Activation of interleukin-33/suppression of tumorigenicity 2 signaling contributes to gallbladder carcinoma-induced chronic pain

Abstract

BACKGROUND

Patients with gallbladder carcinoma (GBC) often report abdominal pain, which is particularly severe, difficult to treat, and insufficiently relieved. Interleukin-33 (IL-33)/suppression of tumorigenicity 2 (ST2) signaling plays a role in cancer and pain, but its role in GBC-induced chronic pain is still unknown.

AIM

To investigate the potential effects of IL-33/ST2 signaling on GBC-induced cancer pain.

METHODS

To establish a GBC-induced chronic pain model, the GBC cell line GBC-SD was implanted into the gallbladder of nude mice. Pain-related behavior was determined by evaluating withdrawal behavior in response to mechanical stimuation. Serum samples from patients were analyzed via enzyme-linked immunolsorbent assay. Spinal cord samples from the rodents were subjected to enzyme-linked immunosorbent assay, western blotting and quantitative real-time polymerase chain reaction.

RESULTS

Nude mice with GBC-induced chronic pain presented significant spontaneous visceral pain-related behavior and abdominal hypersensitivity to mechanical stimuli. We demonstrated a significant increase in IL-33 levels in patient serum and in the spinal cords of GBC-induced chronic pain model mice. IL-33/ST2 signaling activation in the spinal cord may promote GBC-induced chronic pain. Remarkable activation of astrocytes and microglia as well as increased levels of proinflammatory cytokines was observed in the spinal cords of the mice. A significant decrease in the activation of astrocytes and microglia and the levels proinflammatory cytokines was observed following the blockade of IL-33/ST2 signaling.

CONCLUSION

Blockade of spinal IL-33/ST2 signaling results in a significant reduction in GBC-induced pain-related behaviors. This study suggested that targeting IL-33/ST2 signaling may relieve chronic cancer pain due to GBC.

Key Words: Interleukin-33; Gallbladder carcinoma; Chronic cancer-related pain; Spinal cord; Proinflammatory cytokines

Core Tip: This study revealed the role of spinal interleukin-33 (IL-33)/suppression of tumorigenicity 2 (ST2) signaling in the pathogenesis of gallbladder carcinoma (GBC)-induced chronic pain. IL-33/ST2 activation is critical for the genesis and maintenance of GBC-induced chronic pain. Blockade of IL-33/ST2 signaling in the spinal cord results in a significant reduction in pain-related behaviors as well as the proinflammatory cytokine levels in rodents with GBC-induced chronic pain. This study suggested that targeting IL-33/ST2 signaling may relieve chronic cancer pain due to gallbladder carcinoma.

INTRODUCTION

Gallbladder carcinoma (GBC) is the most common type of abdominal cancer, accounting for approximately two-thirds of all biliary tract malignancies. Surgery is the only potentially curative treatment for GBC[1]. Because of the special anatomical location of the gallbladder, as well as the insidious and nonspecific symptoms of GBC, most patients at diagnosis are at an advanced stage, and approximately 75% of them have lost the chance of surgery[1,2]. Moreover, the prognosis of GBC remains unsatisfactory because, after surgery, GBC may recur in approximately 60%-70% of patients, and the 5-year survival rate is only approximately 5%-15%[1-4]. Indeed, chronic pain is a common symptom of GBC, affecting up to 80% of people with this condition[5,6]. Most patients with GBC report abdominal pain[5-7]. As the disease progresses, many patients report chronic excruciating abdominal pain[6]. The specific molecular mechanisms that underlie the pathogenesis of GBC-induced cancer pain remain elusive, and clinical approaches for treatment are limited.

Emerging evidence indicates that interleukin (IL)-33, which belongs to the IL-1 cytokine family, binds to the specific receptor suppression of tumorigenicity 2 (ST2) and contributes to peripheral/central sensitization, resulting in the modulation of various chronic pain disorders[8], including neuropathic pain[9], bone cancer pain[10], joint pain[11,12] and muscle pain[13]. IL-33 is critical for eliciting mechanical allodynia[14,15] and cold allodynia[9]. Blocking IL-33/ST2 signaling has been demonstrated to be useful in treating chronic pain[9,11-13,16]. However, no studies have examined the possible effects of IL-33/ST2 signaling on GBC-induced cancer pain.

