Published online Jul 26, 2026. doi: 10.4252/wjsc.118557
Revised: March 18, 2026
Accepted: May 27, 2026
Published online: July 26, 2026
Processing time: 171 Days and 1.5 Hours
Diabetes has continuously affected some people for a long time, and among them there are many cases of foot ulcers which appear due to insufficient fibroblast activity. Bone-marrow mesenchymal stem cell (BMSC) secreted exosomes (BM
To explore the function of miR-140-3p in BMSC-Exo treatment for high-glucose-induced damage to rat skin fibroblasts (RSFs), as well as its related cell pathways.
Exosome materials originated from rat BMSCs and were obtained by precipitating them. Based on the structure, dimensions and external markers (CD9, CD63, CD81), etc., of these cells using transmission electron microscope, nanoparticle tracking analysis and western blotting technologies respectively. Tagging the exosomes with PKH26 to track their internalisation into RSF cells. Using high-throughput miRNA sequencing combined with bioin
BMSCs-Exo was successfully isolated and characterised. These vesicles are about 50 nm to 250 nm in diameter, oval or spherical in shape; they strongly express the three surfaces antigens of CD9, CD63 and CD81. PKH26 labelling confirmed that BMSCs-Exo had been absorbed into the RSF cells. miRNA-seq data showed that miR-140-3p was significantly up-regulated in BMSCs-Exo under hyperglycaemia, and it was closely related to the pyroptosis signal transduction pathway. According to qRT-PCR results, compared with the negative control group (1.04 ± 0.03), the level of miR-140-3p in the miR-140-3p mimics group increased by more than 2.5 times; the level in the miR-140-3p inhibitor group decreased by about 46% compared with that in the negative control group (1.07 ± 0.02). Comprehensive comparison showed that there was a statistically significant difference at all levels (F = 1062.839, P < 0.001). Cellular experiments showed that compared with those in the Hy-miR-inhibitor-NC-Exo group, there was a significant decrease in proliferation and migration abilities, as well as an obvious increase in expression levels of pyroptotic protein genes in the Hy-miR-140-3p-inhibitor-Exo group. After adding the pyroptosis pathway inhibitor AYC, the above parameters improved greatly. qRT-PCR, western blotting, and dual-luciferase reporters have demonstrated that PTEN is a specific target of miR-140-3p; it has been effectively repressed by this reduction in PTEN levels. Afterwards’ examination found that PTEN overexpressed promoted fibroblasts to perform pyro
BMSCs-Exo delivered miR-140-3p to target PTEN in cells, suppress NLRP3-mediated pyroptosis, improve fib
Core Tip: Specifically, extracellular vesicles derived from bone marrow mesenchymal stem cells contain miR-140-3p that inhibits pyroptosis in rat dermal fibroblasts caused by hyperglycaemic stimulation through direct inhibition of phosphatase and tensin homolog. By blocking the NLRP3/caspase-1/gasdermine-D-N-terminal-dependent pyroptosis pathway to promote fibroblast proliferation and migration. The miR-140-3p/phosphatase and tensin homolog axis has provided an attractive strategy to treat diabetic foot ulcers.
- Citation: Wu Y, Yin WH, Wang HJ, Cai H. miR-140-3p in exosomes derived from bone-marrow mesenchymal stem cells inhibits pyrotoisosis by targeting PTEN under high-glucose condition. World J Stem Cells 2026; 18(7): 118557
- URL: https://www.wjgnet.com/1948-0210/full/v18/i7/118557.htm
- DOI: https://dx.doi.org/10.4252/wjsc.118557
According to the IDF 11th edition, there were an estimated 589 million adults aged 20-79 who had diabetes in 2024; it is predicted that this figure would reach 853 million by 2050. As diabetes continues to spread, chronic ulcers have become one of its severe complications due to prolonged hyperglycaemia, increased oxygen radicals, enhanced inflammation response, and microvessel damages[1-3]. High glucose environment inhibits fibroblast proliferation, migration and extracellular matrix synthesis to halt wound repair. The main protectives and clinical treatments include surgical debridement to manage lower-limb ischaemia and pedal infection; dressing application; to reduce weight-bearing stress on the lesion area are the primary protective measures for these type of lesions.
Current treatments are still limited; exosomes have attracted interest. The following vesicles have low immunogenicity and can be stored stably[4]; bone-marrow mesenchymal stem cell (BMSC) secreted exosomes (BMSCs-Exos), which have recently been recognised as essential mediators of cellular communication among cells in tissues during recovery from damage[5,6]. Transmitting regulatory small molecules, such as microRNAs (miRNAs), that affect the genetic network and cellular function. Extensively recognised by the scientific community for healing bone, tendon and kidney vessels injuries as well as cardiac damage through M1/M2[7-9]. Exosomal miRNAs are considered to be important active factors that impact biological processes like cell proliferation, cell migration, and cell death by altering the expression of target genes[10]. Chronic ulcers are associated with exosomal miRNAs that promote wound repair inflammation attenuation and prevent keloid formation[11].
miR-140-3p is investigated within brain cognitive abnormalities, malignancy-associated matters, osteoarthritis, where it exerts roles in cell multiplication, cell death, aging, and irritation, displaying pro-apoptotic actions. As a result of increasing production, more vascular endothelial cells migrate towards it; as these vessels continue growing inside the skin tissues and causing further inflammation, it becomes chronic disease damage[12-17].
