Calcifying nanoparticles induce apoptosis and calcification in bone marrow mesenchymal stem cells via the transforming growth factor-β/Smad pathway

doi:10.4252/wjsc.v17.i12.106128

Advanced Search

BPG is committed to discovery and dissemination of knowledge

Home / Archive / Volume 17, Issue 12

This Article

Academic Content and Language Evaluation of This Article

CrossCheck and Google Search of This Article

Academic Rules and Norms of This Article

Supplementary Materials of This Article

Citation of this article

Corresponding Author of This Article

Research Domain of This Article

Article-Type of This Article

Open-Access Policy of This Article

Times Cited Counts in Google of This Article

Number of Hits and Downloads for This Article

Total Article Views (166)

All Articles published online

The chart showing PDF series, HTML series, Figures (1-7) series, Tables (1-6) series.

Item

Count

PDF

HTML

Figures (1-7)

Tables (1-6)

Sum=61

Featured Article

The chart showing Browse series, Download series.

Item

Count

Browse

Download

Sum=121

Publishing Process of This Article

Item

Count

Browse

Download

Sum=18

Dec 26, 2025 (publication date) through Dec 31, 2025

Times Cited of This Article

Times Cited (0)

Journal Information of This Article

Publication Name

World Journal of Stem Cells

ISSN

1948-0210

Publisher of This Article

Baishideng Publishing Group Inc, 7041 Koll Center Parkway, Suite 160, Pleasanton, CA 94566, USA

Basic Study

World J Stem Cells. Dec 26, 2025; 17(12): 106128
Published online Dec 26, 2025. doi: 10.4252/wjsc.v17.i12.106128

Table 1 Experimental grouping

Group	Treatment
Control	BMSCs + PBS
L-nHAPs (low concentration)	BMSCs + 2 MCF nHAPs
M-nHAPs (medium concentration)	BMSCs + 4 MCF nHAPs
H-nHAPs (high concentration)	BMSCs + 6 MCF nHAPs
L-CNPs (low concentration)	BMSCs + 2 MCF CNPs
M-CNPs (medium concentration)	BMSCs + 4 MCF CNPs
H-CNPs (high concentration)	BMSCs + 6 MCF CNPs
M-CNPs + SB431542	BMSCs + 4 MCF CNPs, followed by 1-hour treatment with 10 μM SB431542 after 3 days of culture

BMSCs: Bone marrow mesenchymal stem cells; PBS: Phosphate-buffered saline; nHAPs: Nanoscale hydroxyapatites; MCF: McFarland; CNPS: Calcifying nanoparticles.

Full Size Table

Table 2 Primer used for quantitative reverse-transcription polymerase chain reaction for detection of mRNA expression

Gene	Primers (5’-3’)
Gene	Forward	Reverse
OPN	TCCAATCGTCCCTACAGTCG	GGGACTCCTTAGACTCACCG
BMP-2	CCGCTCCACAAACGAGAAAA	CAGCAAGGGGAAAAGGACAC
Bcl-2	GCCTTCTTTGAGTTCGGTGG	ATCAAACAGAGGTCGCATGC
Caspase3	CAGCCAACCTCAGAGAGACA	ACAGGCCCATTTGTCCCATA
BAX	AAGAAGCTGAGCGAGTGTCT	CCCCAGTTGAAGTTGCCATC
TGF-β1	TCGCTTTGTACAACAGCACC	ACTGCTTCCCGAATGTCTGA
Smad3	CAGCCACCATGAATTACGGG	TTCTCGGGAATGGAATGGCT
GAPDH	TGTTGCCATCAATGACCCCTT	CTCCACGACGTACTCAGCG

OPN: Osteopontin; BMP-2: Bone morphogenetic protein-2; TGF-β1: Transforming growth factor-β1.

Full Size Table

Table 3 Statistical analysis of cell proliferation and apoptosis of bone marrow mesenchymal stem cells treated with nanoscale hydroxyapatite and calcifying nanoparticles (mean ± SD, n = 6)

Group	Survival rate
Control	100 ± 3.588
L-nHAPs	89.253 ± 6.804^a
M-nHAPs	74.173 ± 9.219^a^,^b
H-nHAPs	54.134 ± 6.466^a^,^b^,^c
L-CNPs	84.689 ± 10.851^a^,^c^,^d
M-CNPs	55.06 ± 5.654^a^,^b^,^c^,^e
H-CNPs	38.757 ± 11.199^a^,^b^,^c^,^d^,^e^,^f
M-CNPs + SB431542	74.504 ± 7.12^a^,^b^,^d^,^e^,^f^,^g

^aP < 0.05 vs the control group.

^bP < 0.05 vs the low concentration nanoscale hydroxyapatites group.

^cP < 0.05 vs the medium concentration nanoscale hydroxyapatites group.

^dP < 0.05 vs the high concentration nanoscale hydroxyapatites group.

^eP < 0.05 vs the low concentration calcifying nanoparticles group.

^fP < 0.05 vs the medium concentration calcifying nanoparticles group.

^gP < 0.05 vs the high concentration calcifying nanoparticles group.

L-nHAPs: Low concentration nanoscale hydroxyapatites; M-nHAPs: Medium concentration nanoscale hydroxyapatites; H-nHAPs: High concentration nanoscale hydroxyapatites; L-CNPs: Low concentration calcifying nanoparticles; M-CNPs: Medium concentration calcifying nanoparticles; H-CNPs: High concentration calcifying nanoparticles.