The increase in spinal inflammation is sufficient for both the induction and maintenance of chronic pain conditions, such as neuropathic pain[17], inflammatory pain[18], postoperative pain[19], and rheumatoid arthritis[20], as it damages neurons and enhances neuronal hyperactivity, resulting in central sensitization and increased pain sensitivity[21,22]. Proinflammatory cytokines can contribute to central sensitization and chronic pain through the N-methyl-D-aspartic acid receptor (NMDAR). IL-33 and its receptor ST2 have also been reported to play vital roles in many inflammatory conditions[23]. The activation of IL-33/ST2 signaling can trigger a downstream inflammatory cascade that is important for central sensitization, leading to chronic pain. The inhibition of inflammatory mediators can significantly reduce pain-related behavioral and neurochemical signs, which is beneficial for pain therapy[18,24]. Blocking IL-33/ST2 signaling can reduce the high expression of proinflammatory cytokines and play specific anti-inflammatory roles in diabetes[25], cystic fibrosis[26], chronic pulmonary obstructive disease[23,27], asthma[28], atopic dermatitis[29], and gout pain[12]. In the present study, we aimed to explore the potential effects of IL-33/ST2 signaling on pain symptoms in GBC-induced cancer pain. Given the importance of inflammation in the induction and persistence of chronic pain, we hypothesized that IL-33/ST2 signaling may interfere with inflammation and contribute to GBC-induced cancer pain.

In the present study, we used an orthotopic xenograft nude mouse model of GBC to establish a GBC-induced cancer pain model and showed that the activation of IL-33/ST2 signaling in the spinal cord is critical for GBC-induced cancer pain. Blockade of the IL-33/ST2 signaling pathway in the spinal cord can strongly relieve pain symptoms in rodents with GBC-induced cancer pain.

MATERIALS AND METHODS

Clinical samples

Serum was obtained from patients with GBC hospitalized at the Second Affiliated Hospital of Nanjing Medical University between 2020 and 2022. Additionally, serum samples obtained from healthy individuals at the Second Affiliated Hospital of Nanjing Medical University between 2020 and 2022 were included as controls. Written consent was obtained from all individuals. Participants with any of the following conditions or characteristics are excluded: (1) Patients with other chronic pain conditions; (2) Are ongoing or active infection; (3) Have any history of radiation/chemotherapy; and (4) Have other types of malignant tumors, or important organ dysfunction, such as hepatic/renal insufficiency and so on.

Animals

Adult male BALB/C nu/nu mice (8-10 weeks old, weighing 20-25 g) were obtained from Nanjing Medical University. All the animals were given free access to food and water and were housed in cages with a constant temperature of 22-25 °C and a humidity of 50% ± 10% and under a 12 hours light/dark cycle. All the experimental procedures were performed in accordance with the guidelines for laboratory animal care.

Cell culture

The human gallbladder cancer cell line GBC-SD, purchased from cell banks of the Chinese Academy of Sciences, was maintained in Roswell Park Memorial Institute 1640 medium (Gibco, NY, United States) supplemented with 10% foetal bovine serum (Gibco, NY, United States) and 1% penicillin/streptomycin (Thermo, MA, United States). The cell line was incubated at 37 °C in a humidified atmosphere with 5% CO₂ according to the instructions.

Animal models of GBC

An orthotopic xenograft nude mouse model of gallbladder cancer was established in accordance with published protocols[30]. Briefly, the animals were anaesthetized with continuous inhalation of isoflurane (2%, v/v). After conventional iodine complexing was used for disinfection, the skin was disinfected, and the gallbladder was exposed. The gallbladder was punctured through a modified insulin syringe. GBC-SD cells were suspended in saline. After the gallbladder bile was removed, 30 μL of a cell suspension with a cell density of 3 × 10⁸ cells/mL mixed with Matrigel (v/v, 1/1) was slowly injected into the empty gallbladders of nude mice. When the cell suspension solidified, the needle was withdrawn from the gallbladder. The gallbladder and liver were repositioned within the abdominal cavity, followed by surgical closure of the abdominal wall. Animals in the control group were injected with an equivalent volume of saline/Matrigel (v/v, 1/1) alone.

