BPG is committed to discovery and dissemination of knowledge
Case Report
Copyright ©20???? Baishideng Publishing Group Co.
World J Hepatol. Feb 27, 2011; 3(2): 56-60
Published online Feb 27, 2011. doi: 10.4254/wjh.v3.i2.56
Table 1 Laboratory findings at first visit
ParameterValuePartameterValueParameterValue
Peripheral bloodBiochemistryViral marker
WBC (/μL)3800AST (IU/L)41HBsAg (COI)1.4
RBC (× 104/μL)365ALT (IU/L)62Anti-HBs (COI)0
Hb (g/dL)12.2ZTT (U)17.7Anti-HBc (S/CO)< 1.0
Ht (%)37.5LDH (IU/L)213HBeAg (COI)< 0.5
Plt (× 104/μL)12.8ChE (U/L)5.8Anti-HBe (%)< 35.0
γGT (IU/L)39Anti-HCV (COI)0.2
CoagulationALP (IU/L)265
HPT (%)87TBil (mg/dL)0.8Autoantibody
DBil (mg/dL)0.3ANA(-)
UrinalysisUN (mg/dL)15AMA(-)
Protein(-)Cr (mg/dL)0.5
Sugar(-)TP (g/dL)8.6Others
Bilirubin(-)Alb (g/dL)4.9ICG-R15 (%)12
Urobilinogen(±)TC (mg/dL)235AFP (ng/mL)2.6
TG (mg/dL)40
Table 2 Primers for the amplification of the precore region and all remaining regions of hepatitis B virus DNA in nested polymerase chain reaction
PrimerSequencePositiona
PreC region1st forward5'GGGAGGAGATTAGGTTAA3'1744
1st reverse5'GGCAAAAAAGAGAGTAACTC3'1959
2nd forward5'TAGGAGGCTGTAGGCATAA3'1774
2nd reverse5'GCTCCAAATTCTTTATA3'1932
Cycling protocol: 94°C 1 min - 55°C 1 min - 68°C 3 min (25 cycles)
All remaining regions (long PCR)1st forward5'CCTATAAAGAATTTGGAGC3'1914
1st reverse5'TTTATGCCTACAGCCTCC3'1793
2nd forward5'GAGTTACTCTCTTTTTTGC3'1940
2nd reverse5'ACCTTTAACCTAATCTCCT3'1765
Cycling protocol: 95°C 1 min - 57°C 1 min - 68°C 3 min (35 cycles)