Myc-associated zinc finger protein drives colorectal cancer metastasis through activating ubiquitin like with ring finger protein one

Abstract

BACKGROUND

Colorectal cancer (CRC) is one of the most common causes of cancer mortality worldwide. The transcription factor Myc-associated zinc finger protein (MAZ) has been implicated in cancer progression. However, its precise function and mechanisms in CRC remain unclear.

AIM

To investigate the role and mechanism of the MAZ/ubiquitin-like with PHD and RING finger domains 1 (UHRF1)/esophageal cancer-related gene 4 (ECRG4) axis in CRC metastasis.

METHODS

Western blot, quantitative reverse transcription polymerase chain reaction (PCR) and transwell were performed to evaluate the impact of MAZ knockdown on CRC cell migration and invasion. A xenograft tumor metastasis model was established by injecting MAZ-deficient CRC cells into nude mice to assess in vivo metastatic potential. Dual-luciferase reporter assay was performed to determine the role of MAZ and its downstream target, UHRF1. Chromatin immunoprecipitation-quantitative PCR and methylation-specific PCR were used to analyze whether UHRF1 regulated ECRG4 through DNA methylation.

RESULTS

MAZ was highly upregulated in CRC cells and promoted CRC migration, invasion, epithelial-mesenchymal transition (EMT) and metastasis. Mechanistically, MAZ transcriptionally activated UHRF1, which in turn led to DNA methylation of ECRG4. Knockdown of MAZ suppressed CRC migration and invasion was reversed by overexpression of UHRF1. Loss of UHRF1 upregulated ECRG4, inhibited EMT, and reduced cell migration and invasion. However, simultaneous knockdown of ECRG4 partially reversed these effects.

CONCLUSION

MAZ promotes CRC cell migration, invasion, and EMT by transcriptionally activating UHRF1, which downregulates ECRG4 through DNA methylation.

Key Words: Colorectal cancer metastasis; Myc-associated zinc finger protein; Ubiquitin-like with PHD and RING finger domains 1; Esophageal cancer-related gene 4; DNA methylation

Core Tip: This study elucidated the oncogenic role of Myc-associated zinc finger protein (MAZ) in colorectal cancer (CRC), demonstrating its ability to promote cancer cell migration, invasion, and epithelial-mesenchymal transition by modulating the ubiquitin-like with PHD and RING finger domains 1-esophageal cancer-related gene 4 signaling pathway. MAZ was up-regulated in CRC cell species, and inhibition of its expression significantly inhibited cell invasion, invasion, epithelial-mesenchymal transition and tumor metastasis. Dual-luciferase reporter assay, chromatin immunoprecipitation quantitative polymerase chain reaction and methylation-specific polymerase chain reaction further validated the interaction of the MAZ-ubiquitin-like with PHD and RING finger domains 1-esophageal cancer-related gene 4 axis, providing convincing evidence for MAZ as a potential therapeutic target for CRC.

INTRODUCTION

Globally, colorectal cancer (CRC) is a major cause of cancer mortality, largely due to metastasis, which leads to poor prognosis and treatment failure[1]. CRC metastasis is a multifaceted process regulated by various molecular pathways. Studies have shown that epithelial-mesenchymal transition (EMT) enables CRC cells to acquire stronger migratory and invasive abilities, helping cancer cells break through the primary tumor tissue and metastasize to other organs[2]. Although research on CRC has advanced, the poor prognosis associated with its metastasis and the underlying metastatic mechanisms remain incompletely elucidated. Therefore, further identification of key molecules influencing CRC metastasis and investigation of their molecular mechanisms are crucial for discovering new therapeutic targets, improving treatment efficacy, and enhancing patient prognosis.