Behavioral experiments

Von Frey filaments were used to quantify the hypersensitivity of the epigastric region to mechanical stimulation by counting the number of withdrawal behaviors in response to mechanical stimuli to the abdomen[31-33]. The animals were habituated to the testing environment and allowed 30 minutes before testing. The observer was blinded to the experimental conditions. The observer was completely unaware of group allocation. The mechanical threshold of the animals was tested for three days before surgery, and the average value was used as the baseline threshold. Each region was tested for 3-5 times with at least 3 minutes intervals between each testing. Nociceptive behavior was scored as follows[33]. Score 0: No response; score 1: Immediate slight attempt to escape, light licking or scratching of the stimulated site; score 2: Intense withdrawal of the abdomen or jumping.

Hunching behavior was evaluated as previously described[33,34]. In brief, the animals were individually placed in the center of an open field arena and observed for 180 seconds. The observer was blinded to the experimental conditions. The observer was completely unaware of group allocation. The total time (seconds) the animal exhibited hunching behavior multiplied by the scoring factor was used as the hunching score. The scoring factor was defined as follows[33]. Score 0: Normal coat luster, displaying exploratory behavior; score 1: Mild rounded-back posture, displaying slightly reduced exploratory behavior, normal coat luster; score 2: Severe rounded-back posture, displaying considerably reduced exploratory behavior, piloerection, and intermittent abdominal contractions.

Western blotting

The animals were anaesthetized with inhalation of isoflurane (5%, v/v), and the spinal cord segments were rapidly dissected. Protein from the spinal cord was extracted at 4 °C. The bicinchoninic acid method (Beyotime Biotechnology, Shanghai, China) was used to estimate protein concentrations. The total protein from different samples was separated by sodium-dodecyl sulfate gel electrophoresis, and the blots containing the target protein were cut on a gel and then transferred to a polyvinylidene fluoride membrane. After the membrane was immersed in bovine serum albumin, primary antibodies were used to detect the target proteins. The following primary antibodies were used: Anti-glial fibrillary acidic protein (anti-GFAP, 1:1000), anti-ionized calcium-binding adaptor molecule 1 (anti-IBA1, 1:1000), anti-p-protein kinase C (anti-p-PKC, 1:800), anti-p-N-methyl-D-aspartate receptor subunit 1 (anti-p-NR1, 1:800), and anti-glyceraldehyde-3-phosphate dehydrogenase (1:1000). The membranes were subsequently incubated with horseradish peroxidase-conjugated secondary antibodies. The relative expression abundance was analyzed with ImageJ software.

Enzyme-linked immunosorbent assay

The protein levels of IL-33 and proinflammatory cytokines, including IL-1β, IL-6, monocyte chemoattractant protein 1 (MCP-1), and tumour necrosis factor (TNF)-α, were measured using enzyme-linked immunosorbent assay kits (Sigma, MO, United States, for IL-33; Neubioscience Biological Technology Co., Shenzhen, China, for proinflammatory cytokines) as described in the instructions. Briefly, the tissues were lysed and centrifuged for 15 minutes at 12000 rpm at 4 °C, after which the supernatant was transferred to new tubes. The concentrations of IL-33 and proinflammatory cytokines in the samples were calculated using standard curves according to the instructions.

Quantitative real-time polymerase chain reaction

Total RNA was extracted with TRIzol reagent (Takara, Shiga, Japan) and reverse transcribed to synthesize complementary DNA with a PrimeScript PT reagent kit (Vazyme, Nanjing, China). Quantitative real-time polymerase chain reactions were performed with the SYBR Green Kit (Vazyme, Nanjing, China). Differential expression was calculated according to the 2^-ΔΔCT method and statistically evaluated. The primers used are as Table 1.

Table 1 The primers used.