BMSCs-Exo’s underlying mechanism is not yet clear. Therefore, this study explored possible miRNA targets to investigate their effects and pathways on high-glucose-exposed fibroblasts mediated by BMSCs-Exo-derived miRNAs. By analysing its relationship with target genes and signaling networks, we sought to find a new treatment goal for pro
Exosomes have been separated by precipitation technique. Initially, the clarified liquid obtained after propagating newly cultured rat BMSCs in fresh sterile 15 mL enzyme-free centrifuge tubes. Subsequently, centrifuge at a speed of 2000 × g for 40 minutes under ice-bath conditions to separate cells from other particles inside the tube. Centrifuge after separation; filter through a 0.22 μm pore-size filter membrane to eliminate residual impurities. Clear supernatant was pipetted into an empty clean 15-mL centrifuge tube, placed in the ice bath, etc. Then, after adding an appropriate amount (approximately five times that of the cells) of exosome precipitation reagent to the cell supernatant for mixing with a pipette.
After thorough mixing, it was stirred and then cooled to 2 °C-8 °C for 30 minutes; subsequently, a centrifuge at 100000 × g, with an angle of rotation set at 25 °C, for another ten minutes. Gently discard the liquid; then isolate and resuspend the exosome fractions in 1 × phosphate buffered saline (PBS). These exosome solutions were then stored at -80 °C to be used later. Using a transmission electron microscopy method to evaluate the structures of BMSCs-Exo. These exosome sizes can be measured by nanoparticle tracking analysis in most cases, which is called “Particle Size” hereinafter. A western blot analysis of membrane markers, including CD9, CD63 and CD81.
PKH26 has been prepared at a concentration of 100 × reserves by Mao-Kang Biotechnology Co., Ltd., China. In short, a mixture of 5 μL PKH26-labelling solution and 50 μL exosomal samples was prepared, which then needs to be incubated in water bath set at 37 °C for two hours to promote labelling effect. Subsequently, 100 μL containing 1 mg/mL bovine serum albumin proteins were added to the exosome samples for a label-free reaction stop. Finally, mix 2 mL of 1 mg/mL exosomal protein and 5 μL of exosomes. The cell nucleus was stained with DAPI, and the cells were labelled with Phalloidin (Yeasen Biotechnology Co., Ltd., Shanghai, China) before observing it under a fluorescent microscope.
The isolated BMSCs-Exo were categorized into two cohorts for deep sequencing and bioinformatics evaluation to identify the candidate miRNA X: Group A (BMSCs-Exo) and group B (high glucose + BMSCs-Exo). A facility constructed with the QIAseq™miRNeasy Library kit from Qiagen (Germany). After coupling of the 3’-and-5’ adapters, reverse transcription, cDNA purification, and library amplification (using Q5 High-Fidelity DNA polymerase) were completed. Purification of the library using Qsep 100 apparatus.
Using an Illumina PE-150 sequencer for data collection and employing FastQC software to evaluate the integrity of the sequencing library. Before analyzing the raw sequencing data, FastP was employed to remove or discard all ambiguous Ns located at the 5’ or 3’ ends of individual reads, low-quality bases with Q scores under 20, and any remaining adapter sequences.
Using Bowtie2 for short sequence mapping against the Rfam database, etc. For miRDeep2 and DESeq2 to profile miRNAs and perform comparisons in this study. miRNA that was more strongly linked to the traditional pyroptotic pathway after integrating multimodal prediction and enrichments examination.
Chemically synthesised miR-140-3p mimics and inhibitors were each transfected into BMSCs. Transfection after that point in time; isolate and purify exosome types experimentally across all conditions. To test the surface-expression level of miR-140-3p in these isolated exosomes by using a fluorescent real-time quantitative polymerase chain reaction (qRT-PCR) method. Based on this, using the protocol of a fluorescence quantitative kit, select U6 as an internal reference gene. Using this particular kit to quantify miR-140-3p abundance; and calculate the relative expression intensity using the 2-∆∆Ct method. The entire group of participants consisted of three people; detailed primer sequences have been provided in Table 1.
| Primer | Gene | Primer sequences (5’-3’) | |
| R-U6 | RT | K00784.1 | AACGCTTCACGAATTTGCGT |
| Forward | CCTGCTTCGGCAGCACAT | ||
| Reverse | AACGCTTCACGAATTTGCGT | ||
| miR-140-3p | RT | MIMAT0000574 | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCGTGGTT |
| Forward | TACCACAGGGTAGAACCACGG | ||
| Reverse | CTCAACTGGTGTCGTGGAGTC | ||
Rat skin fibroblasts (RSFs) were cultured in high-glucose DMEM medium containing 10% foetal bovine serum and 1% antibiotic/antimycotic; it has been applied to the culture of cells in a high-sugar environment[16,17]. The cells were classified into three groups according to the experimental treatments: (1) Group A1: Fibroblasts co-cultured with exosomes isolated from BMSCs that had been transfected by a negative control miR-inhibitor; (2) Group B1: This cohort received fibroblasts incubated with BMSC-derived exosomes carrying the miR-140-3p inhibitor; and (3) Group C1 (Hy + miR-140-3p inhibitor-Exo + AYC): Cultured cells as described above, and additionally added pyroptosis blocker AYC. All the experiment cells used passage numbers of 3-5.
Dissociate the logarithmically-phase SKIN-FIBROBLASTS using trypsin, then resuspend them at a concentration of 1 × 105 cells/mL. Thereafter, 10000 cells were plated per well within 96-well plates. After cultivating for another 48 hours, add 10 μL of CCK-8 solution to each well; let stand at this time point for 2 hours. The obtained optical density in the 450 nm measurement. All results are expressed by mean ± SD, based on the data of 3 independent experiments.
Using a marker pen to draw several parallel straight lines approximately 0.5-1 cm apart on the bottom surface of each well in a six-well flat-bottom plate; there are exactly five such lines passing through each well. Each well was then added with approximately 5 × 104 fibroblast-culture fluids at a volume of 2 mL. Cells formed a single layer and then underwent linear scratching in the cell group by drawing it with a yellow pipette tip. Three times in PBS wash the well and remove free cells. All the test groups were maintained at 37 °C. Pictures of the scratch injuries were taken at both times 0 and 24 hours post-injury, and sizes of all scratches were quantified using ImageJ.
