BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Stem Cells. Jun 26, 2025; 17(6): 106488
Published online Jun 26, 2025. doi: 10.4252/wjsc.v17.i6.106488
Mesenchymal stem cells-derived exosomes alleviate radiation induced pulmonary fibrosis by inhibiting the protein kinase B/nuclear factor kappa B pathway
Li-Li Wang, Ming-Yue Ouyang, Zi-En Yang, Si-Ning Xing, Song Zhao, Hui-Ying Yu, Laboratory of Basic Medicine, General Hospital of Northern Theater Command, Shenyang 110016, Liaoning Province, China
ORCID number: Hui-Ying Yu (0000-0002-8703-9754).
Author contributions: Wang LL and Yu HY designed the experiments; Wang LL, Ouyang MY, Yang ZE, Xing SN, and Zhao S performed the experiments; Wang LL, Ouyang MY, and Yang ZE analyzed the experiment data and wrote this manuscript; Yu HY reviewed the manuscript and supervised all the work. All authors have read and approved the final version of the manuscript.
Supported by Natural Science Foundation of Liaoning Province, No. 2024-MS-250.
Institutional review board statement: This study was approved by the Northern Theater Command General Hospital Ethics Committee [approval number: Y(2024)100].
Institutional animal care and use committee statement: All animal care and experimental procedures followed the National Research Council’s Guidelines for the Care and Use of Laboratory Animals and were approved by the Northern Theater Command General Hospital Ethics Committee (approval number: 2023-25).
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: The data used to support the findings of this study are available from the corresponding author upon request.
Corresponding author: Hui-Ying Yu, PhD, Laboratory of Basic Medicine, General Hospital of Northern Theater Command, No. 83 Wenhua Road, Shenyang 110016, Liaoning Province, China. hyingy@sina.com
Received: February 28, 2025
Revised: April 14, 2025
Accepted: May 28, 2025
Published online: June 26, 2025
Processing time: 118 Days and 8 Hours

Abstract
BACKGROUND

Radiation induced pulmonary fibrosis (RIPF) is a long-term lung condition with a bleak outlook and few treatment possibilities. Mesenchymal stem cells (MSCs)-derived exosomes (MSCs-exosomes) possess tissue repair and regenerative properties, but their exact mechanisms in RIPF remain unclear. This study explores whether MSCs-exosomes can alleviate RIPF by modulating inflammation, extracellular matrix (ECM) accumulation, and epithelial-mesenchymal transition (EMT) via the protein kinase B (Akt)/nuclear factor kappa B (NF-κB) pathway.

AIM

To assess the therapeutic potential and mechanisms of MSCs-exosomes in RIPF.

METHODS

Sprague-Dawley rats were received 30 Gy X-ray radiation on the right chest to induce RIPF, while RLE-6TN and BEAS-2B cell lines were exposed to 10 Gy X-rays. Using differential centrifugation, MSCs-exosomes were isolated, and their protective effects were examined both in vivo and in vitro. Inflammatory cytokine concentrations were measured using Luminex liquid chip detection and enzyme linked immunosorbent assay. ECM and EMT-related proteins were analyzed using immunohistochemistry, western blotting, and real-time quantitative polymerase chain reaction. Western blotting and immunohistochemistry were also used to investigate the mechanisms underlying MSCs-exosomes’ effects in RIPF.

RESULTS

Administration of MSCs-exosomes significantly mitigated RIPF, reduced collagen deposition, and decreased levels of various inflammatory cytokines. Additionally, MSCs-exosomes prevented radiation-induced ECM accumulation and EMT. Treatment with MSCs-exosomes notably promoted cell proliferation, suppressed inflammation, and reversed ECM deposition and EMT in radiation-exposed alveolar epithelial cells. Mechanistic analysis further revealed that MSCs-exosomes exerted their anti-RIPF effects by inhibiting the Akt/NF-κB pathway, as shown in both in vivo and in vitro models.

CONCLUSION

MSCs-exosomes mitigate RIPF by suppressing inflammation, ECM deposition, and EMT through Akt/NF-κB inhibition, highlighting their potential as a therapeutic strategy.

Key Words: Mesenchymal stem cells; Exosomes; Radiation induced pulmonary fibrosis; Protein kinase B; Nuclear factor kappa B

Core Tip: Mesenchymal stem cells-derived exosomes were demonstrated protective properties against radiation induced pulmonary fibrosis in rat models and lung epithelial cell models. Moreover, these exosomes were shown to reverse the expression of key components involved in the buildup of extracellular matrix and epithelial-mesenchymal transition due to radiation by inhibiting the protein kinase B/nuclear factor kappa B pathway. This inhibition prevented fibrosis progression and facilitated the recovery and proliferation of damaged lung epithelial cells. These findings offer new insights into potential treatment strategies for radiation-induced pulmonary fibrosis.



INTRODUCTION

Radiation-induced lung injury (RILI) is the main toxicity limiting thoracic radiotherapy doses[1]. This condition manifests initially as post-irradiation pneumonitis and progresses to irreversible fibrosis, which is linked to a high incidence rate[2]. Radiation induced pulmonary fibrosis (RIPF) is a chronic, worsening, and deadly lung disease with poor outcomes and few treatment options[3]. RIPF severely affecte quality of life, often causing respiratory failure or death[4]. There is an urgent need for new treatments due to the lack of effective options.