	Primers
IL-33	Forward primer: CAATGTTGACGACTCTGGAAAAG
	Reverse primer: GGGACTCATGTTCACCATCAG
MCP-1	Forward primer: CTTCTGGGCCTGCTGTTCA
	Reverse primer: CAGCCTACTCATTGGGATCA
IL-1β	Forward primer: GTGTGGATCCCAAGCAATAC
	Reverse primer: GTCTGCTCATTCACGAAAAG
TNF-α	Forward primer: CTGAGTTCTGCAAAGGGAGAG
	Reverse primer: CCTCAGGGAAGAATCTGGAAAG
IL-6	Forward primer: CCCTACTTCACAAGTCCGGAGAGGAGA
	Reverse primer: GGTAGCATCCATCATTTCTTTGTATCTCT
GAPDH	Forward primer: AGGTCGGTGTGAACGGATTTG
	Reverse primer: TGTAGACCATGTAGTTGAGGTCA

IL: Interleukin; MCP-1: Monocyte chemoattractant protein 1; TNF: Tumour necrosis factor; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase.

Statistical analysis

Prism (GraphPad) 9.0 was used for all the statistical analyses. The results are expressed as the mean ± SEM. Statistical analysis was carried out using the independent-samples t test or one-way ANOVA, with P < 0.05 considered to indicate a statistically significant difference.

RESULTS

IL-33 levels are increased in the serum of patients with GBC-induced chronic pain

To test the hypothesis that IL-33 is involved in GBC-induced chronic pain, we examined the protein level of IL-33 in the serum of patients with GBC. As shown in Figure 1A, the level of IL-33 was greatly increased in patients with GBC with pain (P < 0.01) but not in patients with GBC without pain (P > 0.05, the baseline characteristics shown in Supplementary Table 1). Animals with GBC in situ presented significant painful syndrome manifested as abdominal mechanical hypersensitivity and spontaneous visceral pain-related behavior (P < 0.01, Figure 1B and C). Consistent with previous results, the level of IL-33 in the serum of the model mice was significantly increased (P < 0.01, Figure 1D). Moreover, the mRNA and protein levels of IL-33 in the spinal cord were markedly increased compared with those in the control group (P < 0.01, Figure 1E and F).

Figure 1 Levels of interleukin-33 in gallbladder carcinoma-induced chronic pain. A: Enzyme-linked immunosorbent assay (ELISA) showing the level of interleukin (IL)-33 in the serum of gallbladder carcinoma (GBC) patients with pain; B: Haematoxylin and eosin staining of the gallbladders of nude mice; C: Animals with gallbladder carcinoma in situ presented numerous pain-related behaviors such as hypersensitivity of the abdomen to mechanical stimulation and spontaneous visceral pain-related behavior; D: ELISA showing the level of IL-33 in the serum of patients with GBC-induced chronic pain; E and F: ELISA and real-time polymerase chain reaction analysis of IL-33 levels in the spinal cords of model animals with GBC-induced chronic pain. Six samples were included in each of the groups (A, D, E, and F). Twelve mice were included in each of the groups (C). Two-way ANOVA. ^bP < 0.01 vs gallbladder carcinoma patients without pain (A) or 0 day (C-F). IL-33: Interleukin-33; GBC: Gallbladder carcinoma.

Blockade of IL-33/ST2 signaling attenuates the persistence and induction of GBC-induced chronic cancer pain

Given that the expression of IL-33 is markedly increased in the spinal cords of rodents with GBC-induced chronic cancer pain, we examined whether inhibition of IL-33/ST2 signaling in the spinal cord could suppress GBC-induced chronic cancer pain, which manifests as abdominal mechanical hypersensitivity and spontaneous visceral pain-related behavior. The results showed that intrathecal (i.t.) treatment with an ST2-neutralizing antibody (300 ng) on day 50 after the operation significantly inhibited established abdominal mechanical hypersensitivity and spontaneous visceral pain-related behavior. Following the administration of an anti-ST2 antibody, the inhibitory effects started within 0.5 hours and lasted for approximately 4 hours (P < 0.01, Figure 2A and B). Repetitive administration of the anti-ST2 antibody (300 ng, i.t.) on postoperative days 50, 51, and 52 alleviated the abdominal mechanical hypersensitivity and mitigated spontaneous visceral pain-related behavior (P < 0.01, Figure 2C and D).