Myc-associated zinc finger protein (MAZ), a transcription factor, has been recognized as a key regulator of gene expression in various cancers[3,4]. In normal physiological conditions, MAZ plays a role in maintaining cellular homeostasis[5,6]. Studies have demonstrated that MAZ facilitates thyroid cancer progression by orchestrating transcriptional reprogramming and promoting extracellular signal-regulated kinases 1 and 2 activation[7]. Emerging evidence suggests that MAZ contributes to cancer metastasis by modulating downstream targets[8], Meanwhile, studies have found that MAZ protein exhibits high levels in patients with ulcerative colitis and CRC, enhancing the acute inflammatory response in colitis and increasing the incidence of colitis-associated colorectal tumors[9]. However, the function and underlying mechanism of MAZ in CRC metastasis are remain unclear.

Ubiquitin-like with PHD and RING finger domains 1 (UHRF1), also referred to as ICBP90, is a multifunctional epigenetic regulator with a pivotal role in maintaining DNA methylation, chromatin remodeling, and gene expression[10]. Research indicates that UHRF1 levels are elevated in CRC tumor tissues, where it drives progression[11,12]. These functional domains, which recognize histones and hemimethylated DNA, are crucial for maintaining CRC-specific DNA methylation[13]. By using the National Center for Biotechnology Information, University of California Santa Cruz, and JASPAR databases, we found multiple MAZ binding sites on the UHRF1 promoter.

Esophageal cancer-related gene 4 (ECRG4) is a newly discovered tumor suppressor. Studies have shown that ECRG4 expression is reduced in CRC tissues and reduces the proliferation of CRC cell lines[14,15]. Genome-wide analysis has revealed hypermethylation of the ECRG4 promoter in CRC. Since DNA methylation is a primary cause of tumor suppressor gene silencing in cancer, this suggests that hypermethylation of ECRG4 may contribute to CRC tumor metastasis[16]. This study aimed to elucidate the mechanism by which MAZ regulates CRC metastasis. By integrating in vivo and in vitro models, we explored the role of MAZ in regulating CRC migration, invasion, and EMT. Mechanistically, our study affirmed the correlation between MAZ, UHRF1, and ECRG4. These findings provide new insights into the molecular mechanisms underlying CRC metastasis.

MATERIALS AND METHODS

Cell culture and cell transfection

We used the human normal colon epithelial cell line NCM460 and two CRC cell lines, HCT116 and SW480 (American Type Culture Collection, VA, United States). All cells were cultured at 37 °C in a 5% CO₂ environment using Dulbecco’s modified Eagle’s medium or RPMI-1640 medium supplemented with 10% fetal bovine serum (Gibco, NY, United States) and 1% penicillin-streptomycin. Cells were treated with drugs or transfected when they reached 80%-90% confluence. Cell transfection was performed using Lipofectamine 3000 reagent (Invitrogen, CA, United States). Transfection was carried out with short hairpin (sh)-RNA RNA solution, and fresh medium was replaced 48 hours after transfection for subsequent experiments. Transfection efficiency was confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) and western blot.

qRT-PCR

Total RNA was extracted from HCT116 and SW480 cells or nude mouse tissues using TRIzol reagent (Thermo Fisher Scientific, MA, United States), and RNA concentration was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, MA, United States). RNA (1 μg) was reverse-transcribed to complementary DNA using the Reverse Transcription System (Thermo Fisher Scientific, MA, United States). qRT-PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, CA, United States) on a QuantStudio 3 real-time PCR system (Applied Biosystems, CA, United States). The total reaction volume was 20 μL, containing 10 μL SYBR Green mix, 1 μL complementary DNA template, 0.4 μM primers, and water. Glyceraldehyde-3-phosphate dehydrogenase was used as the internal control, and data were analyzed using the 2^-ΔΔCt) method. The sequences of the primers were shown in Table 1.

Table 1 The primers used in the present study.

Gene	Forward	Reverse
MAZ	TCTACCACCTGAACCGACAC	GAGCAGTTGTAGGGCTTGTG
UHRF1	AGGTCAATGAGTACGTCGATGC	TTCTCCGGGTAGTCGTCGT
ECRG4	ACTAAGACTAAAGTGGCCGTTG	AATTTCGCTTCGTCAAAGCCC
GAPDH	GAGTCAACGGATTTGGTCGT	GACAAGCTTCCCGTTCTCAG

MAZ: Myc-associated zinc finger protein; UHRF1: Ubiquitin-like with PHD and RING finger domains 1; ECRG4: Esophageal cancer-related gene 4; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.

