of short-chain fatty acids and their correlation with the dominant microbiome (n = 8). A: Short-chain fatty acids (SCFAs) level in each group; B: SCFAs level in model and CA-low group; C: SCFAs level in model and CA-high group; D: Heatmap for the correlation between SCFAs and differential microbiome in each group; E: Heatmap for the correlation between SCFAs and differential microbiome in CA-low group; F: Heatmap for the correlation between SCFAs and differential microbiome in CA-high group. PRU: Prucalopride; CA-low: Cinnamic acid with low dose; CA-high: Cinnamic acid with high dose.
DISCUSSION

There is increasing evidence indicating that the alterations of the intestinal microbiome and its metabolites are the pivotal pathophysiologic mechanism of STC. This study found that the alpha and beta diversity were significantly decreased in the STC mice induced by loperamide. In addition, the abundance of pathogenic or opportunistic bacteria, such as Bacteroides, and the phenotypes of potentially pathogenic were increased significantly in the STC mice. Meanwhile, the SCFAs, including AA, BA, IBA and VA, were decreased significantly in the STC mice compared with the normal control mice. Subsequently, we found that the organic acid: CA improved the symptoms of STC and treated STC effectively. Furthermore, CA ameliorated intestinal mucosa's histopathological performance and secretory function in STC mice. CA, especially with high dose (80 mg/kg·d-1) also improved the alpha and beta diversity of the intestinal microbiome and significantly promoted Firmicutes' composition and abundance, Verrucomicrobiota, Ruminococcus, Akkermansia, Lachnoclostridium Monoglobus and Acinetobacter. Meanwhile, CA upregulated the level of AA, BA and VA via ameliorating the composition and abundance of the intestinal microbiome.

There has been increasing study regarding the direct association between the intestinal microbiome and gut motility and constipation. A recent study in germ-free mice (without gastrointestinal microbiota) showed that the colon transit time and gastric emptying were prolonged compared with the wild-type mice[23]. The colonization of L.acidophilus, Bifidobacterium, or Clostridium tabificum into germ-free rats accelerated the gut transit time and small-bowel migrating motor complexes. However, the colonization of E. coli significantly inhibited intestinal myoelectric activity[24]. In a murine study, the administration of loperamide significantly increased the abundance of Bacteroides and Firmicutes, and decreased the abundance of Lachnospiraceae. Consequently, the colonic contractility was significantly decreased and prolonged colon transit time[25]. In addition, in the loperamide-induced mice with STC, dysbiosis was also observed in intestinal bacteria. The abundance of Bacteroidetes was decreased and the Firmicutes and Proteobacteria increased significantly[26]. On the contrary, a decreasing abundance of Clostridiales and Lactobacillales and a significantly increasing in Bacteroidales abundance was noted in the loperamide-induced constipation rats[27]. Our study also found that the diversity and composition of the intestinal microbiome were dysbiotic, identifying the association between intestinal bacteria dysbiosis and the development of STC. Based on previous studies[28,29], we speculated that CA was absorbed into the bloodstream mainly in the duodenum and jejunum and indirectly affected on the intestinal tract and the intestinal flora. However, no relevant experiments were designed to prove this in our study. Therefore, the study of absorption and metabolism of CA in STC mice will help to systematically elucidate the mechanism of action of CA in the treatment of STC.