The proteins in cell lysate extracts at wound edge and skin fibroblast sites, respectively, using RIPA lysis buffer supplied by Aspen Biotechnology (China) according to its instructions. Determine the amount of protein using a BCA detection kit provided by Aspen Biotechnology (China) in China. Therefore, in total, four samples were prepared for the experiment: Control and infected with virus groups each received two replicates. After electrophoresis, the sample films were moved to a PVDF membrane and blocked with a solution containing 5% nonfat milk in TBST for 60 minutes. After an overnight incubation of the membrane in primary antibodies at 4 °C and three subsequent washes using TBS-Tween20 buffer (TBST) at room temperature. After that, immerse the membrane in the specified second antibody at room temperature for 30 minutes and wash TBST-4 × times to remove unbound antibodies specifically. The expression levels of the target protein were determined by ELISA using an ASPEN-Biotechnology company’s provided ELISA kit; Data quantification was handled with AlphaEaseFC software. Details of the used antibodies are shown in Table 2.
| Name of antibody | Antibody dilution | Company | Catalog number |
| GSDMD-N | 1:1000 | Abclonal | A22523 |
| Cleaved caspase-1 | 1:500 | Affbiotech | AF4005 |
| IL-1β | 1:2000 | Proteintech Group | 26048-1-AP |
| IL-18 | 1:1000 | Abcam | ab191860 |
| NLRP3 | 1:1000 | Proteintech Group | 68102-1-Ig |
| CD9 | 1:1000 | Proteintech Group | 20597-1-AP |
| CD63 | 1:500 | Affbiotech | AF5117 |
| CD81 | 1:1000 | Abcam | ab109201 |
Organisation of the categories is as follows: Group A: Skin fibroblasts plus miRNA-140-3p mimics NC-exosomes (FB + miRNA-140-3p mimics NC-Exo); group B: Skin fibroblasts connected to miRNA-140-3p mimics-exosomes (FB + miRNA-140-3p mimics-Exo); group C: Skin fibroblasts linked with miRNA-140-3p inhibitor NC-exosomes (FB + miRNA-140-3p inhibitor NC-Exo); group D: Skin fibroblasts associated with miRNA-140-3p inhibitor-exosomes (FB + miRNA-140-3p inhibitor-Exo). The procedural method was the same as in the section “Real-time fluorescent quantitative polymerase chain reaction”. The following primer specific are provided in Table 3.
| Primer | Primer sequences (5’-3’) | Tm | CG% | |
| R-ACTIN | Sense | CGTTGACATCCGTAAAGACCTC | 58.4 | 52.4 |
| Antisense | TAGGAGCCAGGGCAGTAATCT | 59.9 | 52.4 | |
| R-PTEN | Sense | CTCAGCCATTGCCTGTGTGT | 59 | 55 |
| Antisense | TCCTTGTCATTATCCGCACG | 59.3 | 50 | |
Bioinformatics prediction (using TargetScan software) revealed that the potential target gene of miR-140-3p was phosphatase and tensin homolog (PTEN); therefore, it was selected as a downstream effector protein. A 3’ untranslated region (3’ UTR) containing a predicted binding site for miR-140-3p in PTEN was added to a double-luciferase reporter vector. A mutant vector construct containing a deletion of the miR-140-3p target site served as the control group. Fibroblasts were cotransfected with the wild-type and mutant PTEN plasmids, as well as miR-140-3p mimics or negative controls. Forty-eight hours after transfection, the relative luciferase activity was detected by a dual-luciferase reporter system; the data were normalised to Renilla luciferase signal values. The cell group classification is shown below: Group A: Negative control (NC); group B: PGL6-miR-PTEN-WT + pRL-TK; group C: MiR-140-3p NC + pGL6-miR-PTEN-WT + pRL-TK; group D: MiR-140-3p mimics + pGL6-miR-PTEN-WT + pRL-TK; group E: PGL6-miR-PTEN-Mut + pRL-TK; group F: MiR-140-3p NC + pGL6-miR-PTEN-Mut + pRL-TK; group G: MiR-140-3p mimics + pGL6-miR-PTEN-Mut + pRL-TK.
pcDNA-PTEN vector, separately or combined with miR-140-3p mimics, were used to examine the association among the miR-140-3p/PTEN regulatory axis and pyroptotic death.
The groupings and transfusion plans were as follows: Group A: Skin fibroblasts combined with pcDNA-NC (FB + pcDNA-NC) served as the control group for comparison; group B: Skin fibroblasts plus PCNT-PTEN (FB + PTEN-c). This PCNA-PTEN vector simulated a constant state of high-level PTEN expression; group C: Skin fibroblasts + pcDNA-PTEN + miR-140-3p mimics NC-exosomes (FB + pcDNA-PTEN + mimic NC-Exo). PCNA-PD-L1, miR-NC mimics, etc., were not included in the transfection experiment to ensure that there was no nonspecific oligonucleotide interference; and group D: Skin fibroblast + pcDNA-PTEN + miR-140-3p mimics-exosomes (FB + pcDNA-PTEN + miR-140-3p mimics-Exo). Confirm whether PTEN overexpressed can be inhibited by introducing PCNA-LIP and miRNA-140-3p mimic in combination. Details of the used antibodies are shown in Table 2.
Using the analytical tool SPSS 21.0 for data analysis. All quantified data reached a normal distribution, presented as means ± SD. One-way ANOVA was used for the comparison of various groups. Homogeneous variance assumption met; then performed LSD post hoc test and found a significant difference among groups. Under the condition of homogeneity variance assumption, used Dunn-Tukey HSD test as follow-up comparisons to demonstrate significant disparities.