Western blot

HCT116 and SW480 cells and lung tumors were lysed using radioimmunoprecipitation assay buffer (Beyotime, Shanghai, China) to extract total protein. Protein concentration was measured using the BCA Protein Assay Kit (Thermo Fisher Scientific, MA, United States). Equal amounts of protein were separated by sodium-dodecyl sulfate gel electrophoresis and transferred to a polyvinylidene difluoride membrane (Millipore, MA, United States). After blocking, the membrane was incubated overnight with primary antibodies, followed by horseradish-peroxidase-conjugated secondary antibodies (Cell Signaling Technology, MA, United States). Protein detection was performed using chemiluminescence (Thermo Fisher Scientific, MA, United States). MAZ (1:1000; 21068-1-AP) was from Proteintech (Wuhan, China), and UHRF1 (1:1000; #12387), E-cadherin (1:1000; #3195), N-cadherin (1:1000; #13116), vimentin (1:1000; #5741), Snail (1:1000; #3879), and glyceraldehyde-3-phosphate dehydrogenase (1:1000; #2118) were from Cell Signaling Technology, MA, United States. ECRG4 (1:1000; PA5-104506) was from Thermo Fisher Scientific, MA, United States. Data were analyzed using ImageJ software, and all experiments were repeated at least three times.

Transwell assay

Transfected HCT116 and SW480 cells were seeded into uncoated Transwell chambers (Corning, NY, United States) at 5 × 10⁴ cells/well, with 10% fetal bovine serum-containing medium in the lower chamber as a chemoattractant. After incubating for 24 hours, cells were fixed, and stained with crystal violet (Sigma-Aldrich, MO, United States). Cell migration was observed and the cells were counted under a light microscope (Olympus IX73, Japan). For invasion assays, Matrigel (Corning, NY, United States) was used to coat the Transwell chambers, and other steps were the same as those for the migration assay.

Dual-luciferase reporter assay

The 3’ untranslated region fragment of the UHRF1 gene was cloned into the pMIR-REPORT (Promega, WI, United States) reporter vector and cotransfected with the Renilla luciferase gene into HCT116 and SW480 cells. After 24 hours of transfection, luciferase activity was detected using a luciferase substrate (Promega, WI, United States) and measured with a GloMax Luminometer (Promega, WI, United States). Luciferase activity was determined based on the ratio of Firefly to Renilla luciferase activity, and results were analyzed using GraphPad Prism software.

Chromatin immunoprecipitation-quantitative polymerase chain reaction

HCT116 and SW480 cells were crosslinked with 1% formaldehyde and subsequently sonicated to fragment the DNA. DNA fragments were immunoprecipitated and analyzed by quantitative polymerase chain reaction (PCR). Specific antibodies were used for immunoprecipitation, and SYBR Green quantitative PCR was performed for DNA fragment quantification, with immunoglobulin G as a negative control (NC). Data were analyzed using the 2^-ΔΔCt method to compare the binding strength of transcription factors in different groups.

Methylation-specific PCR

Genomic DNA was extracted from HCT116 and SW480 cells, and methylation-specific or unmethylated-specific primers were used for PCR amplification. Amplified products were separated by agarose gel electrophoresis and stained with ethidium bromide (Sigma-Aldrich, MO, United States). The methylation status was determined by comparing the amplification results of different samples.

