Overexpression of ELL-associated factor 2 suppresses invasion, migration, and angiogenesis in colorectal cancer

Table 1 Gene sequences used for transfection

Gene	Sequences
STAT3-siRNA	1-siRNA	5’-CCGGGCTGACCAACAATCCCAAGAACTCGAGTTCTTGGGATTGTTGGTCAGCTTTTT G-3’
	Anti-sense	5’-AATTCAAAAAGCTGACCAACAATCCCAAGAACTCGAGTTCTTGGGATTGTTGGTCAGC-3’
	2-siRNA	5’-CCGGGCACAATCTACGAAGAATCAACTCGAGTTGATTCTTCGTAGATTGTGCTTTTTG-3’
	Anti-sense	5’-AATTCAAAAAGCACAATCTACGAAGAATCAACTCGAGTTGATTCTTCGTAGATTGTGC-3’
	3-siRNA	5’-CCGGGCTGAAATCATCATGGGCTATCTCGAGATAGCCCATGATGATTTCAGCTTTTTG-3’
	Anti-sense	5’-AATTCAAAAAGCTGAAATCATCATGGGCTATCTCGAGATAGCCCATGATGATTTCAGC-3’

STAT3: Signal transducer and activator of transcription 3.

Table 2 Baseline characteristics of patients with advanced colorectal cancer and their correlation with immunohistochemical expression of ELL-associated factor 2

Clinicopathologic characteristic	Cases, n (%)	EAF2		P value
		Low (n = 58)	High (n = 12)
Age (yr)				0.831
< 61 (median)	47.14	27	6
≥ 61	52.86	31	6
Gender				0.589
Male	57.14	34	6
Female	42.86	24	6
Tumor site				0.162
Colon	34.29	22	2
Rectum	65.71	36	10
Size of the tumor (cm)				0.726
≤ 4	37.14	21	5
> 4	62.86	37	7
Histological type				0.210
Mucinous	20.00	10	4
Non-mucinous	80.00	48	8
Degree of differentiation				0.318
Well/moderate	62.86	38	6
Poor/mucinous	37.14	20	6
Angiolymphatic and/or perineural invasion				0.113
Absent	45.71	24	8
Present	54.29	34	4
Tumor stage (TNM)				0.240
I-II	42.86	23	7
III-IV	57.14	35	5
Tumor invasion depth				0.682
T2-T3	52.86	30	7
T4	47.14	28	5
Lymph node status				0.210
N0	50.00	27	8
N1-N2	50.00	31	4
Distant metastasis				0.025
Absent	74.29	40	12
Present	25.71	18	0
CEA				0.038
Normal	65.71	35	11
High	34.29	23	1
CA19-9				0.445
Normal	40.00	22	6
High	60.00	36	6
P53				0.589
Normal	42.86	24	6
High	57.14	34	6
CDX2				0.350
Normal	22.86	12	4
High	77.14	46	8

EAF2: ELL-associated factor 2; TNM: Tumor-node-metastasis; CEA: Carcinoembryonic antigen; CA19-9: Carbohydrate antigen 19-9.

Table 3 Univariate and multivariate survival analyses of overall survival for colorectal cancer by Cox regression

Variable	Univariate analysis			Multivariate analysis
	HR	95%CI	P value	HR	95%CI	P value
Age (yr) (≥ 61/< 61)	1.203	0.633-2.284	0.573
Gender (female/male)	0.894	0.472-1.695	0.732
Tumor site (colon/rectum)	1.524	0.791-2.935	0.208	0.682	0.288-1.618	0.386
Size of the tumor, cm (> 4/≤ 4)	0.929	0.479-1.799	0.827
Histological type (mucinous/non-mucinous)	1.481	0.619-3.544	0.378
Degree of differentiation (poor/mucinous, well/moderate)	0.863	0.446-1.670	0.661
Angiolymphatic and/or perineural invasion (present/absent)	0.342	0.169-0.693	0.003	0.194	0.036-1.042	0.056
Tumor stage (III-IV/I-II)	0.404	0.200-0.816	0.012	4.199	0.603-29.234	0.147
Tumor invasion depth (T4/T2-T3)	0.426	0.221-0.822	0.011	0.253	0.071-0.908	0.035
Lymph node status (N1-N2/N0)	0.447	0.231-0.867	0.017	3.138	0.766-12.863	0.112
Distant metastasis (present/absent)	0.203	0.105-0.393	< 0.001	0.149	0.056-0.397	< 0.001
EAF2 (low/high)	3.481	1.069-11.341	0.038	2.261	0.653-7.829	0.198
CEA (high/low)	1.092	0.559-2.136	0.796
CA19-9 (high/low)	0.740	0.378-1.446	0.378
P53 (high/low)	0.579	0.295-1.134	0.111	0.697	0.336-1.448	0.333
CDX2 (high/low)	0.694	0.305-1.576	0.383

HR: Hazard ratio; CI: Confidence interval; EAF2: ELL-associated factor 2; CEA: Carcinoembryonic antigen; CA19-9: Carbohydrate antigen 19-9.