The nanoparticle tracking analysis result showed that the sizes of the exosomes were distributed between 50-250 nm (Figure 1A). The transmission electron microscope image of the vesicles is shown in Figure 1B; most are oval or concave-shaped. Using western blot to validate the presence of exosomal markers in BMSCs-Exo included CD9, CD63 and CD81 (Figure 1C).
After a co-culture period of 24 hours for skin fibroblasts and PKH67-labelled BMSCs-Exo, red fluorescence was observed around the nuclei of some fibroblasts. The above experiment revealed that the fibroblasts had absorbed BMSCs-Exo (Figure 2).
High-throughput sequencing was conducted on the isolated exosome miRNA libraries to identify altered miRNAs in normal vs high-glucose exosomes (Figure 3). miRNA-140-3p and miR-542-5p showed significant upregulation in the hyperglycaemic group. By merging multidatabase forecasting and enrichment analysis techniques to identify the strong-interacting miRNAs of the canonical pyroptotic pathway. Fluctuations of miRNA-140-3p expression were closely associated with the regulation pathway of pyroptosis, suggesting that miR-140-3p may regulate fibroblasts’ activities via changes in pyroptosis-related signal transduction during diabetic wound healing.
Using real-time fluorescent quantitative PCR to detect the expression levels of miR-140-3p in the BMSC + miR-140-3pmimic-NC group, BMSC + miR-140-3pmimicaotumor, BMSC + miR-140-3pmimicao-inhibitor-NC group and BMSC + miR-140-3pmolicao-inhiboter groups, the values were recorded as follows: The control was 1.04 ± 0.03; miR-140-3pmi-c group: 2.44 ± 0.07, miR-140-3pmimioc-n group: 1.07 ± 0.02, miR-l40-3pi-oa-inhibitomioc group: 0.53 ± 0.04. The entire assessment showed that there was a significant difference among all groups (F = 1062.839, P < 0.001). The expression level of miR-140-5p in the BMSC + miR-140-3p mimics group was significantly higher than that in the BMSC + miR-140-3p mimic negative control group (P < 0.001). On the other hand, miR-140-3p levels were significantly lower in the BMSC + miR-140-3p inhibitor group compared with that of the BMSC + miR-140-3p inhibitor control group (P < 0.001). There were no clinically relevant changes in the expression level of miR-140-3p between the BMSC + miR-140-3pmimic NC group and the BMSC + mir-140-3pi positive control group; the P value was greater than 0.05.
The group B1 had a lower degree of proliferation of skin fibroblasts than the control group A1 in high glucose en
In contrast to the level in the control group, there were higher abundances of pyroptosis-related factors NLRP3, in
RT-qPCR data showed a significant decrease in relative PTEN mRNA levels in exosomes of the miR-140-3p mimic transfection group (group B), compared with that in the negative control exosome (FB plus miR-140-3p mimic NC-Exo, group A). Inversely, exosomal PTEN mRNA expression was significantly higher in the miR-140-3p inhibitor-transfected group (group D) than that of other groups such as FB + miRNA-140-3p inhibitor NC-exosome and positive control (FB + negative control plus miRNA-140-3p inhibitor; Figure 6).
The results of western blot analysis showed that the expression in the treatment group (miR-140-3p mimetics injection, group B) was lower than that of the controls (injected PBS; group A); PTEN levels in groups B and A were significantly different from each other. Compared with the level of PTEN in group C, there was a significant increase at the time point for treatment groups that received miR-140-3p inhibitor (group D); in Figure 7.
Group A: The NC (without blank addition) did not introduce a reporter vector; it was only used to correct background fluorescence through baseline measurement. Reporter vectors that contained the natural 3’-UTR sequence of PTEN (B, C, and D) had significantly reduced firefly fluorescence intensity (D) when co-transfected with miR-140-3p mimics. Through this experiment, it was found that miR-140-3p can effectively bind to and inhibit the translation of PTEN’s 3’-UTR. After the mutation of the target sequences (E, F and G), the RLU values did not change in comparison with control groups; whether there were miR-140-3p mimic added or not. It was confirmed that this result indicated that the mutation eliminated the miRNA-mRNA interaction region and proved to be a sequence-specific effect (Figure 8). The results showed that miR-140-3p specifically bound to the 3’UTR of PTEN mRNA and inhibited its translation. By modifying the particular target site, it completely eliminated the suppressive effect and confirmed that PTEN is a direct regulatory gene for miR-140-3p.
Using western blot technology showed a higher concentration of pyroptotic-related proteins, such as GSDMD-N and cleaved-caspase-1; IL-1β and IL-18; NLRP3 in group B compared with group A. Compared with the ones in group C, there were obvious decreases in expressions of pyroptosis-related protein GSDMD-N, cleaved-caspase-1, IL-1β, IL-18 and NLRP3 in group D. Therefore, there were more of these pyroptosis-related molecules in groups A and B. PTEN promoted pyrotoxicity in the skin fibroblasts through this experiment. miR-140-3p mimics-Exo transfected group D compared to control group C, there was a decrease in pyroptosis-related molecules’ amounts (as shown in Figure 9).