Fibroblasts are crucial in RIPF by driving myofibroblast differentiation and extracellular matrix (ECM) protein production[5]. Epithelial-mesenchymal transition (EMT), triggered by alveolar epithelial cell injury, directly forms fibroblasts and generates pro-inflammatory signals that cause cell damage[6]. During EMT, alveolar epithelial cells temporarily gain mesenchymal traits, increasing interaction with mesenchymal cells[7]. Chronic injury, inflammation, and hypoxia lead activated fibroblasts to deposit excessive ECM, disrupting lung structure and gas exchange. This positive feedback loop perpetuates pulmonary fibrosis[8]. The protein kinase B (Akt) pathway is vital in fibrosis, regulating EMT by reducing E-cadherin expression via transcription factors like Snail, which promotes EMT progression[9]. Phosphatidylinositol 3-kinase (PI3K)/Akt pathway activation induces the expression of Snail, an EMT-associated transcription factor, thereby promoting EMT progression[10]. Dysregulated inflammation often leads to pathological conditions such as fibrosis and cancer. Increasing evidence highlights the link between inflammation and EMT, which is implicated in fibrosis development[11]. For instance, tumor necrosis factor-alpha (TNF-α)-induced EMT has been shown to be mediated by Snail stabilization through the PI3K/Akt/glycogen synthase kinase 3β pathway[12]. Consequently, ECM production and EMT induced by profibrogenic signaling represent a key pathogenic mechanism and a potential therapeutic target for RIPF.

Mesenchymal stem cells (MSCs) therapy has shown potential as a treatment for pulmonary fibrosis because of its ability to modulate the immune system, reduce inflammation, and regenerate tissue, helping to restore the balance needed for healing. However, preclinical studies reveal significant challenges in translating the therapeutic potential of MSCs into clinical applications[13]. To address these challenges, several studies have shown that MSCs-derived conditioned medium (CM) captures many of the therapeutic features of the parental cells, suggesting that MSCs-derived CM components (such as soluble factors) and exosomes may offer viable cell-free strategies for further exploration[14,15]. MSCs-derived exosomes (MSCs-exosomes) are small extracellular vesicles (50-100 nm) that deliver mRNAs, microRNAs (miRNAs), and proteins to target cells, altering their biological properties. Their small size allows efficient circulation and targeting of injured sites, and they have low immunogenicity due to the absence of major histocompatibility complex antigens, making them a promising cell-free therapy[16,17]. Studies have shown that these exosomes can reverse radiation damage and alleviate lung injury by transferring specific miRNAs[18,19].

In this study, the protective effects of MSCs-exosomes were confirmed in RIPF rat models and lung epithelial cell models. Additionally, MSCs-exosomes inhibited key components of radiation-induced ECM and EMT through the Akt/nuclear factor kappa B (NF-κB) pathway, preventing fibrosis and promoting the recovery and proliferation of damaged lung epithelial cells. The findings suggest new treatment strategies for RIPF.

MATERIALS AND METHODS
Isolation and identification of MSCs

MSCs were isolated from human umbilical cord and cultured in DMEM/F12 medium (BasalMedia Biotechnology Inc, China) with 10% fetal bovine serum (FBS), as previously described[20]. Once cell density reached 90%, cells were washed, trypsinized, centrifuged, and passaged. MSCs from the 3rd to 5th generations were used in subsequent experiments. Flow cytometry analysis was performed using antibodies against CD73-PE, HLA-DR-FITC, CD19-FITC, CD105-PE, CD14-APC, CD34-APC, CD90-PE, and CD45-PerCP (BD Biosciences, CA, United States), with immunoglobulin G isotypes as controls, and analyzed using a FACS Canto flow cytometer. MSCs morphology was assessed using an optical microscope. The adipogenic, osteogenic, and chondrogenic capacities of MSCs were evaluated through Oil Red O, Alizarin Red, and Alcian Blue staining.

Isolation and characterization of exosomes

MSCs were cultured in a medium supplemented with 10% exosome-free FBS for 48 hours. MSCs culture medium was collected and subjected to gradient centrifugation to obtain e exosomes, followed by storage at -80 °C for further experiments. The size of exosomes was measured using nanoparticle tracking analysis, and the morphology was assessed through transmission electron microscopy. Exosome markers tumor susceptibility gene 101, CD9, and ALIX were identified using western blotting.

Experimental animals and RIPF rat model establishment

The study was approved by the Northern Theater Command General Hospital Ethics Committee (approval number: 2023-25). All authors complied with the ARRIVE guidelines. Efforts were made to minimize animal discomfort and pain, and humane endpoints were defined as the presence of dyspnea and body weight loss ≥ 20%. Seventy-two 8-9-week-old male Sprague-Dawley rats were randomly divided into three groups: Normal control (n = 24, control + phosphate buffered saline), irradiation (n = 24, irradiation + phosphate buffered saline), and irradiation + exosomes (n = 24, IR + EXO). Anesthesia was administered through intraperitoneal injection of sodium pentobarbital at 40 mg/kg. Except for the control group, all other groups were received a single 30 Gy radiation dose to the right chest (Elekta, Sweden). The IR + EXO group received an intravenous (tail vein) dose of 1 × 1010 particles/kg exosomes, administered 2 hours post-radiation, followed by the same dose two weeks later. Rats were humanely sacrificed at 2, 4, 8, and 16 weeks to collect serum, bronchoalveolar lavage fluid (BALF), and right lung tissue for further analysis.