SCFAs have been verified to affect the gut motility and contractility, colonic transit time, mucus production and the gut-brain axis. The alterations of the intestinal microbiome could regulate the production of SCFAs by changing the intestinal environment. Butyrate stimulates the Na and Cl absorption in the intestine and accelerates colon transit[12]. Butyrate also significantly increased the colonic muscle contractions and promoted colonic transit by increasing the proportion of choline acetyltransferase in rats' enteric nervous system[30]. In addition, another study in vitro has shown that butyrate, propionate, and valerate induced the phasic contractions in the middle and distal colon via connecting the mucosal receptors to enteric and/or vagal nerves[31]. More and more studies have indicated that the intestinal microbiome regulates the level of SCFAs. A study predicted that the genus of Coprococcus, Roseburia, and Faecalibacterium increased the level of butyrate in constipation patients[6]. de Meij et al[32] found an increase in Bacteroides fragilis, Bacteroides ovatus, Bifidobacterium longum, Parabacteroides spp., and a decrease in Alistipes finegoldii in children with STC compared to healthy children. Parthasarathy and his colleagues found by 16S ribosomal RNA gene sequencing that the colonic mucosal microbiota of STC patients differed from that of healthy patients——increased abundant of Bacteroidetes spp. and decreased abundant of Firmicutes spp. (Faecalibacterium, Lactococcus, and Roseburia). And they revealed that Firmicutes spp. were associated with faster colonic transport, and methane (slowing intestinal motility) production was related to the composition of the fecal microbiota but not to constipation or colonic transport[5]. Moreover, the abundance of Prevotella is positively correlated with the fiber content of the diet[33]. Clostridium spp., and Ruminococcus spp. were responsible for the significant fraction of AA, BA and PA production[34]. Our study found that the main types of SCFAs (including AA, BA, CA-1, IBA, IVA, PA and VA) were decreased in the loperamide-induced mice with STC. After being treated by CA, most of SCFAs level were increased with the specific microbiome regulated by CA. The level of BA and VA was significantly increased with g_UCG.005, PA was increased with the abundance of g_Paenalcaligenes and g_Psychrobacter significantly. But the level of CA-1 was significantly decreased with g__norank_f__Rs-E47_termite_group.

CONCLUSION

Conclusively, this study provided experimental evidence that CA was an effective agent in treating STC. This conclusion was followed by the results that CA ameliorated the infiltration of neutrophils and lymphocytes, increasing the number of goblet cells and the colon mucosa secretory function. CA significantly improved the diversity and abundance of the beneficial microbiome. Furthermore, the changed abundance of Firmicutes, Akkermansia, Lachnoclostridium, Monoglobus, UCG.005, Paenalcaligenes, Psychrobacter and Acinetobacter were involved in the production of AA, BA, PA and VA. Our results identified that CA could ameliorate the composition and abundance of the intestinal microbiome to regulate the production of SCFAs in STC.

ARTICLE HIGHLIGHTS
Research background

Slow transit constipation (STC) is a disorder with delayed colonic transit. Cinnamic acid (CA) is an organic acid in natural plants with low toxicity and biological activities to modulate the intestinal microbiome.

Research motivation

We found CA to be very effective in treating STC.

Research objectives

We intend to explore the potential effects of CA on the intestinal microbiome and the primary endogenous metabolites.

Research methods

Loperamide was applied to induce STC in mice. The treatment effects of CA on STC mice were assessed from the 24 h defecations, fecal moisture and intestinal transit rate. We used the enzyme-linked immunosorbent assay, Hematoxylin-eosin and Alcian blue and Periodic acid Schiff staining, 16S rDNA and gas chromatography-mass spectrometry to explore the potential effects of CA on the intestinal microbiome and the primary endogenous metabolites-short-chain fatty acids (SCFAs) and evaluate the therapeutic effects of CA in STC.

Research results

CA ameliorated the symptoms and the pathology of STC and treated STC effectively. CA significantly increased the concentration of 5-HT and reduced VIP. CA significantly improved the diversity and abundance of the beneficial microbiome. The production of SCFAs (including acetic acid, butyric acid, propionic acid and valeric acid) was significantly promoted by CA.

Research conclusions

CA could treat STC effectively by ameliorating the composition and abundance of the intestinal microbiome to regulate the production of SCFAs.

Research perspectives

CA is effective in treating STC mice, and further studies are needed to better advance its clinical application.