Full Size Table

Table 4 Statistical analysis of apoptosis in bone marrow mesenchymal stem cells treated with nanoscale hydroxyapatite and calcifying nanoparticles (mean ± SD, n = 6)

Group	Apoptosis rate
Control	2.52 ± 0.822
L-nHAPs	11.257 ± 0.895^a
M-nHAPs	22.175 ± 1.776^a^,^b
H-nHAPs	31.618 ± 2.622^a^,^b^,^c
L-CNPs	19.745 ± 1.302^a^,^b^,^d
M-CNPs	34.397 ± 2.002^a^,^b^,^c^,^e
H-CNPs	43.505 ± 1.96^a^,^b^,^c^,^d^,^e^,^f
M-CNPs + SB431542	16.543 ± 0.76^a^,^b^,^c^,^d^,^e^,^f^,^g

^aP < 0.05 vs the control group.

^bP < 0.05 vs the low concentration nanoscale hydroxyapatites group.

^cP < 0.05 vs the medium concentration nanoscale hydroxyapatites group.

^dP < 0.05 vs the high concentration nanoscale hydroxyapatites group.

^eP < 0.05 vs the low concentration calcifying nanoparticles group.

^fP < 0.05 vs the medium concentration calcifying nanoparticles group.

^gP < 0.05 vs the high concentration calcifying nanoparticles group.

Full Size Table

Table 5 Gene expression of bone marrow mesenchymal stem cells treated with nanoscale hydroxyapatite and calcifying nanoparticles, mean ± SD

Group	*OPN*	*BMP-2*	*Bcl-2*	*Caspase3*	*Bax*	*TGF-β*	*Smad3*
Control	1.016 ± 0.205	1.018 ± 0.208	1.007 ± 0.133	1.008 ± 0.147	1.002 ± 0.075	1.010 ± 0.161	1.007 ± 0.118
M-nHAPs	2.384 ± 0.577^a	1.996 ± 0.332^a	0.584 ± 0.134^a	2.169 ± 0.232^a	1.919 ± 0.210^a	1.714 ± 0.305^a	1.617 ± 0.210^a
M-CNPs	2.437 ± 0.535^a	2.131 ± 0.362^a	0.324 ± 0.049^a^,^b	1.839 ± 0.207^a^,^b	1.767 ± 0.105^a	1.930 ± 0.258^a	1.861 ± 0.341^a
M-CNPs + SB431542	1.520 ± 0.447^b^,^c	1.356 ± 0.266^b^,^c	0.878 ± 0.113^b^,^c	1.329 ± 0.182^a^,^b^,^c	1.208 ± 0.227^b^,^c	1.279 ± 0.156^b^,^c	1.177 ± 0.253^b^,^c

^aP < 0.05 vs the control group.

^bP < 0.05 vs the medium concentration nanoscale hydroxyapatites group.

^cP < 0.05 vs the medium concentration calcifying nanoparticles group.

OPN: Osteopontin; BMP-2: Bone morphogenetic protein-2; TGF-β: Transforming growth factor-β; M-nHAPs: Medium concentration nanoscale hydroxyapatites; M-CNPs: Medium concentration calcifying nanoparticles.

Full Size Table

Table 6 Protein expression of bone marrow mesenchymal stem cells treated with nanoscale hydroxyapatite and calcifying nanoparticles, mean ± SD

Protein	Control	M-nHAPs	M-CNPs	M-CNPs + SB431542
OPN	0.307 ± 0.014	0.463 ± 0.042^a	0.629 ± 0.047^a^,^b	0.471 ± 0.034^a^,^c
BMP-2	0.319 ± 0.035	0.411 ± 0.040^a	0.552 ± 0.031^a^,^b	0.398 ± 0.062^a^,^c
Bcl-2	0.684 ± 0.053	0.568 ± 0.059^a	0.446 ± 0.025^a^,^b	0.545 ± 0.036^a^,^c
Caspase3	0.370 ± 0.050	0.481 ± 0.043^a	0.673 ± 0.092^a^,^b	0.489 ± 0.050^a^,^c
BAX	0.364 ± 0.032	0.448 ± 0.035^a	0.527 ± 0.032^a^,^b	0.451 ± 0.024^a^,^c
TGF-β	0.383 ± 0.059	0.500 ± 0.054^a	0.638 ± 0.040^a^,^b	0.495 ± 0.055^a^,^c
Smad3	0.639 ± 0.034	0.687 ± 0.056^a	0.660 ± 0.025^a^,^b	0.683 ± 0.046^a^,^c
p-Smad3	0.721 ± 0.036	0.778 ± 0.041^a	0.877 ± 0.021^a^,^b	0.767 ± 0.041^a^,^c

^aP < 0.05 vs the control group.

^bP < 0.05 vs the medium concentration nanoscale hydroxyapatites group.

^cP < 0.05 vs the medium concentration calcifying nanoparticles group.

M-nHAPs: Medium concentration nanoscale hydroxyapatites; M-CNPs: Medium concentration calcifying nanoparticles; OPN: Osteopontin; BMP-2: Bone morphogenetic protein-2; TGF-β: Transforming growth factor-β.

Full Size Table

Citation: Su XL, Xu FR, Yang J, Niu SQ, Shi HJ, He YF, Li ZH, Bagari P, Wu XW, Peng XY, Zhang HW, Wang MY. Calcifying nanoparticles induce apoptosis and calcification in bone marrow mesenchymal stem cells via the transforming growth factor-β/Smad pathway. World J Stem Cells 2025; 17(12): 106128
URL: https://www.wjgnet.com/1948-0210/full/v17/i12/106128.htm
DOI: https://dx.doi.org/10.4252/wjsc.v17.i12.106128