Animal experiment

Four-week-old female nude mice (SLACOM Company, Shanghai, China) were utilized to develop a tumor metastasis model (n = 6 per group). Stable MAZ knockdown HCT116 cells (10⁶/100 μL saline) were injected into the tail veins of mice to establish a tumor metastasis model. Two groups were formed from the mice: The sh-MAZ group (n = 6) and the sh-NC group (n = 6). The sh-MAZ group was injected via the tail vein with stable MAZ-knockdown HCT116 cells (10⁶/100 mL saline), while the sh-NC group was injected with an equal amount of HCT116 cells transfected with the control plasmid sh-NC. Mouse body weight was monitored regularly, and lung tumor growth and metastasis volume were measured. Six weeks after cell injection, the mice were killed for sample collection and further analysis, using CO₂ asphyxiation followed by cervical dislocation, ensuring minimal animal suffering and compliance with ethical guidelines.

Hematoxylin and eosin staining

Lung tumor specimens were extracted from nude mice, fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. Sections of 4 μm thickness were stained with hematoxylin and eosin (Solarbio, Beijing, China). Histological changes of tumors were observed and analyzed under a microscope (Leica DM2500, Germany).

Statistical analysis

All experimental data were analyzed using GraphPad Prism version 9.5. Between-group comparisons were performed using one-way ANOVA or t test, and data were expressed as mean ± SD. P < 0.05 was considered significant. For multiple group comparisons, Bonferroni or Dunnett’s post hoc test was used for further analysis.

RESULTS

MAZ is highly expressed in CRC cell lines and promotes cell migration, invasion, and EMT

MAZ is an essential transcriptional regulator controlling gene expression under normal physiological conditions but becomes abnormally activated in cancer[17]. To explore whether MAZ participates in the regulation of CRC progression, we conducted a series of experimental validations. Western blot and qRT-PCR (Figure 1A and B) showed that MAZ expression was significantly higher in HCT116 and SW480 cells. Therefore, sh-RNA was used to interfere with MAZ expression in CRC cell lines for further analysis. All three sh-RNAs significantly knocked down MAZ expression, with sh-MAZ-2 exhibiting the most pronounced effect (Figure 1C and D). Therefore, sh-MAZ-2 was selected for subsequent experiments. The transwell assay demonstrated that silencing of MAZ strongly inhibited CRC cell migration and invasion (Figure 1E and F, P < 0.05). To rule out the off-target effect of sh-RNA, we further knocked down MAZ using another two sh-RNAs, and evaluated the migration and invasion of CRC cells (Supplementary Figure 1). Sh-MAZ-1 and sh-MAZ-3 also significantly inhibited migration and invasion of CRC cells (P < 0.05). We assessed EMT-related protein expression in CRC cell lines using western blot. Silencing MAZ upregulated E-cadherin and downregulated N-cadherin, vimentin, and snail levels, indicating inhibition of EMT. These results suggest that MAZ is overexpressed in CRC cells, and facilitates cell migration, invasion, and EMT (Figure 1G).

Figure 1 Myc-associated zinc finger protein is highly expressed in colorectal cancer cell lines and promotes cell migration, invasion and epithelial-mesenchymal transition. A and B: Western blot and quantitative reverse transcription polymerase chain reaction showed the level of Myc-associated zinc finger protein (MAZ) in normal colonic epithelial cells (NCM460) and colorectal cancer (CRC) cell lines (HCT116 and SW480); C and D: Western blot demonstrated knockdown of MAZ expression in CRC cells using short hairpin-RNA (short hairpin-MAZ) targeting MAZ; E and F: Transwell assay images and quantification showed the migration and invasion of CRC cells after MAZ knockdown; G: Western blot showed protein expression of E-cadherin, N-cadherin, vimentin, and snail levels in CRC cells after MAZ knockdown. Data are presented as the mean ± SD. The dashes represent comparisons between groups. The experiments were repeated at least three times independently. MAZ: Myc-associated zinc finger protein; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; sh: Short hairpin; NC: Negative control. ^aP < 0.05, ^bP < 0.01, and ^cP < 0.0001.