Computed tomography analysis of rats’ lungs

At 16 weeks, rats from each group were randomly selected and anesthetized for micro-computed tomography (CT) analysis. Their lungs were scanned with a micro-CT system (PerkinElmer, MA, United States).

Histological analysis

The right lungs were fixed overnight in 4% paraformaldehyde, embedded in paraffin, and sectioned at 5 μm. Hematoxylin and eosin staining was used to assess pulmonary fibrosis with the modified Ashcroft score[21], while Masson’s Trichrome staining evaluated collagen content, quantified as the percentage of blue-colored collagen area using ImageJ software.

Hydroxyproline assay

Collagen content in the right lungs was quantified by measuring hydroxyproline (HYP) content using a HYP detection kit (Solarbio, China), following the manufacturer’s instructions.

Luminex liquid chip

Following treatment with MSCs-exosomes for 2, 4, 8, and 16 weeks, whole blood was collected from the orbits of the rats and centrifuged (10000 rpm for 10 minutes). Supernatants from each group were analyzed using a Luminex liquid chip (Luminex 200, TX, United States) to measure the levels of interleukin (IL)-1β, IL-2, IL-6, IL-12p70, TNF-α, and interferon (IFN)-γ.

Protein concentration in BALF

The left bronchus in each rat was tied, and 0.5 mL phosphate buffered saline was used to wash the right lung. The lavage fluid was pooled, centrifuged, and the supernatant was used to measure total protein in BALF with BCA kits (Thermo, MA, United States).

Immunohistochemical assay

Right lung tissues were fixed in 4% formaldehyde for 24 hours, deparaffinized with xylene, dehydrated using alcohol, embedded in paraffin wax, and sliced into 4 μm sections. Primary antibodies against transforming growth factor (TGF)-β1, IL-6, IL-1β, CD3, CD68, E-cadherin, vimentin, alpha-smooth muscle actin (α-SMA), collagen type 1 alpha 1 (COL1A1), p-Akt, p-IkappaB kinase (IKK) α/β, and p-NF-κB p65 were used to immunostain these sections overnight at 4 °C. The second antibody and color were applied according to the diaminobenzidine tetrahydrochloride kit’s instructions. Sections were visualized under a microscope (ZEISS Axio Imager.A2, Germany).

Cell culture and treatment

Rat alveolar (RLE-6TN) and human bronchial (BEAS-2B) epithelial cells were cultured in DMEM/F12 with 10% FBS at 37 °C, 5% CO2. At 70%-80% density, cells were exposed to 10 Gy radiation and treated with or without 5 × 108 particles/mL exosomes for 48 hours.

CCK8 assay

RLE-6TN and BEAS-2B cells were exposed to 10 Gy radiation and treated with or without 5 × 108 particles /mL exosomes. Cells were plated at 3000 per well in 96-well plates. After treatment, CCK8 reagent (Absin, China) was added, and proliferation was measured at 24, 48, and 72 hours via absorbance at 450 nm.

Real-time quantitative polymerase chain reaction

Total RNA was extracted from cells with Trizol (Sigma-Aldrich, MA, United States). The RNA was reverse-transcribed into cDNA using PrimeScript RT Master Mix (Takara, Japan). Real-time quantitative polymerase chain reaction (RT-qPCR) was conducted on an ABI7500 system (Applied Biosystems, MA, United States) with the SYBR-Green Kit (Takara, Japan). The PCR cycle included pre-denaturation at 95 °C for 1 minute, denaturation at 95 °C for 15 seconds, and annealing/extension at 60 °C for 1 minute over 40 cycles. To determine the relative expression levels of the target genes, the 2-ΔΔCt method was employed with GAPDH serving as the internal control[22]. Primer sequences were in Table 1.

Table 1 Sequence information of primers used for real-time quantitative polymerase chain reaction.
Gene
Forward (5’-3’)
Reverse (5’-3’)
r-TGF-β1ATGGTGGACCGCAACAACGATCTCTGCAGGCGCAGCTCT
r-IL-6TTCACAGAGGATACCACCCACAAATCAGAATTGCCATTGCACAA
r-IL-1βAGAGACAAGCAACGACAAAATCCTCTTCTTTGGGTATTGTTTGGGA
r-E-cadherinGATATGTATGGTGGCGGCGACAGACAGACTGGTAGGTAGAGTGGG
r-vimentinGGACCTGCTCAATGTAAAGATGGGACTCCAGGTTAGTTTCTCTCAGGT
r-α-SMAGACCCTGAAGTATCCGATAGAACACACGCGAAGCTCGTTATAGAAG
r-COL1A1TGCCGATGTCGCTATCCATCTTGCAGTGATAGGTGATGTTCTG
r-GAPDHGACAAGATGGTGAAGGTCGGTGTGTAGTTGAGGTCAATGAAGGGGT
h-E-cadherinCTGAGAACGAGGCTAACGGTCCACCATCATCATTCAATAT
h-vimentinTTGAACGCAAAGTGGAATCGGTCAGGCTTGGAAACATC
h-α-SMAGTCCACCGCAAATGCTTCTAAAACACATAGGTAACGAGTCAG
h-COL1A1CGAAGACATCCCACCAATCATCACGTCATCGCACAACA
h-GAPDHGAAGGTGAAGGTCGGAGTCGAAGATGGTGATGGGATTTC
Enzyme linked immunosorbent assay

TNF-α, IL-6, IL-1β, and IL-10 levels in BALF or cell supernatants were determined by enzyme linked immunosorbent assay (R&D Systems, MN, United States).