References
1.  Rao SS, Rattanakovit K, Patcharatrakul T. Diagnosis and management of chronic constipation in adults. Nat Rev Gastroenterol Hepatol. 2016;13:295-305.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 277]  [Cited by in RCA: 243]  [Article Influence: 24.3]  [Reference Citation Analysis (0)]
2.  Tanner S, Chaudhry A, Goraya N, Badlani R, Jehangir A, Shahsavari D, Malik Z, Parkman HP. Prevalence and Clinical Characteristics of Dyssynergic Defecation and Slow Transit Constipation in Patients with Chronic Constipation. J Clin Med. 2021;10.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 35]  [Cited by in RCA: 30]  [Article Influence: 6.0]  [Reference Citation Analysis (0)]
3.  Guerin A, Carson RT, Lewis B, Yin D, Kaminsky M, Wu E. The economic burden of treatment failure amongst patients with irritable bowel syndrome with constipation or chronic constipation: a retrospective analysis of a Medicaid population. J Med Econ. 2014;17:577-586.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 57]  [Cited by in RCA: 56]  [Article Influence: 4.7]  [Reference Citation Analysis (1)]
4.  Singh G, Lingala V, Wang H, Vadhavkar S, Kahler KH, Mithal A, Triadafilopoulos G. Use of health care resources and cost of care for adults with constipation. Clin Gastroenterol Hepatol. 2007;5:1053-1058.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 90]  [Cited by in RCA: 75]  [Article Influence: 3.9]  [Reference Citation Analysis (3)]
5.  Parthasarathy G, Chen J, Chen X, Chia N, O'Connor HM, Wolf PG, Gaskins HR, Bharucha AE. Relationship Between Microbiota of the Colonic Mucosa vs Feces and Symptoms, Colonic Transit, and Methane Production in Female Patients With Chronic Constipation. Gastroenterology. 2016;150:367-79.e1.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 349]  [Cited by in RCA: 313]  [Article Influence: 31.3]  [Reference Citation Analysis (6)]
6.  Zhu L, Liu W, Alkhouri R, Baker RD, Bard JE, Quigley EM, Baker SS. Structural changes in the gut microbiome of constipated patients. Physiol Genomics. 2014;46:679-686.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 330]  [Cited by in RCA: 289]  [Article Influence: 24.1]  [Reference Citation Analysis (5)]
7.  Wedel T, Spiegler J, Soellner S, Roblick UJ, Schiedeck TH, Bruch HP, Krammer HJ. Enteric nerves and interstitial cells of Cajal are altered in patients with slow-transit constipation and megacolon. Gastroenterology. 2002;123:1459-1467.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 256]  [Cited by in RCA: 232]  [Article Influence: 9.7]  [Reference Citation Analysis (4)]
8.  Gerritsen J, Smidt H, Rijkers GT, de Vos WM. Intestinal microbiota in human health and disease: the impact of probiotics. Genes Nutr. 2011;6:209-240.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 581]  [Cited by in RCA: 462]  [Article Influence: 30.8]  [Reference Citation Analysis (0)]
9.  Yarullina DR, Shafigullin MU, Sakulin KA, Arzamastseva AA, Shaidullov IF, Markelova MI, Grigoryeva TV, Karpukhin OY, Sitdikova GF. Characterization of gut contractility and microbiota in patients with severe chronic constipation. PLoS One. 2020;15:e0235985.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 57]  [Cited by in RCA: 51]  [Article Influence: 8.5]  [Reference Citation Analysis (0)]
10.  Pryde SE, Duncan SH, Hold GL, Stewart CS, Flint HJ. The microbiology of butyrate formation in the human colon. FEMS Microbiol Lett. 2002;217:133-139.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1106]  [Cited by in RCA: 944]  [Article Influence: 39.3]  [Reference Citation Analysis (3)]
11.  Zhao Y, Yu YB. Intestinal microbiota and chronic constipation. Springerplus. 2016;5:1130.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 177]  [Cited by in RCA: 161]  [Article Influence: 16.1]  [Reference Citation Analysis (0)]
12.  Binder HJ, Mehta P. Short-chain fatty acids stimulate active sodium and chloride absorption in vitro in the rat distal colon. Gastroenterology. 1989;96:989-996.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 249]  [Cited by in RCA: 206]  [Article Influence: 5.6]  [Reference Citation Analysis (0)]