Persistent diabetic ulcer is an issue of slow wound healing, persistent irritation, dysfunction of fibroblasts, lack of adequate vessel formation[18], etc., which ultimately leads to poor prognosis and heavy clinical workload[19]. Recent studies have pointed out that pyroptosis is an inflammatory form of programmed cell death involving the production of reactive oxygen species and other factors to enhance inflammation and tissue damage. Within this study, new me
Currently, there are some researches related with electric vehicles which pay attention on the functions of extracellular vesicles; miRNA-laden extracellular vesicles specifically deliver gene expression patterns from donor cells to wounds during wounding recovery[20,21], through Toll-like receptor 4-mediated inhibition[22,23]. The BMSCs-Exo have gained attention for their role in acting as cytokines-like information mediators in immune modulation and tissue repair[24]. Different types of miRNA present in the exosomes may enter their corresponding receptors in a cell to exert potent regulation over genes’ expressions. miR-140-3p was upregulated in high-glucose-conditioned cells compared with those under normal conditions through miRNA sequencing, suggesting it may play a role in regulating pyroptotic death by binding to its target genes. Clarify the role of miR-140-3p in guiding cellular activity and pathological state through mimic or inhibitor transfection in rat BMSCs. To detect miR-140-3p levels in isolated exosomes using PCR technology. The levels of miR-140-3p in the exosome samples from the mimic group significantly increased, and those in the inhibitor group decreased markedly. Transfection of miR-140-3p overexpression vector significantly increased the amount of miR-140-3p in cells. Therefore, extramolar miR-140-3p loaded onto vesicles and transferred to the cell interior. Inhibitor groups: MiR-140-3p target inhibitors can reduce the amount of miR-140-3p in cells and exosomes to weaken their effects. Exosomes have relatively fixed membrane structures; they can move genetic materials to recipient cells by transporting them directly at the post-transcription level.
At high-glucose levels, obvious changes occur inside the cell compared to outside cells; namely increased oxidative stress, disorder of inflammasome-related cytokines and reduced mitochondrial function. All of these changes affect fibroblast activity and inhibit the process to some degree. Through investigating the effects of miR-140-3p inhibitor-transfected BMSCs-Exo on diabetic conditions involving fibroblast proliferation and injury[25]. The results showed that all exosomal miR-140-3p completely inhibited the proliferation and migration of fibroblasts in the control group. However, the administration of a pyroptosis-inhibitor YACI restored it. The observations also showed that the pyroptosis cascade was necessary in miR-140-3p-regulated cell behaviour.
Pyroptosis is a type of inflammation-induced cell death mainly activated through the inflammasome, NLRP3; after rupturing, it stimulates caspase-1 and GSDMD, releases pro-inflammatory factors such as IL-1β and IL-18. Studies show that sustained-high levels of blood sugar activate the inflammasome in surrounding tissue to cause damage there gradually[26,27]. Using western blot analysis in this study to examine BMSCs after miR-140-3p inhibitor transfection[28-30]. Based on our observations, NLRP3, IL-18, IL-1β, caspase-1, and GSDMD protein expression levels significantly elevated compared with those in the control group demonstrated intense pyroptosis activity. Using a combination of pyroptosis inhibitor AYC and exosomes led to decreased levels of the above proteins compared with the miR-140-3p inhibitor-only group. The above data show that miR-140-3p may alleviate fibroblasts’ damage through regulation of the pyropotocytosis pathway, etc.
Then, using qRT-PCR and western blotting to verify that miR-140-3p mimic significantly reduced PTEN expression, while miR-140-3p inhibitor showed an opposite effect. These above-results are also in line with what was found pre
In addition, a dual-luciferase reporter assay further supported that the miR-140-3p-PTEN link was valid. The wild type 3’-UTR of PTEN was linked to firefly luciferase, and together they were transfected with miR-140-3p mimics; the ratio of firefly luciferase/Renilla significantly decreased. The above-mentioned observation showed that miR-140-3p can form an RISC complex, has a target sequence and induces post-transcriptional silencing. However, by introducing specific point mutations in the six essential bases of the seed region of the 3’UTR, no fluorescence signal was observed when exogenous miR-140-3p had reached a high level; it remained at baseline. This discovery also confirmed the traditional miRNA regulatory mode that occurs post-transcriptionally by forming complementary bonds with target genes’ 3’-UTRs. The above data clearly show that PTEN is an immediate downstream gene of miR-140-3p[35]. To explore whether miR-140-3p protects fibroblasts from pyroptosis by suppressing this pathway through a target gene; therefore, we will test the association of the miR-140-3p/PTEN axis with pyroptosis using western blot analysis. The data suggested that PTEN overexpression alone substantially activated the NLRP3/caspase-1/GSDMD cascade, driving pyroptosis in skin fibroblasts. Conversely, when exosomes carrying miR-140-3p mimics were administrated along with PTEN over-ex
Various types of miRNAs participate in the regulation of pyroptosis in prior research. Liang et al[36] found in a study that exosomes released by dental pulp stem cell-derived cells could inhibit the activation of NLRP3 inflammasomes through miR-197-3p/FOXO3 pathways to reduce neuro-inflammation and microglial pyroptosis. Additionally, an extra study showed that exosomes derived from umbilical cord blood stem cells can enhance autophagy to inhibit pyroptosis via the miR-146a-5p/Trak6 axis to reduce inflammation-related pain[37]. Exosomes secreted by human umbilical cord mesenchymal stem cells can reduce cellular inflammation, improve acute liver failure and inhibit pyroptosis induced by lipopolysaccharide and ATP through the miR-423-5p/ZBP1 pathway[38]. However, there are fewer researches on the miRNA regulation of fibroblasts’ pyroptosis yet. At present, this is the first demonstration of that miR-140-3p has an anti-inflammatory effect on skin fibroblasts. Therefore, it may have a role in activation of pyroptosis as well. PTEN plays roles in the alternate form of cell death via apoptosis/autophagy pathway; however, how it affects pyroptosis warrants further investigation still. Based on this, the current study has found that PTEN can stimulate fibroblast pyroptosis; then determined the activation pathway of NLRP3/caspase-1/GSDMD for further research purposes.