Western blotting

Proteins were extracted with RIPA buffer, separated by sodium-dodecyl sulfate gel electrophoresis on 6%-12% gels, and transferred to polyvinylidene difluoride. After blocking with TBS-T and 5% nonfat milk for 2 hours, the membranes were incubated with primary antibodies [E-cadherin (1:1000), vimentin (1:1000), α-SMA (1:500), COL1A1 (1:1000), Akt (1:1000), p-Akt (1:500), IKKα (1:1000), p-IKKα/β (1:500), NF-κB p65 (1:500), p-NF-κB p65 (1:500), and GAPDH (1:3000)] overnight at 4 °C. Afterward, HRP-conjugated secondary antibodies were applied for 2 hours. Detection was performed using SuperSignalTM West Pico PLUS Luminol/Enhancer (Thermo, MA, United States), and densitometric analysis was conducted using ImageJ software.

Statistical analysis

Each experiment was repeated three times. One-way analysis of variance (ANOVA) and Student’s t-test were used for intergroup comparisons with GraphPad Prism 9.0 software. A P value < 0.05 was considered statistically significant.

RESULTS
Characteristics of MSCs and their exosomes

The proportions of stem cell markers CD105, CD90, and CD73 in MSCs were 99.5%, 99.3%, and 98.5%, respectively, while the negative stem cell markers CD45, CD34, CD14, CD19, and HLA-DR were present at 0.25%, 0.58%, 0.31%, 0.10%, and 0.38%, respectively (Figure 1A). Upon induction with the appropriate medium, MSCs demonstrated osteogenic, chondrogenic, and adipogenic differentiation (Figure 1B). Exosomes were isolated and purified from MSCs-derived CM. According to transmission electron microscopy analysis, exosomes displayed the usual cup-shaped appearance (Figure 1C). Nanoparticle tracking analysis results showed that the average size of the purified exosome particles was 106.27 ± 6.18 nm, with a concentration of 3.4E+10 particles per mL (Figure 1D). The exosomes expressed specific markers, including tumor susceptibility gene 101, ALIX, and CD9 (Figure 1E). Based on these results, the isolated exosomes met the criteria for exosome identification.

Figure 1
Figure 1 Identification of mesenchymal stem cells and mesenchymal stem cells-derived exosomes. A: Identification of mesenchymal stem cells surface marker proteins (CD105, CD90, CD73, D45, CD34, CD14, CD19 and HLA-DR) by flow cytometry; B: The morphology (× 100) of mesenchymal stem cells, and identification of osteogenic (× 100), chondrogenic (× 100) and adipogenic (× 100) differentiation abilities of mesenchymal stem cells; C: Electron microscopic image of exosomes; D: Particle diameter of exosomes detected by nanoparticle tracking analysis; E: Western blot assay utilized for the detection of the surface marker proteins (ALIX, tumor susceptibility gene 101 and CD9) of exosomes (n = 1). EXO: Exosomes; MSCs: Mesenchymal stem cells; TSG101: Tumor susceptibility gene 101.
Therapeutic efficacy of MSCs-exosomes in RIPF rats

To evaluate whether MSCs-exosomes could protect against RIPF, the therapeutic effects of MSCs-exosomes were assessed (Figure 2A). Pulmonary fibrosis was evaluated 16 weeks post-radiation exposure. Notably, the radiation-exposed rats showed a significant reduction in body weight, which was partially prevented by MSCs-exosomes treatment (Figure 2B). CT imaging of the IR group revealed reticular changes and irregular septal thickening, typical of pulmonary fibrosis. In comparison to the IR group, MSCs-exosomes significantly reduced radiologically detectable lung damage, with an increase in lung density (Figure 2C). In the IR group, the right lung was notably reduced in volume and firm in texture, while the left lung appeared enlarged and dark red (Figure 2C). In contrast, the EXO group exhibited mild atrophy in the right lung, with gray and white spots, while the left lung was enlarged (Figure 2C). Consistent with these results, MSCs-exosomes alleviated radiation-induced pathological changes, including thickened alveolar walls, disrupted alveolar structure, and excessive collagen deposition, as observed in hematoxylin and eosin and Masson’s Trichrome staining (Figure 2D). The Ashcroft score and area percentage of collagen quantitatively demonstrated a decrease in fibrotic lesions in rats treated with MSCs-exosomes (Figure 2E and F). Moreover, the EXO group showed a significant reduction in HYP, a crucial element of collagen (Figure 2G). Taken together, these results suggested that MSCs-exosomes represented a promising therapeutic agent for alleviating RIPF.