MAZ promotes metastasis of CRC in vivo

To further investigate the impact of MAZ on CRC tumor metastasis, a xenograft tumor metastasis model was established by injecting sh-NC or sh-MAZ transfected CRC cells into the tail veins of nude mice. After 6 weeks, both groups of nude mice developed lung metastases, and MAZ knockdown significantly reduced metastatic tumor nodules compared to the sh-NC group (Figure 2A). Hematoxylin and eosin staining of lung tissues revealed that MAZ knockdown resulted in a significantly lower number of metastatic nodules (Figure 2B). MAZ mRNA level was significantly decreased in metastatic tumor nodules (Figure 2C). Regarding EMT, western blot demonstrated that MAZ knockdown led to increased E-cadherin expression and decreased levels of N-cadherin, vimentin, and snail, indicating suppression of EMT in metastatic nodules (Figure 2D). The results demonstrated that knockdown of MAZ inhibited CRC tumor metastasis.

Figure 2 Myc-associated zinc finger protein promotes colorectal cancer metastasis in vivo. A: Representative images of lung tissues from sh-negative control and sh-Myc-associated zinc finger protein (MAZ) groups showed the metastatic tumor burden (n = 6); B: Hematoxylin and eosin-stained lung tissue sections showed metastatic tumor nodules, with a quantification bar graph comparing the number of nodules in the sh-negative control and sh-MAZ groups, scale bar: 50 μm; C: Quantitative reverse transcription polymerase chain reaction analysis of MAZ mRNA levels in metastatic tumor nodules; D: Western blot of epithelial-mesenchymal transition markers (E-cadherin, N-cadherin, vimentin, and snail) in metastatic tumor nodules. Data are presented as mean ± SD. The dashes represent the comparisons between groups. The experiments were repeated at least three times independently. MAZ: Myc-associated zinc finger protein; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; sh: Short hairpin; NC: Negative control. ^bP < 0.01, and ^cP < 0.0001.

MAZ promotes ECRG4 DNA methylation through transcriptional activation of UHRF1

We investigated the downstream mechanisms by which MAZ promotes CRC metastasis. Western blot (Figure 3A) and qRT-PCR (Figure 3B) showed that UHRF1 expression was significantly reduced after knockdown of MAZ, while ECRG4 expression was increased, and ECRG4 expression was decreased after overexpression of UHRF1. MAZ directly bound to the UHRF1 promoter region to activate its transcription, which was confirmed by dual-luciferase reporter assays (Figure 3C). We established UHRF1-knockdown CRC cell lines (HCT116 and SW480) by sh-RNA. Western blot and qRT-PCR (Figure 3D and E) confirmed that all three sh-RNAs significantly downregulated UHRF1 expression, with sh-UHRF1-1 showing the most significant impact. As a result, sh-UHRF1-1 was chosen for further experiments. Moreover, chromatin immunoprecipitation-quantitative PCR assay (Figure 3F) demonstrated decreased enrichment of UHRF1 on the ECRG4 promoter after knockdown of UHRF1. Similarly, methylation-specific PCR results (Figure 3G) showed reduced methylation and increased unmethylation of the ECRG4 promoter after knockdown of UHRF1. These results indicated that in CRC cell lines, MAZ binds to the UHRF1 promoter and activates its transcription. Subsequently, UHRF1 promotes DNA methylation of ECRG4, leading to the downregulation of the tumor suppressor gene ECRG4.

Figure 3 Myc-associated zinc finger protein promotes esophageal cancer-related gene 4 DNA methylation via ubiquitin-like with PHD and RING finger domains 1 activation. A and B: Western blot and quantitative reverse transcription polymerase chain reaction (PCR) showed ubiquitin-like with PHD and RING finger domains 1 (UHRF1) and esophageal cancer-related gene 4 (ECRG4) level in colorectal cancer cell lines; C: Dual luciferase reporter assay showed binding of Myc-associated zinc finger protein to UHRF1 promoter; D and E: Western blot and quantitative reverse transcription PCR demonstrated UHRF1 knockdown efficiency and its effect on ECRG4 expression; F: Chromatin immunoprecipitation-quantitative PCR showed that UHRF1 was enriched at the ECRG4 promoter in colorectal cancer cells; G: Methylation-specific PCR showed methylation and unmethylation status of the ECRG4 promoter after UHRF1 knockdown. Data are presented as the mean ± SD. The dashes represent the comparisons between groups. The experiments were repeated at least three times independently. MAZ: Myc-associated zinc finger protein; UHRF1: Ubiquitin-like with PHD and RING finger domains 1; ECRG4: Esophageal cancer-related gene 4; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; sh: Short hairpin; NC: Negative control; oe: Overexpression. ^aP < 0.05, ^bP < 0.01, and ^cP < 0.0001.

