Copyright
©The Author(s) 2020.
World J Gastrointest Oncol. May 15, 2020; 12(5): 535-548
Published online May 15, 2020. doi: 10.4251/wjgo.v12.i5.535
Published online May 15, 2020. doi: 10.4251/wjgo.v12.i5.535
Table 1 Epidemiological data of individuals with normal gastric mucosa (control group, chronic gastritis, and gastric cancer patients), n (%)
| Variables | Control, n = 381 | Chronic gastritis, n = 269 | Gastric cancer, n = 202 |
| Gender | |||
| Female | 205 (53.8) | 146 (54.3) | 50 (24.8) |
| Male | 176 (46.2) | 123 (45.7) | 152 (75.2) |
| Age in yr | |||
| mean ± SD | 51.26 ± 16.77 | 50.89 ± 23.03 | 66.26 ± 16.32 |
| Smoking | |||
| Yes | 79 (20.7) | 84 (31.2) | 142 (70.3) |
| No | 302 (79.3) | 185 (68.8) | 60 (29.7) |
| Drinking | |||
| Yes | 98 (25.7) | 115 (42.7) | 128 (63.3) |
| No | 281 (74.3) | 154 (57.3) | 74 (36.7) |
| Helicobacter pylori | |||
| Positive | 0 (0) | 122 (45.3) | 86 (42.6) |
| Negative | 381 (100) | 147 (54.7) | 116 (57.4) |
Table 2 Nucleotide primer sequences, PCR conditions, and minor allele frequency for polymorphisms TLR2 -196 to -174 ins/del (rs111200466) and TLR2 19216T/C (rs3804099)
| Genes | Location | MAF | Primers, 5’-3’ | Cycles | T° melting | Enzyme | Genotypes, bp |
| TLR2 -196 to -174 ins/del (rs111200466) | Chromosome 4:153684312-153684338 (intron variant) | 0.1952 (del) | F: CACGGAGGCAGCGAGAAA | 35 | 60 °C | - | ins/ins: 286 bp |
| R: CTGGGCCGTGCAAAGAAG | ins/del: 286 + 264 bp | ||||||
| del/del: 264 bp | |||||||
| TLR2 19216T/C (rs3804099) | Chromosome 4:153703504 (synonymous variant) | 0.4048(C) | F: TCCCTGGGCAGTCTTGAACATTTAG | 30 | 65 °C | TaiI | TT: 415 bp |
| TC: 415 + 109 + 306 bp | |||||||
| R: TGTCCAAATCAGTATCTCGCAGTTCC | CC: 306 + 109 bp |
Table 3 Genotype frequencies of TLR2 -196 to -174 ins/del and TLR2 19216 T/C polymorphisms in both case and control groups (GC vs C, CG vs C and GC vs CG) , n (%)
| Polymorphisms | Models | Genotypes | C, n = 381 | Case | |||||||
| GC | CG | GC x CG | |||||||||
| n = 202 | OR (95%CI) | P value | n = 269 | OR (95%CI) | P value | OR (95%CI) | P value | ||||
| TLR2 -196 to -174 ins/del (rs111200466) | Codomi-nant | ins/ins | 316 (82.9) | 112 (55.5) | 1.00 | < 0.0001 | 212 (78.8) | 1.00 | 0.4100 | 1.00 | < 0.0001 |
| ins/del | 60 (15.8) | 79 (39.1) | 3.70 (2.41-5.70) | 53 (19.7) | 1.32 (0.88-1.98) | 2.68 (1.71-4.20) | |||||
| del/del | 5 (1.3) | 11 (5.5) | 5.73 (1.80-18.21) | 4 (1.5) | 1.19 (0.32-4.49) | 5.06 (1.45-17.70) | |||||
| Dominant | ins/ins | 316 (82.9) | 112 (55.5) | 1.00 | < 0.0001 | 212 (78.8) | 1.00 | 0.1900 | 1.00 | < 0.0001 | |
| ins/del | 65 (17.1) | 90 (44.5) | 3.87 (2.55-5.86) | 57 (21.2) | 1.31 (0.88-1.94) | 2.84 (1.84-4.39) | |||||
| del/del | |||||||||||
| Recessive | ins/ins | 376 (98.7) | 191 (94.5) | 1.00 | 0.0130 | 265 (98.5) | 1.00 | 0.8500 | 1.00 | 0.0260 | |
| ins/del | |||||||||||
| del/del | 5 (1.3) | 11 (5.5) | 4.00 (1.27-12.62) | 4 (1.5) | 1.13 (0.30-4.26) | 3.77 (1.08-13.12) | |||||
| Overdo-minant | ins/ins | 321 (84.2) | 123 (60.9) | 1.00 | < 0.0001 | 216 (80.3) | 1.00 | 0.1900 | 1.00 | < 0.0001 | |
| del/del | |||||||||||
| ins/del | 60 (15.8) | 79 (39.1) | 3.44 (2.24-5.27) | 53 (19.7) | 1.31 (0.87-1.97) | 2.49 (1.59-3.88) | |||||
| Log-additive | --- | --- | --- | 3.23 (2.23-4.69) | < 0.0001 | --- | 1.25 (0.88-1.79) | 0.2200 | 2.54 (1.72-3.74) | < 0.0001 | |
| TLR2 19216T/C (rs3804099) | Codomi-nant | T/T | 157 (41.2) | 101 (50.0) | 1.00 | 0.0920 | 131 (48.7) | 1.00 | 0.1600 | 1.00 | 0.8900 |