Figure 2 The intrathecal administration of an interleukin-33/suppression of tumorigenicity 2 signaling blocking agent suppressed gallbladder carcinoma-induced chronic pain in nude mice. A and B: A single dose of an anti-suppression of tumorigenicity 2 (anti-ST2) antibody (300 ng) administered 50 days after the operation significantly inhibited the established hypersensitivity of the abdomen to mechanical stimulation and spontaneous visceral pain-related behavior; C and D: Repetitive administration of the anti-ST2 antibody (300 ng, daily for three consecutive days) at postoperative days 50, 51, and 52 abrogated the established hypersensitivity of the abdomen to mechanical stimulation and spontaneous visceral pain-related behavior; E and F: Repetitive administration of the anti-ST2 antibody (300 ng, daily for three consecutive days) at 22, 23 and 24 days after the operation abrogated the hypersensitivity of the abdomen to mechanical stimulation and spontaneous visceral pain-related behavior. Twelve mice were included in each of the groups. Drug administration is indicated by the arrow(s) on the corresponding day. Two-way ANOVA. ^bP < 0.01 vs control, ^cP < 0.05 vs control, and ^dP < 0.01 vs model + saline. ST2: Suppression of tumorigenicity 2.

To further test whether blocking IL-33/ST2 signaling affects the induction of GBC-induced chronic cancer pain, the animals were administered an anti-ST2 antibody during the phase after surgery when chronic cancer pain had not developed well. The results indicated that repeated daily administration of the ST2 antibody (300 ng, i.t.) for three consecutive days on days 22, 23 and 24 after the operation prevented the development of GBC-induced chronic cancer pain (P < 0.05, Figure 2E and F).

Activation of IL-33/ST2 signaling promotes the induction but not the persistence of GBC-induced chronic pain

To explore the putative role of IL-33 in GBC-induced chronic cancer pain, we investigated whether recombinant IL-33 (rIL-33) could promote the induction and development of GBC-induced mechanical allodynia. The results revealed that repeated i.t. administration of rIL-33 (90 ng) daily for three consecutive days at 22, 23, and 24 days after the operation promoted the induction of GBC-induced chronic cancer pain (P < 0.05, Figure 3A and B). Repetitive administration of rIL-33 (90 ng, i.t.) on postoperative days 50, 51, and 52 failed to decrease the withdrawal threshold in the models (P > 0.05, Figure 3C and D).

Figure 3 Intrathecal administration of an interleukin-33/suppression of tumorigenicity 2 signaling activator promoted the induction of gallbladder carcinoma-induced chronic pain in nude mice. A and B: Repetitive administration of recombinant interleukin-33 (90 ng, daily for three consecutive days) at 22, 23 and 24 days after the operation promoted hypersensitivity of the abdomen to mechanical stimulation and spontaneous visceral pain-related behavior; C and D: Repetitive administration of recombinant interleukin-33 (90 ng, daily for three consecutive days) at postoperative days 50, 51, and 52 did not exacerbate hypersensitivity of the abdomen to mechanical stimulation or promote spontaneous visceral pain-related behavior. Twelve mice were included in each of the groups. Drug administration is indicated by the arrow(s) on the corresponding day. Two-way ANOVA. ^bP < 0.01 vs control, ^cP < 0.05 vs control, and ^dP < 0.01 vs model + saline. rIL-33: Recombinant interleukin-33.

Blockade of IL-33/ST2 activation suppresses inflammation and reduced the phosphorylation level of the NMDAR-NR1 subunit in the spinal cords of animals with GBC-induced chronic pain

Accumulating evidence has demonstrated that inflammation in the spinal cord is a key mechanism that mediates central sensitization and nociceptive transmission, and it is also a potential treatment target for cancer pain as well as other forms of chronic pain. Blocking IL-33/ST2 signaling decreases inflammation in animals with chronic pain. Consistently, we found that the levels of proinflammatory cytokines, including IL-1β, IL-6, MCP-1, and TNF-α, were significantly increased in the spinal cords of animals with GBC-induced chronic cancer pain, whereas repeated administration of an anti-ST2 antibody (300 ng, i.t.) on postoperative days 50, 51, and 52 markedly reduced the RNA and protein expression of these cytokines (P < 0.01, Figure 4A and B).