MAZ promotes CRC migration, invasion, and EMT through UHRF1 activation

Further functional experiments were conducted to validate the impact of MAZ transcriptional activation of UHRF1 on CRC progression. Silencing MAZ greatly inhibited the migration and invasion of CRC cells; however, UHRF1 overexpression partially restored these effects (Figure 4A and B, P < 0.05). Similarly, UHRF1 overexpression also reversed the effect of sh-MAZ on EMT in CRC cells, with decreased E-cadherin expression and increased expression of N-cadherin, vimentin, and snail (Figure 4C). Our results indicated that in CRC cell lines, MAZ promotes cell migration, invasion, and EMT by transcriptionally activating UHRF1.

Figure 4 Myc-associated zinc finger protein promotes colorectal cancer migration, invasion, and epithelial-mesenchymal transition through ubiquitin-like with PHD and RING finger domains 1 activation. A and B: Transwell assay images and quantification of colorectal cancer cell migration in different groups: Short hairpin (sh)-negative control, sh-Myc-associated zinc finger protein (MAZ), sh-MAZ + overexpression-negative control, and sh-MAZ + overexpression-ubiquitin-like with PHD and RING finger domains 1; C: Western blot showed that protein expression of epithelial-mesenchymal transition markers (E-cadherin, N-cadherin, vimentin, and snail) in colorectal cancer cells. Data are presented as the mean ± SD. The dashes represent the comparisons between groups. The experiments were repeated at least three times independently. MAZ: Myc-associated zinc finger protein; UHRF1: Ubiquitin-like with PHD and RING finger domains 1; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; sh: Short hairpin; NC: Negative control; oe: Overexpression. ^bP < 0.01, and ^cP < 0.0001.

UHRF1 regulates CRC migration, invasion, and EMT by downregulating ECRG4 through DNA methylation

To further explore the impact of UHRF1 in regulating ECRG4 in promoting cell migration, invasion, and EMT in CRC cells, we constructed UHRF1-deficient and ECRG4-deficient CRC cells. Western blot and qRT-PCR (Figure 5A and B) showed that silencing UHRF1 significantly increased ECRG4 expression in CRC cells. Silencing UHRF1 inhibited CRC cell migration and invasion; however, simultaneous knockdown of ECRG4 partially restored these phenotypes (Figure 5C and D, P < 0.05). Western blot (Figure 5E) showed that UHRF1 knockdown increased E-cadherin expression and reduced N-cadherin, vimentin, and snail levels. Simultaneous silencing ECRG4 partially reversed these changes. These results showed that UHRF1 regulates CRC migration, invasion, and EMT by downregulating ECRG4 through DNA methylation in CRC cell lines.

Figure 5 Ubiquitin-like with PHD and RING finger domains 1 regulates colorectal cancer migration, invasion, and epithelial-mesenchymal transition by DNA methylation-mediated suppression of esophageal cancer-related gene 4. A and B: Western blot and quantitative reverse transcription polymerase chain reaction showed esophageal cancer-related gene 4 (ECRG4) level in colorectal cancer (CRC) cells after ubiquitin-like with PHD and RING finger domains 1 (UHRF1) knockdown or combined UHRF1 and ECRG4 knockdown; C and D: Transwell assay images and quantification showed the effects of UHRF1 knockdown and simultaneous knockdown of UHRF1 and ECRG4 on CRC cell migration; E: Western blot of E-cadherin, N-cadherin, vimentin, and snail in CRC cells under UHRF1 knockdown or combined UHRF1 and ECRG4 knockdown. Data are presented as the mean ± SD. The dashes represent the comparisons between groups. The experiments were repeated at least three times independently. ECRG4: Esophageal cancer-related gene 4; UHRF1: Ubiquitin-like with PHD and RING finger domains 1; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; sh: Short hairpin; NC: Negative control. ^aP < 0.05, ^bP < 0.01, and ^cP < 0.0001.