Figure 2
Figure 2 Therapeutic efficacy of mesenchymal stem cells-derived exosomes in radiation induced pulmonary fibrosis rats. A: Schematic diagram of the strategy for radiation induced pulmonary fibrosis in rats; B: Changes of body weight of rats in each group (n = 6); C: Computed tomography images of rat lungs and morphological changes in lung tissue; D: Hematoxylin and eosin staining and Masson staining of lung tissue among different groups; E: Quantification of fibrosis by Ashcroft score (n = 6); F: Quantification of area percentage of collagen (n = 6); G: Hydroxyproline content in lung tissues (n = 6). aP < 0.05 vs control + phosphate buffered saline, bP < 0.01 vs control + phosphate buffered saline, cP < 0.0001 vs control + phosphate buffered saline, dP < 0.0001 vs irradiation + phosphate buffered saline. CON: Control; PBS: Phosphate buffered saline; IR: Irradiation; EXO: Exosomes; HYP: Hydroxyproline.
MSCs-exosomes ameliorated radiation-induced inflammation in RIPF rats

An exaggerated inflammatory response contributes significantly to RIPF development[23]. To evaluate alterations in circulating inflammatory cytokine profiles following RIPF, serum levels of IL-1β, IL-2, IL-6, IL-12p70, IFN-γ, and TNF-α were quantified at 2, 4, 8, and 16 weeks post-radiation exposure. Compared to the IR group, the EXO group showed a significant reduction in all cytokine levels (P < 0.05, Figure 3A-F). To evaluate lung microvascular permeability in vivo, the total protein concentration in BALF was measured. Radiation significantly increased protein leakage into the BALF, a response substantially mitigated by MSCs-exosomes treatment (P < 0.05, Figure 3G). At 16 weeks post-radiation, IL-6 and TNF-α levels in BALF were significantly elevated but were suppressed by MSCs-exosomes (P < 0.05, Figure 3H and I). In lung tissue, mRNA levels of TGF-β1, IL-6, and IL-1β were lower in the EXO group than in the IR group (P < 0.05, Figure 3J). Correspondingly, protein expression of these cytokines was reduced in the lung tissue of the EXO group (Figure 3K). Immunohistochemical staining showed increased CD3 (T cell marker) and CD68 (macrophage marker) cell infiltration in the IR group, which was reduced in the EXO group (Figure 3L). These findings implied that MSCs-exosomes may attenuate radiation-induced inflammatory cytokine production.

Figure 3
Figure 3 Mesenchymal stem cells-derived exosomes ameliorated radiation induced inflammation in radiation induced pulmonary fibrosis rats. A-F: Changes in the level of inflammatory cytokines [interleukin (IL)-1β, IL-2, IL-6, IL-12p70, interferon-γ and tumor necrosis factor-α] of serum samples collected at different time points in three groups (n = 6); G: The total protein concentration in bronchoalveolar lavage fluid of rats at 16 weeks (n = 6); H and I: Changes in inflammatory factors (IL-6 and tumor necrosis factor-α) in rat bronchoalveolar lavage fluid at 16 weeks (n = 6); J: Real-time quantitative polymerase chain reaction detection of transforming growth factor-β1, IL-6 and IL-1β mRNA levels in rat lung tissue (n = 6); K and L: Immunohistochemical staining to observe the staining intensity of transforming growth factor-β1, IL-6, IL-1β, CD3 and CD68 in rat lung tissue. aP < 0.05 vs control + phosphate buffered saline, bP < 0.01 vs control + phosphate buffered saline, cP < 0.001 vs control + phosphate buffered saline, dP < 0.0001 vs control + phosphate buffered saline, eP < 0.05 vs irradiation + phosphate buffered saline, fP < 0.01 vs irradiation + phosphate buffered saline, gP < 0.001 vs irradiation + phosphate buffered saline, hP < 0.0001 vs irradiation + phosphate buffered saline. CON: Control; IR: Irradiation; EXO: Exosomes; PBS: Phosphate buffered saline; IL: Interleukin; IFN: Interferon; TNF: Tumor necrosis factor; TGF: Transforming growth factor; BALF: Bronchoalveolar lavage fluid.
MSCs-exosomes suppressed radiation-induced ECM and EMT in RIPF rats

ECM remodeling and EMT are pivotal in the accumulation of myofibroblasts during the fibrotic process[24,25]. To determine whether MSCs-exosomes influence ECM and EMT markers, immunohistochemical analysis, western blotting, and RT-qPCR were performed on lung tissue. α-SMA and COL1A1 are key ECM components. In the IR rats, α-SMA and COL1A1 levels were significantly elevated, but these alterations were markedly inhibited by EXO treatment (Figure 4A). EMT activation is linked to myofibroblast generation[26]. In the present study, EXO treatment led to a downregulation of vimentin protein and an upregulation of E-cadherin protein levels in the EXO group (Figure 4A). Western blotting further confirmed that EXO reduced α-SMA, COL1A1, and vimentin protein levels while increasing E-cadherin protein expression in lung tissue (Figure 4B and C). RT-qPCR analysis revealed similar effects (Figure 4D). These results indicate that MSCs-exosomes may exert anti-fibrotic effects by inhibiting radiation-induced ECM deposition and EMT progression.