Figure 4 Intrathecal administration of the anti-suppression of tumorigenicity 2 antibody suppresses glial cell activation, proinflammatory cytokine release and phosphorylation of the N-methyl-D-aspartate receptor subunit 1 and protein kinase C in the spinal cords of animals with gallbladder carcinoma-induced chronic pain. A and B: MRNA and protein levels of monocyte chemoattractant protein 1, tumour necrosis factor-α, interleukin (IL)-1β, and IL-6 in the spinal cords of model mice with gallbladder carcinoma-induced chronic pain; C: Western blot analysis showing the effects of repeated intrathecal injections of the anti-suppression of tumorigenicity 2 antibody (300 ng, daily for three consecutive days 50-52 days after the operation) on the expression of glial fibrillary acidic protein, ionized calcium-binding adaptor molecule 1, p-N-methyl-D-aspartate receptor subunit 1, and p-protein kinase C; D: Proposed mechanisms of action by which IL-33/suppression of tumorigenicity 2 signaling promotes gallbladder carcinoma-induced chronic pain. Tissues were collected on the 52^nd day, 2 hours after the last injection. Six spinal cord segments were included in each of the groups. One-way ANOVA. ^bP < 0.01 vs control, and ^dP < 0.01 vs model + saline. ST2: Suppression of tumorigenicity 2; MCP-1: Monocyte chemoattractant protein 1; TNF: Tumour necrosis factor; IL: Interleukin; GFAP: Glial fibrillary acidic protein; IBA1: Ionized calcium-binding adaptor molecule 1; NR1: N-methyl-D-aspartate receptor subunit 1; PKC: Protein kinase C; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; NMDAR: N-methyl-D-aspartic acid receptor.

Spinal cord astrocytes and microglia have been shown to be markedly activated in chronic cancer pain, as well as in other forms of chronic pain. Both spinal cord astrocytes (GFAP) and microglia (IBA1) are significantly activated during GBC-induced chronic cancer pain. Repetitive spinal administration of the IL-33/ST2 signaling blocker anti-ST2 antibody (300 ng) daily for three consecutive days on postoperative days 50, 51, and 52 significantly inhibited the increased expression of GFAP and IBA1 (Figure 4C). Moreover, the activation of the NMDAR and its modulator PKC in the spinal cord plays a critical role in the development of chronic pain. Our results demonstrated that blocking IL-33/ST2 signaling effectively decreased the phosphorylation of the NR1 and PKC in the spinal cords of the model animals (Figure 4C).

DISCUSSION

This study revealed that IL-33/ST2 signaling in the spinal cord is critical for the induction and maintenance of GBC-induced chronic pain and provides a new understanding of the pathogenesis of GBC-induced chronic pain. GBC-induced chronic pain causes significant activation of IL-33/ST2 signaling in addition to increases in the levels of p-NR1, p-PKC, GFAP, IBA1 and proinflammatory cytokines, including IL-1β, IL-6, MCP-1, and TNF-α. Spinal administration of the anti-ST2 antibody, which blocks IL-33/ST2 signaling, inhibits the induction of GBC-induced chronic pain, as well as established abdominal hypersensitivity and spontaneous visceral pain-related behavior. Moreover, repetitive spinal administration of the anti-ST2 antibody (300 ng) daily for three consecutive days on postoperative days 50, 51, and 52 significantly suppressed the activation of the NMDAR and proinflammatory cytokines in the spinal cord. These findings support a new mechanism underlying the pathogenesis of GBC-induced chronic cancer pain (Figure 4D). This study suggested that IL-33/ST2 signaling may be a potential target for relieving GBC-induced chronic pain.