Clinical management of diabetic ulcers from this research is significant. At first, the target of treatment was miR-140-3p. Inhibiting the recovery process and achieving our objectives through BMSCs-Exo containing miR-140-3p to trigger fibroblasts’ pyroptosis in lesion sites after injecting miR-140-3p mimics. Building PTEN inhibitors may be a feasible approach for treating these conditions currently. Small-molecule PTEN antagonists have demonstrated clinical potential for neuroprotection and are also worth exploring in tissue repair applications[39].
Despite these results being still affected by some issues. Initially, the investigation mainly utilized in vitro cell cultures; validation via in vivo animal trials is missing. Within the microenvironment of diabetic ulcers is highly complex and involves various types of cells interacting; therefore, simple in vitro tests cannot fully represent their true state in vivo. Thereafter, based on diabetic rodents or mouse wound models, research should examine the function of mir-140-3p-PTEN-pyrotoxicosis. In addition to the regulation of PTEN-mediated miR-140-3p levels in this research. Many bioactive molecules have also been found in exosome particles; for example, miRNA, protein and lipid types. Molecules that may affect these paths in different ways. Afterwards, subsequent studies may employ omic techniques to investigate the components of BMSCs-Exo and determine which specific factors drive its formation.
The above research is the first exploration showing that miR-140-3p contained in exosomes originating from BMSCs can alleviate pyroptosis of skin fibroblasts stimulated by high-glucose environment through inhibition of PTEN expression. Therefore, such suppression reduces the expression of NLRP3/caspase-1/GSDMD. The above experimental results further reveal the molecular pathogenesis mechanism of impaired wound healing associated with diabetes; thus, providing theoretical support for developing novel exosome-targeted therapies.
| 1. | Xiang E, Han B, Zhang Q, Rao W, Wang Z, Chang C, Zhang Y, Tu C, Li C, Wu D. Human umbilical cord-derived mesenchymal stem cells prevent the progression of early diabetic nephropathy through inhibiting inflammation and fibrosis. Stem Cell Res Ther. 2020;11:336. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 281] [Cited by in RCA: 239] [Article Influence: 39.8] [Reference Citation Analysis (5)] |
| 2. | Yu M, Liu W, Li J, Lu J, Lu H, Jia W, Liu F. Exosomes derived from atorvastatin-pretreated MSC accelerate diabetic wound repair by enhancing angiogenesis via AKT/eNOS pathway. Stem Cell Res Ther. 2020;11:350. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 331] [Cited by in RCA: 323] [Article Influence: 53.8] [Reference Citation Analysis (9)] |
| 3. | Li X, Xie X, Lian W, Shi R, Han S, Zhang H, Lu L, Li M. Exosomes from adipose-derived stem cells overexpressing Nrf2 accelerate cutaneous wound healing by promoting vascularization in a diabetic foot ulcer rat model. Exp Mol Med. 2018;50:1-14. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 317] [Cited by in RCA: 345] [Article Influence: 43.1] [Reference Citation Analysis (6)] |
| 4. | Wu P, Zhang B, Shi H, Qian H, Xu W. MSC-exosome: A novel cell-free therapy for cutaneous regeneration. Cytotherapy. 2018;20:291-301. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 262] [Cited by in RCA: 231] [Article Influence: 28.9] [Reference Citation Analysis (1)] |
| 5. | Wu F, Song C, Zhen G, Jin Q, Li W, Liang X, Xu W, Guo W, Yang Y, Dong W, Jiang A, Kong P, Yan J. Exosomes derived from BMSCs in osteogenic differentiation promote type H blood vessel angiogenesis through miR-150-5p mediated metabolic reprogramming of endothelial cells. Cell Mol Life Sci. 2024;81:344. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 19] [Reference Citation Analysis (0)] |
| 6. | Yang L, Li X, Jiang A, Li X, Chang W, Chen J, Ye F. Metformin alleviates lead-induced mitochondrial fragmentation via AMPK/Nrf2 activation in SH-SY5Y cells. Redox Biol. 2020;36:101626. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 96] [Cited by in RCA: 90] [Article Influence: 15.0] [Reference Citation Analysis (0)] |
| 7. | He L, He T, Xing J, Zhou Q, Fan L, Liu C, Chen Y, Wu D, Tian Z, Liu B, Rong L. Bone marrow mesenchymal stem cell-derived exosomes protect cartilage damage and relieve knee osteoarthritis pain in a rat model of osteoarthritis. Stem Cell Res Ther. 2020;11:276. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 350] [Cited by in RCA: 325] [Article Influence: 54.2] [Reference Citation Analysis (0)] |
| 8. | Gu J, You J, Liang H, Zhan J, Gu X, Zhu Y. Engineered bone marrow mesenchymal stem cell-derived exosomes loaded with miR302 through the cardiomyocyte specific peptide can reduce myocardial ischemia and reperfusion (I/R) injury. J Transl Med. 2024;22:168. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 3] [Cited by in RCA: 47] [Article Influence: 23.5] [Reference Citation Analysis (0)] |
| 9. | Liu Y, Guo Y, Bao S, Huang H, Liu W, Guo W. Bone marrow mesenchymal stem cell-derived exosomal microRNA-381-3p alleviates vascular calcification in chronic kidney disease by targeting NFAT5. Cell Death Dis. 2022;13:278. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 39] [Article Influence: 9.8] [Reference Citation Analysis (0)] |