Figure 4
Figure 4 Mesenchymal stem cells-derived exosomes suppressed radiation induced extracellular matrix and epithelial-mesenchymal transition in radiation induced pulmonary fibrosis rats. A: Immunohistochemical staining to observe the staining intensity of E-cadherin, vimentin, alpha-smooth muscle actin (α-SMA) and collagen type 1 alpha 1 (COL1A1) in rat lung tissue; B and C: Western blotting detection of E-cadherin, vimentin, α-SMA and COL1A1 protein expression levels in rat lung tissue (n = 3); D: Real-time quantitative polymerase chain reaction detection of E-cadherin, vimentin, α-SMA and COL1A1 mRNA levels in rat lung tissue (n = 6). aP < 0.05 vs control + phosphate buffered saline, bP < 0.01 vs control + phosphate buffered saline, cP < 0.0001 vs control + phosphate buffered saline, dP < 0.05 vs irradiation + phosphate buffered saline, eP < 0.001 vs irradiation + phosphate buffered saline, fP < 0.0001 vs irradiation + phosphate buffered saline. CON: Control; PBS: Phosphate buffered saline; IR: Irradiation; EXO: Exosomes; α-SMA: Alpha-smooth muscle actin; COL1A1: Collagen type 1 alpha 1.
MSCs-exosomes promoted proliferation and suppressed inflammation, ECM, and EMT in radiation-induced alveolar epithelial cells

Initially, the impact of MSCs-exosomes on the proliferation of RLE-6TN and BEAS-2B cells was assessed. The data showed that radiation significantly suppressed the proliferation of both cell lines, but MSCs-exosomes partially restored cell viability in both cases (Figure 5A and B). Enzyme linked immunosorbent assay analysis showed increased TNF-α, IL-6, and IL-1β, and decreased IL-10 in irradiated cells, which MSCs-exosomes reversed by lowering proinflammatory cytokines and boosting IL-10 (Figure 5C and D). RT-qPCR further confirmed that radiation induced an upregulation of mRNA levels of α-SMA, COL1A1, and vimentin, and a downregulation of E-cadherin mRNA. MSCs-exosomes reversed these radiation-induced changes (Figure 5E and F). These results suggest that MSCs-exosomes exert anti-inflammatory effects and mitigate radiation-induced ECM and EMT processes in vitro.

Figure 5
Figure 5 Mesenchymal stem cells-derived exosomes promoted proliferation and suppressed inflammation, extracellular matrix, epithelial-mesenchymal transition in radiation induced alveolar epithelial cells. A and B: The cell proliferations of RLE-6TN and BEAS-2B cells were detected by CCK8 assay. OD value (450 nm) was measured at 24 hours, 48 hours and 72 hours (n = 3); C and D: The secretion levels of inflammatory chemokines [tumor necrosis factor-α, interleukin (IL)-6, IL-1β, IL-10] in the culture supernatants were measured by enzyme linked immunosorbent assay (n = 3); E and F: The mRNA expressions of E-cadherin, vimentin, alpha-smooth muscle actin and collagen type 1 alpha 1 were detected by real-time quantitative polymerase chain reaction in RLE-6TN and BEAS-2B cells (n = 3). aP < 0.05 vs control + phosphate buffered saline, bP < 0.01 vs control + phosphate buffered saline, cP < 0.001 vs control + phosphate buffered saline, dP < 0.0001 vs control + phosphate buffered saline, eP < 0.05 vs irradiation + phosphate buffered saline, fP < 0.01 vs irradiation + phosphate buffered saline, gP < 0.001 vs irradiation + phosphate buffered saline, hP < 0.0001 vs irradiation + phosphate buffered saline. CON: Control; PBS: Phosphate buffered saline; IR: Irradiation; EXO: Exosomes; IL: Interleukin; TNF: Tumor necrosis factor; α-SMA: Alpha-smooth muscle actin; COL1A1: Collagen type 1 alpha 1.
MSCs-exosomes inhibited Akt/NF-κB signaling in RIPF

To investigate whether MSCs-exosomes exert their anti-fibrotic effects through regulation of the Akt/NF-κB signaling, key molecules in both RIPF animal and cell models was evaluated. Western blotting revealed significant upregulation of p-Akt/Akt, p-IKKα/β/IKKα, and p-NF-κB p65/NF-κB p65 following radiation. EXO treatment significantly reversed the radiation-induced upregulation of these molecules in vivo (Figure 6A and B). In vitro results were consistent, as EXO treatment notably reduced the expression of p-Akt/Akt, p-IKKα/β/IKKα, and p-NF-κB p65/NF-κB p65 in irradiated RLE-6TN cells (Figure 6C and D). Additionally, immunohistochemistry further confirmed that EXO treatment inhibited p-Akt, p-IKKα/β, and p-NF-κB p65 levels in lung tissue (Figure 6E and F). The findings indicated that MSCs-exosomes could mitigate the RIPF process by blocking the Akt/NF-κB pathway.