13.  Shi Y, Chen Q, Huang Y, Ni L, Liu J, Jiang J, Li N. Function and clinical implications of short-chain fatty acids in patients with mixed refractory constipation. Colorectal Dis. 2016;18:803-810.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 37]  [Cited by in RCA: 33]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
14.  Fukumoto S, Tatewaki M, Yamada T, Fujimiya M, Mantyh C, Voss M, Eubanks S, Harris M, Pappas TN, Takahashi T. Short-chain fatty acids stimulate colonic transit via intraluminal 5-HT release in rats. Am J Physiol Regul Integr Comp Physiol. 2003;284:R1269-R1276.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 371]  [Cited by in RCA: 341]  [Article Influence: 14.8]  [Reference Citation Analysis (5)]
15.  Zolfaghari B, Yazdiniapour Z, Sadeghi M, Akbari M, Troiano R, Lanzotti V. Cinnamic acid derivatives from welsh onion (Allium fistulosum) and their antibacterial and cytotoxic activities. Phytochem Anal. 2021;32:84-90.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 21]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
16.  Zhuo R, Cheng X, Luo L, Yang L, Zhao Y, Zhou Y, Peng L, Jin X, Cui L, Liu F. Cinnamic Acid Improved Lipopolysaccharide-Induced Depressive-Like Behaviors by Inhibiting Neuroinflammation and Oxidative Stress in Mice. Pharmacology. 2022;107:281-289.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 35]  [Cited by in RCA: 29]  [Article Influence: 7.3]  [Reference Citation Analysis (0)]
17.  Ren X, Liu L, Gamallat Y, Zhang B, Xin Y. Enteromorpha and polysaccharides from enteromorpha ameliorate loperamide-induced constipation in mice. Biomed Pharmacother. 2017;96:1075-1081.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 98]  [Cited by in RCA: 79]  [Article Influence: 8.8]  [Reference Citation Analysis (1)]
18.  Yan SL, Wang ZH, Yen HF, Lee YJ, Yin MC. Reversal of ethanol-induced hepatotoxicity by cinnamic and syringic acids in mice. Food Chem Toxicol. 2016;98:119-126.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 46]  [Cited by in RCA: 36]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
19.  Wang Z, Ge S, Li S, Lin H, Lin S. Anti-obesity effect of trans-cinnamic acid on HepG2 cells and HFD-fed mice. Food Chem Toxicol. 2020;137:111148.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 53]  [Cited by in RCA: 35]  [Article Influence: 5.8]  [Reference Citation Analysis (0)]
20.  Yang D, Zhao D, Shah SZA, Wu W, Lai M, Zhang X, Li J, Guan Z, Zhao H, Li W, Gao H, Zhou X, Yang L. Implications of gut microbiota dysbiosis and metabolic changes in prion disease. Neurobiol Dis. 2020;135:104704.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 44]  [Cited by in RCA: 39]  [Article Influence: 6.5]  [Reference Citation Analysis (0)]
21.  Zhao R, Chu L, Wang Y, Song Y, Liu P, Li C, Huang J, Kang X. Application of packed-fiber solid-phase extraction coupled with GC-MS for the determination of short-chain fatty acids in children's urine. Clin Chim Acta. 2017;468:120-125.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 26]  [Cited by in RCA: 48]  [Article Influence: 5.3]  [Reference Citation Analysis (0)]
22.  Zhuang M, Shang W, Ma Q, Strappe P, Zhou Z. Abundance of Probiotics and Butyrate-Production Microbiome Manages Constipation via Short-Chain Fatty Acids Production and Hormones Secretion. Mol Nutr Food Res. 2019;63:e1801187.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 147]  [Cited by in RCA: 129]  [Article Influence: 18.4]  [Reference Citation Analysis (3)]
23.  Waclawiková B, Codutti A, Alim K, El Aidy S. Gut microbiota-motility interregulation: insights from in vivo, ex vivo and in silico studies. Gut Microbes. 2022;14:1997296.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 107]  [Cited by in RCA: 80]  [Article Influence: 20.0]  [Reference Citation Analysis (0)]