| 10. | de Marañón AM, Canet F, Abad-Jiménez Z, Jover A, Morillas C, Rocha M, Victor VM. Does Metformin Modulate Mitochondrial Dynamics and Function in Type 2 Diabetic Patients? Antioxid Redox Signal. 2021;35:377-385. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 12] [Cited by in RCA: 21] [Article Influence: 4.2] [Reference Citation Analysis (0)] |
| 11. | Zhou C, Zhang B, Yang Y, Jiang Q, Li T, Gong J, Tang H, Zhang Q. Stem cell-derived exosomes: emerging therapeutic opportunities for wound healing. Stem Cell Res Ther. 2023;14:107. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 277] [Cited by in RCA: 245] [Article Influence: 81.7] [Reference Citation Analysis (4)] |
| 12. | Ma Y, She X, Liu Y, Qin X. MSC-derived exosomal miR-140-3p improves cognitive dysfunction in sepsis-associated encephalopathy by HMGB1 and S-lactoylglutathione metabolism. Commun Biol. 2024;7:562. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1] [Cited by in RCA: 24] [Article Influence: 12.0] [Reference Citation Analysis (0)] |
| 13. | Toury L, Frankel D, Airault C, Magdinier F, Roll P, Kaspi E. miR-140-5p and miR-140-3p: Key Actors in Aging-Related Diseases? Int J Mol Sci. 2022;23:11439. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 20] [Reference Citation Analysis (0)] |
| 14. | Long X, Li J, Wen F, Cao Y, Luo Z, Luo C. miR-140-3p attenuated the tumorigenesis of multiple myeloma via attenuating BZW2. Hematology. 2022;27:173-180. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 7] [Cited by in RCA: 11] [Article Influence: 2.8] [Reference Citation Analysis (0)] |
| 15. | Wang D, Wang H, Liu C, Mu X, Cheng S. Hyperglycemia inhibition of endothelial miR-140-3p mediates angiogenic dysfunction in diabetes mellitus. J Diabetes Complications. 2019;33:374-382. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 14] [Cited by in RCA: 22] [Article Influence: 3.1] [Reference Citation Analysis (0)] |
| 16. | Weil BR, Abarbanell AM, Herrmann JL, Wang Y, Meldrum DR. High glucose concentration in cell culture medium does not acutely affect human mesenchymal stem cell growth factor production or proliferation. Am J Physiol Regul Integr Comp Physiol. 2009;296:R1735-R1743. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 68] [Cited by in RCA: 69] [Article Influence: 4.1] [Reference Citation Analysis (0)] |
| 17. | Chen W, Yang J, Chen S, Xiang H, Liu H, Lin D, Zhao S, Peng H, Chen P, Chen AF, Lu H. Importance of mitochondrial calcium uniporter in high glucose-induced endothelial cell dysfunction. Diab Vasc Dis Res. 2017;14:494-501. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 14] [Cited by in RCA: 26] [Article Influence: 2.9] [Reference Citation Analysis (0)] |
| 18. | Shi R, Jin Y, Zhao S, Yuan H, Shi J, Zhao H. Hypoxic ADSC-derived exosomes enhance wound healing in diabetic mice via delivery of circ-Snhg11 and induction of M2-like macrophage polarization. Biomed Pharmacother. 2022;153:113463. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 119] [Cited by in RCA: 114] [Article Influence: 28.5] [Reference Citation Analysis (2)] |
| 19. | Wang X, Jiao Y, Pan Y, Zhang L, Gong H, Qi Y, Wang M, Gong H, Shao M, Wang X, Jiang D. Fetal Dermal Mesenchymal Stem Cell-Derived Exosomes Accelerate Cutaneous Wound Healing by Activating Notch Signaling. Stem Cells Int. 2019;2019:2402916. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 92] [Cited by in RCA: 98] [Article Influence: 14.0] [Reference Citation Analysis (5)] |
| 20. | Doyle LM, Wang MZ. Overview of Extracellular Vesicles, Their Origin, Composition, Purpose, and Methods for Exosome Isolation and Analysis. Cells. 2019;8:727. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 2821] [Cited by in RCA: 2507] [Article Influence: 358.1] [Reference Citation Analysis (5)] |
| 21. | Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science. 2020;367:eaau6977. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 9106] [Cited by in RCA: 8207] [Article Influence: 1367.8] [Reference Citation Analysis (16)] |
| 22. | Zhou W, Silva M, Feng C, Zhao S, Liu L, Li S, Zhong J, Zheng W. Exosomes derived from human placental mesenchymal stem cells enhanced the recovery of spinal cord injury by activating endogenous neurogenesis. Stem Cell Res Ther. 2021;12:174. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 9] [Cited by in RCA: 76] [Article Influence: 15.2] [Reference Citation Analysis (4)] |
| 23. | Peng X, He F, Mao Y, Lin Y, Fang J, Chen Y, Sun Z, Zhuo Y, Jiang J. miR-146a promotes M2 macrophage polarization and accelerates diabetic wound healing by inhibiting the TLR4/NF-κB axis. J Mol Endocrinol. 2022;69:315-327. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 63] [Cited by in RCA: 54] [Article Influence: 13.5] [Reference Citation Analysis (0)] |
| 24. | Wang J, Wu H, Peng Y, Zhao Y, Qin Y, Zhang Y, Xiao Z. Hypoxia adipose stem cell-derived exosomes promote high-quality healing of diabetic wound involves activation of PI3K/Akt pathways. J Nanobiotechnology. 2021;19:202. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 234] [Cited by in RCA: 234] [Article Influence: 46.8] [Reference Citation Analysis (6)] |