DISCUSSION

Our study found that MAZ was a crucial transcription factor involved in CRC metastasis. MAZ was upregulated in CRC cells and promoted migration, invasion, and EMT of CRC cells. Our findings provided new insights into the molecular mechanisms underlying CRC progression and suggest the MAZ/UHRF1/ECRG4 axis as a potential therapeutic target. As a transcription factor, MAZ has specific domains for DNA binding and protein-protein interactions[18]. In previous studies, it was found that high expression of MAZ was positively correlated with poor overall survival and bone-metastasis-free survival in prostate cancer patients without bone metastasis[19]. In thyroid cancer patients, those with high MAZ expression have shorter overall survival and disease-free survival[20]. MAZ expression is increased in hepatocellular carcinoma and is associated with distant metastasis[21]. Studies have demonstrated that MAZ drives prostate cancer bone metastasis by upregulating the Kirsten rat sarcoma 2 viral oncogene homolog (KRAS)-dependent Ral guanine nucleotide exchange factors pathway transcriptionally[22]. In addition, MAZ is overexpressed in thyroid cancer and transcriptionally activates TANK binding kinase 1. TANK binding kinase 1 can activate the phosphatidylinositol-3-kinase/protein kinase B/mammalian target of rapamycin signaling pathway, promoting the viability, proliferation, migration, and invasion of thyroid cancer cells[23]. MAZ binds to the promoter of Mitogen-activated protein kinase 2 (MAP2K2), increasing MAP2K2 transcription and thus upregulating its expression. MAP2K2 activates the extracellular signal-regulated kinase signaling pathway, promoting the progression of clear cell renal cell carcinoma. In recent years, studies have found that MAZ is expected to be a potential target for cancer treatment[24]. Our results demonstrated that MAZ expression is significantly upregulated in CRC cells. EMT is a complex and dynamic process, typically marked by the absence of cell polarity, reduced cell-cell adhesion, and enhanced cell migration and invasion capabilities[25,26]. In CRC, we observed that MAZ knockdown effectively reduced cell migration, invasion, and EMT, suggesting its critical role in metastasis.

UHRF1 is a well-known epigenetic regulator[27,28]. UHRF1 knockout selectively impairs growth and induces apoptosis in KRAS-mutant lung cancer cells[29]. Additionally, in lung cancer patients, high UHRF1 expression is negatively correlated with TSG expression and predicts a worse prognosis for patients with KRAS-mutant tumors. UHRF1 binds to Yes-associated protein 1 (YAP1) and inhibits the ubiquitination-mediated degradation of YAP1, thereby stabilizing the YAP1 protein in small cell lung carcinoma (SCLC) cells. Downregulation of UHRF1 enhances the sensitivity of SCLC cells to cisplatin and is associated with a favorable prognosis in SCLC patients receiving platinum-based chemotherapy[30]. Further studies have indicated that UHRF1 can recruit histone deacetylase 1 to the thioredoxin interacting protein (TXNIP) promoter and mediate the deacetylation of histone H3K9, thus inhibiting TXNIP expression. This reveals the mechanism by which UHRF1 promotes tumor progression through epigenetic regulation of TXNIP in renal cell carcinoma[31]. Through in silico analysis using National Center for Biotechnology Information, University of California Santa Cruz, and JASPAR databases, we identified multiple MAZ binding sites on the UHRF1 promoter. This was experimentally validated using dual-luciferase reporter assays, which confirmed that MAZ directly binds to and activates UHRF1 transcription. Our findings further establish UHRF1 as a key mediator of MAZ-driven oncogenic processes in CRC. The role of UHRF1 in maintaining cancer-specific DNA methylation is well established[32].