| T/C | 175 (45.9) | 83 (41.1) | 0.72 (0.49-1.06) | 106 (39.4) | 0.73 (0.52-1.01) | 0.95 (0.63-1.44) | |||||
| C/C | 49 (12.9) | 18 (8.9) | 0.56 (0.30-1.05) | 32 (11.9) | 0.78 (0.47-1.29) | 0.85 (0.43-1.69) | |||||
| Dominant | T/T | 157 (41.2) | 101 (50.0) | 1.00 | 0.0420 | 131 (48.7) | 1.00 | 0.0580 | 1.00 | 0.7100 | |
| T/T | 224 (58.8) | 101 (50.0) | 0.68 (0.45-0.99) | 138 (51.3) | 0.74 (0.54-1.01) | 0.93 (0.63-1.38) | |||||
| T/C | |||||||||||
| Recessive | T/T | 332 (87.1) | 184 (91.1) | 1.00 | 0.1600 | 237 (88.1) | 1.00 | 0.7100 | 1.00 | 0.6800 | |
| T/C | |||||||||||
| C/C | 49 (12.9) | 18 (8.9) | 0.65 (0.36-1.19) | 32 (11.9) | 0.91 (0.57-1.47) | 0.87 (0.45-1.68) | |||||
| Overdo-minant | T/T | 206 (54.1) | 119 (58.9) | 1.00 | 0.2500 | 163 (60.6) | 1.00 | 0.0970 | 1.00 | 0.9000 | |
| C/C | |||||||||||
| T/C | 175 (45.9) | 83 (41.1) | 0.81 (0.56-1.17) | 106 (39.4) | 0.77 (0.56-1.05) | 0.98 (0.65-1.46) | |||||
| Log-additive | --- | --- | --- | 0.74 (0.56-0.97) | 0.0300 | --- | 0.83 (0.66-1.05) | 0.1200 | 0.93 (0.69-1.26) | 0.6400 | |
Table 4 Genotype frequencies of TLR2 -196 to -174 ins/del and TLR2 19216T/C polymorphisms in Helicobacter pylori-positive and Helicobacter pylori-negative groups, n (%)
| Polymorphisms | Models | Genotypes/ alleles | Case | |||
| H. pylori-positive, n = 619 | H. pylori-negative, n = 233 | OR (95%CI) | P value | |||
| TLR2 -196 to -174 ins/del (rs111200466) | Codominant | ins/ins | 481 (77.7) | 159 (68.2) | 1.00 | 0.0120 |
| ins/del | 127 (20.5) | 65 (27.9) | 1.55 (1.09-2.19) | |||
| del/del | 11 (1.8) | 9 (3.9) | 2.48 (1.01-6.08) | |||
| Dominant | ins/ins | 481 (77.7) | 159 (68.2) | 1.00 | 0.0051 | |
| ins/del | 138 (22.3) | 74 (31.8) | 1.62 (1.16-2.27) | |||
| del/del | ||||||
| Recessive | ins/ins | 608 (98.2) | 224 (96.1) | 1.00 | 0.0880 | |
| ins/del | ||||||
| del/del | 11 (1.8) | 9 (3.9) | 2.22 (0.91-5.43) | |||
| Overdo-minant | ins/ins | 492 (79.5) | 168 (72.1) | 1.00 | 0.0240 | |
| del/del | ||||||
| ins/del | 127 (20.5) | 65 (27.9) | 1.50 (1.06-2.12) | |||
| Log-additive | --- | --- | --- | 1.56 (1.17-2.08) | 0.0030 | |
| TLR2 19216T/C (rs3804099) | Codominant | T/T | 261 (42.2) | 128 (54.9) | 1.00 | 0.0039 |
| T/C | 281 (45.4) | 83 (35.6) | 0.60 (0.44-0.83) | |||
| C/C | 77 (12.4) | 22 (9.4) | 0.58 (0.35-0.98) | |||
| Dominant | T/T | 261 (42.2) | 128 (54.9) | 1.00 | < 0.0001 | |
| T/C – C/C | 358 (57.8) | 105 (45.1) | 0.60 (0.44-0.81) | |||
| Recessive | T/T – T/C | 542 (87.6) | 211 (90.6) | 1.00 | 0.2200 | |
| C/C | 77 (12.4) | 22 (9.4) | 0.73 (0.45-1.21) | |||
| Overdo-minant | T/T – C/C | 338 (54.6) | 150 (64.4) | 1.00 | 0.0097 | |
| T/C | 281 (45.4) | 83 (35.6) | 0.67 (0.49-0.91) | |||
| Log-additive | --- | --- | --- | 0.70 (0.55-0.88) | 0.0021 | |
Table 5 TLR2 gene expression level groups to assess influence of polymorphic genotypes in gastric cancer and chronic gastritis
- Citation: Lourenço CM, Susi MD, Nascimento MCAD, Serafim Junior V, Vila APS, Rodrigues-Flemming GH, Goloni-Bertollo EM, Silva AE, Oliveira-Cucolo JG. Characterization and strong risk association of TLR2 del -196 to -174 polymorphism and Helicobacter pylori and their influence on mRNA expression in gastric cancer. World J Gastrointest Oncol 2020; 12(5): 535-548
- URL: https://www.wjgnet.com/1948-5204/full/v12/i5/535.htm
- DOI: https://dx.doi.org/10.4251/wjgo.v12.i5.535