| 25. | Nallakumarasamy A, Jeyaraman M, Maffulli N, Jeyaraman N, Suresh V, Ravichandran S, Gupta M, Potty AG, El-Amin SF 3rd, Khanna M, Gupta A. Mesenchymal Stromal Cell-Derived Extracellular Vesicles in Wound Healing. Life (Basel). 2022;12:1733. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 11] [Cited by in RCA: 13] [Article Influence: 3.3] [Reference Citation Analysis (0)] |
| 26. | Shin KO, Ha DH, Kim JO, Crumrine DA, Meyer JM, Wakefield JS, Lee Y, Kim B, Kim S, Kim HK, Lee J, Kwon HH, Park GH, Lee JH, Lim J, Park S, Elias PM, Park K, Yi YW, Cho BS. Exosomes from Human Adipose Tissue-Derived Mesenchymal Stem Cells Promote Epidermal Barrier Repair by Inducing de Novo Synthesis of Ceramides in Atopic Dermatitis. Cells. 2020;9:680. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 93] [Cited by in RCA: 150] [Article Influence: 25.0] [Reference Citation Analysis (0)] |
| 27. | Shi J, Ma X, Su Y, Song Y, Tian Y, Yuan S, Zhang X, Yang D, Zhang H, Shuai J, Cui W, Ren F, Plikus MV, Chen Y, Luo J, Yu Z. MiR-31 Mediates Inflammatory Signaling to Promote Re-Epithelialization during Skin Wound Healing. J Invest Dermatol. 2018;138:2253-2263. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 88] [Cited by in RCA: 100] [Article Influence: 12.5] [Reference Citation Analysis (0)] |
| 28. | Bao H, Chen YX, Huang K, Zhuang F, Bao M, Han Y, Chen XH, Shi Q, Yao QP, Qi YX. Platelet-derived microparticles promote endothelial cell proliferation in hypertension via miR-142-3p. FASEB J. 2018;32:3912-3923. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 45] [Cited by in RCA: 65] [Article Influence: 8.1] [Reference Citation Analysis (0)] |
| 29. | Gidlöf O, van der Brug M, Ohman J, Gilje P, Olde B, Wahlestedt C, Erlinge D. Platelets activated during myocardial infarction release functional miRNA, which can be taken up by endothelial cells and regulate ICAM1 expression. Blood. 2013;121:3908-3917, S1. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 234] [Cited by in RCA: 219] [Article Influence: 16.8] [Reference Citation Analysis (0)] |
| 30. | Gaspar RS, Ferreira PM, Mitchell JL, Pula G, Gibbins JM. Platelet-derived extracellular vesicles express NADPH oxidase-1 (Nox-1), generate superoxide and modulate platelet function. Free Radic Biol Med. 2021;165:395-400. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 13] [Cited by in RCA: 33] [Article Influence: 6.6] [Reference Citation Analysis (0)] |
| 31. | Hu L, Wang J, Zhou X, Xiong Z, Zhao J, Yu R, Huang F, Zhang H, Chen L. Author Correction: Exosomes derived from human adipose mensenchymal stem cells accelerates cutaneous wound healing via optimizing the characteristics of fibroblasts. Sci Rep. 2020;10:6693. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 1] [Cited by in RCA: 14] [Article Influence: 2.3] [Reference Citation Analysis (0)] |
| 32. | Sang Z, Dong S, Zhang P, Wei Y. miR‑214 ameliorates sepsis‑induced acute kidney injury via PTEN/AKT/mTOR‑regulated autophagy. Mol Med Rep. 2021;24:683. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 7] [Cited by in RCA: 39] [Article Influence: 7.8] [Reference Citation Analysis (0)] |
| 33. | Ma M, Fu L, Jia Z, Zhong Q, Huang Z, Wang X, Fan Y, Lin T, Song T. miR-17-5p attenuates kidney ischemia-reperfusion injury by inhibiting the PTEN and BIM pathways. Ann Transl Med. 2021;9:1545. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 4] [Cited by in RCA: 8] [Article Influence: 1.6] [Reference Citation Analysis (0)] |
| 34. | Zhong XQ, Wang D, Chen S, Zheng J, Hao TF, Li XH, Luo LH, Gu J, Lian CY, Li XS, Chen DJ. Umbilical cord blood-derived exosomes from healthy term pregnancies protect against hyperoxia-induced lung injury in mice. Clin Transl Sci. 2023;16:966-977. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 14] [Reference Citation Analysis (0)] |
| 35. | Song Y, Wang B, Zhu X, Hu J, Sun J, Xuan J, Ge Z. Human umbilical cord blood-derived MSCs exosome attenuate myocardial injury by inhibiting ferroptosis in acute myocardial infarction mice. Cell Biol Toxicol. 2021;37:51-64. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 170] [Cited by in RCA: 281] [Article Influence: 56.2] [Reference Citation Analysis (3)] |
| 36. | Liang X, Miao Y, Tong X, Chen J, Liu H, He Z, Liu A, Hu Z. Dental pulp mesenchymal stem cell-derived exosomes inhibit neuroinflammation and microglial pyroptosis in subarachnoid hemorrhage via the miRNA-197-3p/FOXO3 axis. J Nanobiotechnol. 2024;22:426. [RCA] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 33] [Reference Citation Analysis (0)] |
| 37. | Shi J, Gao W, Shao F. Pyroptosis: Gasdermin-Mediated Programmed Necrotic Cell Death. Trends Biochem Sci. 2017;42:245-254. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 2678] [Cited by in RCA: 2493] [Article Influence: 277.0] [Reference Citation Analysis (2)] |
| 38. | Xie D, Yu L, Wang Z, Qiu G, Ouyang S. Exosomes derived from human umbilical cord mesenchymal stem cells inhibit hepatocyte pyroptosis via miR-423-5p/ZBP1 in acute liver failure. Hum Cell. 2025;38:124. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 3] [Reference Citation Analysis (0)] |
| 39. | Kostura MJ, Tocci MJ, Limjuco G, Chin J, Cameron P, Hillman AG, Chartrain NA, Schmidt JA. Identification of a monocyte specific pre-interleukin 1 beta convertase activity. Proc Natl Acad Sci U S A. 1989;86:5227-5231. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 355] [Cited by in RCA: 392] [Article Influence: 10.6] [Reference Citation Analysis (4)] |