24.  Husebye E, Hellström PM, Sundler F, Chen J, Midtvedt T. Influence of microbial species on small intestinal myoelectric activity and transit in germ-free rats. Am J Physiol Gastrointest Liver Physiol. 2001;280:G368-G380.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 239]  [Cited by in RCA: 203]  [Article Influence: 8.1]  [Reference Citation Analysis (0)]
25.  Kashyap PC, Marcobal A, Ursell LK, Larauche M, Duboc H, Earle KA, Sonnenburg ED, Ferreyra JA, Higginbottom SK, Million M, Tache Y, Pasricha PJ, Knight R, Farrugia G, Sonnenburg JL. Complex interactions among diet, gastrointestinal transit, and gut microbiota in humanized mice. Gastroenterology. 2013;144:967-977.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 405]  [Cited by in RCA: 360]  [Article Influence: 27.7]  [Reference Citation Analysis (5)]
26.  Zhang X, Yang H, Zheng J, Jiang N, Sun G, Bao X, Lin A, Liu H. Chitosan oligosaccharides attenuate loperamide-induced constipation through regulation of gut microbiota in mice. Carbohydr Polym. 2021;253:117218.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 100]  [Cited by in RCA: 90]  [Article Influence: 18.0]  [Reference Citation Analysis (0)]
27.  Deng Y, Li M, Mei L, Cong LM, Liu Y, Zhang BB, He CY, Zheng PY, Yuan JL. Manipulation of intestinal dysbiosis by a bacterial mixture ameliorates loperamide-induced constipation in rats. Benef Microbes. 2018;9:453-464.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 37]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
28.  Nutley BP, Farmer P, Caldwell J. Metabolism of trans-cinnamic acid in the rat and the mouse and its variation with dose. Food Chem Toxicol. 1994;32:877-886.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 56]  [Cited by in RCA: 44]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
29.  Yang BK, Wang SJ, Zeng J, Zhong YM, Zang LQ. Study of intestinal absorption of cinnamic acid in one-way intestinal perfusion rat model. Guangdong Yaoke Daxue Xuebao. 2013;29:69-72.  [PubMed]  [DOI]  [Full Text]
30.  Soret R, Chevalier J, De Coppet P, Poupeau G, Derkinderen P, Segain JP, Neunlist M. Short-chain fatty acids regulate the enteric neurons and control gastrointestinal motility in rats. Gastroenterology. 2010;138:1772-1782.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 461]  [Cited by in RCA: 402]  [Article Influence: 25.1]  [Reference Citation Analysis (4)]
31.  Wang JK, Yao SK. Roles of Gut Microbiota and Metabolites in Pathogenesis of Functional Constipation. Evid Based Complement Alternat Med. 2021;2021:5560310.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 48]  [Cited by in RCA: 48]  [Article Influence: 9.6]  [Reference Citation Analysis (1)]
32.  de Meij TG, de Groot EF, Eck A, Budding AE, Kneepkens CM, Benninga MA, van Bodegraven AA, Savelkoul PH. Characterization of Microbiota in Children with Chronic Functional Constipation. PLoS One. 2016;11:e0164731.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 107]  [Cited by in RCA: 98]  [Article Influence: 9.8]  [Reference Citation Analysis (0)]
33.  De Filippo C, Cavalieri D, Di Paola M, Ramazzotti M, Poullet JB, Massart S, Collini S, Pieraccini G, Lionetti P. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc Natl Acad Sci USA. 2010;107:14691-14696.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4731]  [Cited by in RCA: 4036]  [Article Influence: 252.3]  [Reference Citation Analysis (6)]
34.  Markowiak-Kopeć P, Śliżewska K. The Effect of Probiotics on the Production of Short-Chain Fatty Acids by Human Intestinal Microbiome. Nutrients. 2020;12.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1021]  [Cited by in RCA: 822]  [Article Influence: 137.0]  [Reference Citation Analysis (7)]
Footnotes

Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

Provenance and peer review: Invited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country/Territory of origin: China

Peer-review report’s scientific quality classification

Grade A (Excellent): 0

Grade B (Very good): B

Grade C (Good): C

Grade D (Fair): D

Grade E (Poor): 0

P-Reviewer: Chiba T, Japan; Zhang X, China S-Editor: Liu JH L-Editor: A P-Editor: Yu HG

Write to the Help Desk