ECRG4, a newly identified tumor suppressor gene, has been reported to exhibit reduced expression in CRC tissues due to promoter hypermethylation[16,33]. Research findings indicate that ECRG4, as a tumor suppressor, promotes the expression of osteoglycin by upregulating nuclear factor 1 C-type. Nuclear factor 1 C-type can bind to the promoter region of osteoglycin and regulate its transcription[34]. ECRG4 likely inhibits the malignant phenotype of tongue cancer cells by suppressing the BC200 long non-coding RNA/matrix metalloproteinases signaling pathway[35]. Additionally, ECRG4 has been identified as a novel thrombin-processed monocyte chemoattractant that recruits myeloid cells, promotes their activation, and leads to the blockade of tumor progression[36]. Our study confirmed that ECRG4 expression was downregulated in CRC cells due to promoter hypermethylation, and this silencing was mediated by UHRF1. Functionally, restoring ECRG4 by sh-UHRF1 inhibits EMT, migration, and invasion, while ECRG4 knockdown partially reverses these phenotypes, directly linking ECRG4 loss to enhanced metastatic potential. The tumor-suppressive role of ECRG4 may extend beyond inhibiting EMT. Previous studies have suggested that ECRG4 modulates cell cycle progression and apoptosis in CRC, and in gastric cancer, it upregulates Kruppel-like factor 2 to suppress metastasis[33]. Whether ECRG4 exerts similar effects in CRC warrants further investigation. Additionally, this finding suggests that ECRG4 is inhibited at multiple levels in CRC; both at the epigenetic and post-translational levels. This may explain why ECRG4 is often silenced in advanced CRC. These findings highlight the important functional significance of ECRG4 in inhibiting the metastasis of CRC, as well as the importance of its regulation by the MAZ/UHRF1 axis.

Although our study identified a novel regulatory axis in the mechanism of CRC metastasis, it had some limitations. The animal model lacked a functional immune system, which cannot fully recapitulate the role of the tumor microenvironment in MAZ-mediated metastasis. Additionally, we did not correlate the expression levels of MAZ/UHRF1 and the methylation status of ECRG4 with clinicopathological characteristics. In future research, we will attempt to use organoid models to explore the role of MAZ in CRC progression and combine clinical data to further investigate the potential targeting mechanism of MAZ in clinical practice. Additionally, in vivo studies with patient-derived xenograft models would enhance the translational relevance of our findings. Investigating potential small molecule inhibitors targeting MAZ or UHRF1 could also pave the way for novel therapeutic interventions.

Our findings underscore the pivotal role of MAZ in CRC progression and its downstream regulatory mechanisms. We demonstrated that MAZ promoted CRC migration, invasion, and EMT while transcriptionally activating UHRF1. In turn, UHRF1 epigenetically silenced ECRG4 through DNA methylation, facilitating tumor progression (Figure 6). Targeting the MAZ/UHRF1/ECRG4 signaling axis could provide a novel therapeutic approach for CRC. Inhibiting MAZ, UHRF1, or restoring ECRG4 expression may effectively reactivate tumor suppressor pathways, thereby mitigating tumor metastasis.

Figure 6 Molecular mechanisms by which Myc-associated zinc finger protein promotes colorectal cancer progression. In colorectal cancer cells, Myc-associated zinc finger protein transcription activates ubiquitin-like with PHD and RING finger domains 1 and promotes esophageal cancer-related gene 4 DNA methylation leading to colorectal cancer tumor metastasis. CRC: Colorectal cancer; MAZ: Myc-associated zinc finger protein; UHRF1: Ubiquitin-like with PHD and RING finger domains 1; ECRG4: Esophageal cancer-related gene 4; EMT: Epithelial-mesenchymal transition.

CONCLUSION

Our study identified a novel regulatory axis involving MAZ, UHRF1, and ECRG4 in the progression of CRC, where MAZ transcriptionally activated UHRF1, leading to the epigenetic silencing of the tumor suppressor gene ECRG4 via DNA methylation.