Figure 6
Figure 6 Mesenchymal stem cells-derived exosomes inhibited protein kinase B/nuclear factor kappa B signaling in radiation induced pulmonary fibrosis. A-D: Western blot analysis of protein kinase B (Akt)/nuclear factor kappa B (NF-κB) signaling pathway expression levels in rat lung tissue at 16 weeks (n = 3) (A and B); western blot analysis of Akt/NF-κB signaling pathway expression levels in RLE-6TN cells (n = 3) (C and D); E and F: Immunohistochemistry was used to determine the staining intensity of p-Akt, p-IkappaB kinase α/β and p-NF-κB p65 in rat lung tissue at 16 weeks (n = 6). aP < 0.0001 vs control + phosphate buffered saline, bP < 0.01 vs control + phosphate buffered saline, cP < 0.0001 vs irradiation + phosphate buffered saline. CON: Control; IR: Irradiation; PBS: Phosphate buffered saline; EXO: Exosomes; Akt: Protein kinase B; IKK: IkappaB kinase; NF-κB: Kinase nuclear factor kappa B.
DISCUSSION

RIPF is marked by the ongoing and irreversible deterioration of lung structure, leading to the loss of gas exchange function. Clinical manifestations include breathing difficulties, impaired lung function, and interstitial fluid accumulation, ultimately culminating in respiratory failure[27]. While amifostine has been approved as a radioprotective agent[28], no cure exists for RIPF, and treatment options to manage the disease and alleviate symptoms remain limited. Despite extensive research on MSCs and genetically modified MSCs for treating RILI[29,30], studies on the efficacy of MSCs-exosomes in RILI treatment are still scarce. Previous research indicated that mouse bone marrow MSCs-exosomes could alleviate RILI within 8-12 weeks post-irradiation[31]. However, this research utilized MSCs-exosomes from mouse bone marrow, whereas our study employed human umbilical cord-derived MSCs-exosomes, offering greater practical applicability. Furthermore, our animal experiments were conducted over a longer duration, with a specific focus on the effects of MSCs-exosomes across various stages of RIPF. We verified the therapeutic impact of MSCs-exosomes in a RIPF rat model, and their ability to shield alveolar epithelial cells from radiation-induced ECM production and EMT processes was confirmed in vitro. Additionally, MSCs-exosomes were shown to reverse key components of radiation-induced ECM and EMT via the Akt/NF-κB pathway, thereby inhibiting fibrosis progression and promoting the recovery and proliferation of damaged cells. These findings provide novel insights into potential therapeutic strategies for RIPF.

MSCs possess anti-inflammatory and immunoregulatory functions, promoting tissue regeneration and inhibiting fibrosis. They have been shown to reduce lung damage in several animal models, including those of inflammation, pulmonary hypertension, and RILI[32-34]. However, several challenges remain before MSCs can be clinically applied[35]. In contrast, MSCs-exosomes offer a regenerative healing potential with reduced risks of teratoma formation, tumorigenesis, and immune suppression-related complications[36], enhancing their translational potential. Thus, MSCs-exosomes represent a promising alternative, sharing therapeutic properties with their progenitor cells. For instance, Wang et al[37] revealed that extracellular vesicles from MSCs could reverse cerebral ischemia-reperfusion injury. Zhu et al[38] reported that adipose-derived MSCs-exosomes blocked the TGF-β1-induced transition of tubular epithelial cells to a profibrogenic phenotype. Similarly, Ferguson et al[39] found that MSCs-exosomes inhibited type I collagen gene expression in primary human cardiac fibroblasts. Based on these findings, it is hypothesized that MSCs-exosomes may have therapeutic potential for RIPF. This study confirmed that RIPF rats treated with MSCs-exosomes exhibited reduced morphological and histopathological pulmonary fibrosis compared to those treated with saline.

Pulmonary fibrosis is a chronic inflammatory condition of lung tissue, where the progression heavily relies on the inflammatory response. Inflammatory mediators, including interleukins, TNF-α, and IFN-γ, can influence organ fibrosis and induce EMT through various signaling pathways, thereby enhancing the secretion of ECM[40]. In pulmonary fibrosis, the balance between collagen production and degradation is disrupted, leading to excessive accumulation of ECM in tissues. This accumulation of collagen fragments can exacerbate inflammation, further contributing to fibrosis[41]. Therefore, inhibiting inflammation may help mitigate pulmonary fibrosis. In line with this, our research showed that radiation significantly upregulated the levels of inflammatory factors, suggesting ongoing significant inflammatory responses in rats from 2 to 16 weeks after radiation exposure. However, MSCs-exosomes treatment significantly reduced the secretion of these inflammatory cytokines. Additionally, MSCs-exosomes effectively suppressed the mRNA levels of radiation-induced inflammatory factors both in vivo and in vitro. Furthermore, TGF-β1, a critical cytokine in the induction of EMT, was demonstrated to be pivotal in pulmonary fibrosis and RILI[42]. Pro-inflammatory cytokines can synergistically interact with or promote the synthesis of TGF-β1, contributing to EMT and creating a feedback loop that accelerates fibrosis[43]. Our findings indicated that MSCs-exosomes significantly reversed the radiation-induced increase in TGF-β1 protein and mRNA levels. These results support the notion that MSCs-exosomes alleviate RIPF by inhibiting inflammatory responses.