GBC-induced chronic pain is severe, intractable chronic cancer pain accompanying patients who suffer from GBC. The specific cellular and molecular mechanisms underlying the pathogenesis of GBC-induced chronic pain are complex and remain unclear. Thus, adequate treatment of GBC-induced cancer pain is an important means to maintain quality of life. The binding of IL-33 to ST2 initiates neuroinflammation and promotes neuron-glia crosstalk, which is important for the induction and maintenance of chronic pain[8,16,35,36], including gout-associated pain[11,12], inflammatory pain[37], and neuropathic pain induced by chronic constriction injury[38], spared nerve injury[15,39], and infraorbital nerve injury[14]. These studies provide strong evidence that IL-33/ST2 signaling acts as a key factor in chronic pain and may be an effective therapeutic target for the treatment of these painful conditions.

In this study, we developed a novel nude mouse model of abdominal pain caused by GBC. Rodents with GBC showed dramatic increases in nociceptive scores in response to abdominal mechanical stimulation and visceral pain-related behavior 4 weeks after the inoculation of tumour cells. Information from the periphery to the spinal cord contributes to chronic pain[22,24,40]. Our results revealed that IL-33 levels are high not only in the serum of patients with GBC-induced chronic pain but also in the spinal cords of rodents with GBC-induced chronic pain. Consistent with these data, the results of the present study indicate that IL-33/ST2 signaling is involved in the induction and maintenance of GBC-induced chronic cancer pain and that blocking IL-33/ST2 signaling activation can greatly reduce abdominal hypersensitivity and spontaneous visceral pain-related behavior in rodents with GBC-induced chronic cancer pain. Protein, signaling and ion channel functions may possess a threshold and, once sufficiently activated, cannot receive further stimuli or generate responses. Given that the protein expression of IL-33 is high in the spinal cords of GBC-induced chronic cancer pain model animals, the level of IL-33 may be too high to reduce pain. It is understandable that repetitive spinal administration of IL-33 on postoperative days 50, 51, and 52 failed to decrease the withdrawal threshold in the model mice. In addition, the spinal administration of IL-33 can promote GBC-induced chronic pain. These findings suggest that IL-33/ST2 signaling may be a new mechanism underlying the pathogenesis of GBC-induced chronic cancer pain and that IL-33/ST2 signaling may also be an effective pharmaceutical treatment target for GBC-induced chronic cancer pain.

The pathophysiology of chronic cancer-related pain is complex. Chronic pain caused by GBC is considered typical chronic cancer-related pain[41,42]; thus, it is not surprising that GBC-induced chronic pain shares certain common neural mechanisms that underlie other forms of chronic cancer-related pain, such as that caused by bone cancer. Inflammation plays an important role in chronic pain, including chronic cancer-related pain[10,40,43,44], chronic neuropathic pain[17,45,46] and inflammatory pain[47,48]. The upregulation of inflammatory mediators is important in the genesis and maintenance of chronic cancer-related pain and other painful conditions[49-53], such as diabetic neuropathic pain. Furthermore, proinflammatory cytokines can mediate the activation of the NMDAR, which is essential for central sensitization, and induce the increased production of substance P, which acts as a neurotransmitter and neuromodulator, thereby contributing to the pathogenesis of nociceptive processes[54,55].

Activated IL-33/ST2 signaling mediates the transcriptional regulation of various cytokines[23,56,57], such as MCP-1, IL-1β, TNF-α and IL-6. To visually identify the changes in the expression of proinflammatory cytokines in the spinal cord related to pain in a nude mouse model of GBC-induced chronic pain, we observed changes in MCP-1, IL-1β, TNF-α, and IL-6 levels. In agreement with these reports, the present study revealed that the high expression of MCP-1, IL-1β, TNF-α and IL-6 in the spinal cord can be strongly suppressed by blocking Il-33/ST2 signaling activation in the spinal cord. Consistently, we found that the high expression of p-NR1 and p-PKC, which are essential for central sensitization, in the spinal cords of model mice was significantly reduced by blocking IL-33/ST2 signaling. These findings suggest that the activation of IL-33/ST2 signaling may be responsible for the production of proinflammatory cytokines and the activation of NMDARs, which cause central sensitization in the spinal cord and behavioral signs of GBC-induced chronic pain.

While our study provides evidence for the involvement of the IL-33/ST2 axis in GBC-associated pain, situating these findings within the broader landscape of cancer pain research reveals both shared mechanisms and potential disease-specific nuances. In models of bone cancer pain, IL-33/ST2 signaling has been consistently implicated in driving spinal glial activation and central sensitization, a finding that aligns with our observations in the GBC-induced chronic pain model[10,36]. However, the functional outcomes of this pathway may be critically shaped by the unique tumor microenvironment. The anatomical peculiarities of GBC, including its proximity to the liver hilum, rich innervation, and propensity for perineural and locoregional invasion, likely foster a distinct pathophysiological milieu. Unlike the confined marrow space in bone metastasis or the retroperitoneal location of pancreatic cancer, GBC often induces pain through direct biliary obstruction, local inflammatory infiltration, and invasion into adjacent hepatic tissue and the parietal peritoneum. We hypothesize that these conditions may alter the predominant cellular sources of IL-33 (e.g., favoring activated biliary epithelial cells, infiltrating immune cells, or damaged hepatocytes) and the pattern of downstream cytokine release compared to other cancer types. Consequently, while the IL-33/ST2 axis is a common player in cancer-related nociception, its relative contribution, cellular targets, and functional interplay in GBC pain may have unique features. This cautions against overgeneralization and underscores the need for context-specific investigation. It should be noted that our findings were derived from an immunodeficient nude mouse model, whereas patients with gallbladder cancer are immunocompetent.

IL-33/ST2 can induce group 2 innate lymphoid cells responses and T helper 2 cell responses[58]. In the tumor draining lymph node, IL-33 can activate T regulatory cells, while tumor debris phagocytosis by medullary sinus macrophages induces the cytokine IL-33, and blocking ST2 or deletion of IL-33 in medullary sinus macrophages can enhance therapy responses[59]. Given the immunomodulatory functions of IL-33, its role in pain modulation may differ depending on immune status, a discrepancy that warrants consideration when translating these preclinical results. Furthermore, the present study did not investigate potential crosstalk between the IL-33/ST2 axis and other established pain-related pathways (e.g., mitogen-activated protein kinase, nuclear factor-κB), suggesting that the complete mechanistic network remains to be elucidated.

Our findings suggest that intrathecal administration of an ST2 antibody can attenuate pain in a preclinical model of gallbladder cancer. However, several substantial limitations must be acknowledged regarding its direct clinical translatability. The primary concern involves the route of administration: Repeated intrathecal injections are highly invasive, associated with risks such as infection and neural injury, and may be impractical for long-term management of chronic cancer pain. Furthermore, systemic inhibition of the IL33/ST2 pathway could entail potential adverse effects, including immunosuppression, given the integral role of this axis in immune homeostasis and host defense. The need for frequent dosing to sustain analgesic effects also poses a notable clinical challenge. To address these translational barriers, several cautious yet promising directions for future research may be considered. First, the utility of serum IL33 as a non-invasive biomarker requires further systematic validation; subsequent studies should evaluate its specificity and sensitivity in relation to pain intensity and disease progression in clinical GBC cohorts. Second, to circumvent the limitations of invasive antibody-based approaches, the development of orally available small-molecule inhibitors targeting the IL33/ST2 interaction could represent a viable therapeutic strategy, potentially improving patient adherence and clinical feasibility. Astegolimab is a fully human IgG2 monoclonal antibody targeting ST2, which has been shown to inhibit IL-33 signaling[60]. Several clinical trials targeting astegolimab are now underway. Finally, carefully designed early-phase pilot trials would be necessary to preliminarily assess the safety, tolerability, and initial efficacy of ST2targeting agents in selected patient populations. These proposed steps, while tentative, might contribute to bridging the gap between preclinical observation and potential clinical application in GBC-related pain management.

CONCLUSION

In summary, this study revealed the role of spinal IL-33/ST2 signaling in the pathogenesis of GBC-induced chronic pain. IL-33/ST2 activation is critical for the genesis and maintenance of GBC-induced chronic pain. Blockade of IL-33/ST2 signaling in the spinal cord results in a significant reduction in pain-related behaviors as well as the proinflammatory cytokine levels in rodents with GBC-induced chronic pain. This study suggested that targeting IL-33/ST2 signaling may relieve chronic cancer pain due to GBC.