Although the pathogenesis of RIPF remains incompletely understood, previous research has pointed out the significant role of EMT in its development. The process of EMT caused epithelial features to be lost while a mesenchymal phenotype was gained[44]. This transition diminishes the ability of lung cells to maintain alveolar-capillary barrier integrity, impairing gas exchange[45]. In alignment with earlier studies, our work confirmed that radiation induced EMT in rat lung tissue and epithelial cells (RLE-6TN and BEAS-2B), evidenced by the loss of epithelial polarity, decreased E-cadherin, and increased vimentin. Additionally, radiation also elevated α-SMA and COL1A1 levels, indicating ECM deposition. Following MSCs-exosomes transplantation, E-cadherin expression was upregulated, while vimentin, α-SMA, and COL1A1 were downregulated in both rat lung tissue and lung epithelial cells. These results demonstrate that MSCs-exosomes effectively inhibited the radiation-induced EMT process and ECM deposition, highlighting their possible therapeutic application in treating RIPF.

Further investigation was conducted into the signaling pathways that exosomes use to inhibit RIPF. PI3K/Akt serves as a critical signaling hub in the fibrosis process[46]. Inhibition of PI3K/Akt has been shown to disrupt EMT, with Akt inhibitors partially reversing this process[47,48]. Activated Akt induces hypoxia-inducible factor-1 alpha, promoting the transformation of alveolar epithelial cells into fibroblasts and facilitating EMT in pulmonary fibrosis[49]. In fibroblasts, Akt regulates collagen I and III production, contributing to liver fibrosis and BLM-induced pulmonary fibrosis[50]. The NF-κB pathway, known for its role in inflammatory signaling, is involved in acute lung injury caused by lipopolysaccharide[51]. Inhibitors of AKT and NF-κB have demonstrated considerable potential in reducing pulmonary fibrosis. For instance, in mice, Duvelisib, a PI3K inhibitor, significantly reduced bleomycin-induced lung fibrosis by inhibiting PI3K, Akt, and mammalian target of rapamycin phosphorylation[52]. Cepharanthine has been shown to slow pulmonary fibrosis progression by suppressing the NF-κB/nod-like receptor protein 3 pathway[53], while sinomenine alleviated fibrosis by the downregulation of the TGF-β1/Smad3, PI3K/Akt, and NF-κB pathways[54]. Recent studies have indicated that MSCs can reverse damage and EMT in lipopolysaccharide-treated MLE-12 mouse lung epithelial cells through blockade of the NF-κB/Hedgehog pathway[55]. Our findings revealed that radiation activated the Akt/NF-κB pathway, while MSCs-exosomes mitigated the radiation-induced activation of Akt/NF-κB, suggesting their role in RIPF treatment. Although these data indicated that MSCs-exosomes may alleviate RIPF by inhibiting the Akt/NF-κB pathway, further validation using pathway-specific inhibitors is necessary to establish a causal relationship.

Alterations in miRNAs following radiation exposure have been observed in both patients with lung cancer undergoing radiotherapy and in preclinical animal models[56,57]. These observations proposed that miRNAs have a significant impact on the pathological processes involved in RILI[58]. Evidence also indicates that exosomes released by MSCs carry miRNAs, which mediate tissue regeneration and immune regulation, thereby reducing inflammation and fibrosis in damaged tissues[59]. Specific miRNAs, such as miR-185 (targeting COL1A1)[60], miR-125b-5p (targeting Smad2)[61], miR-23a-3p (targeting TGF-β2)[61], and Let-7f-5p (targeting IL-6)[62], have been implicated in these regulatory pathways. Prior investigations have underscored the therapeutic benefits of MSCs-exosomes for RIPF treatment[31], though challenges related to their clinical application remain. Despite the absence of acute immune rejection and tumor formation risks associated with exosomes, MSCs-exosomes have been shown to induce physiological processes relevant to tumor development, such as proliferation, angiogenesis, metastasis, and drug resistance[63,64]. Recent studies also underscore that miRNAs delivered via exosomes are involved in the regulation of lung diseases[65,66]. This suggests that exosomes engineered to express specific miRNAs, rather than unmodified exosomes, may offer a promising alternative for RIPF therapy. Targeting miRNAs capable of simultaneously inhibiting cancer and inflammation provides a superior approach to RIPF treatment through MSCs-exosome cargo. However, further investigation is required to fully elucidate the working mechanism of MSCs-exosomes in RIPF and to validate their efficacy in clinical trials.

CONCLUSION

This study demonstrated that MSCs-exosomes alleviated RIPF both in vivo and in vitro. Specifically, MSCs-exosomes were shown to reverse radiation-induced ECM production and EMT processes by inhibition of the Akt/NF-κB pathway. These findings underscored MSCs-exosomes potential as a novel therapeutic approach for RIPF.

References
1.  Zhang Z, Zhou J, Verma V, Liu X, Wu M, Yu J, Chen D. Crossed Pathways for Radiation-Induced and Immunotherapy-Related Lung Injury. Front Immunol. 2021;12:774807.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 48]  [Article Influence: 9.6]  [Reference Citation Analysis (0)]
2.  Hanania AN, Mainwaring W, Ghebre YT, Hanania NA, Ludwig M. Radiation-Induced Lung Injury: Assessment and Management. Chest. 2019;156:150-162.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 527]  [Cited by in RCA: 494]  [Article Influence: 70.6]  [Reference Citation Analysis (1)]
3.  Li J, Wang R, Shi W, Chen X, Yi J, Yang X, Jin S. Epigenetic regulation in radiation-induced pulmonary fibrosis. Int J Radiat Biol. 2023;99:384-395.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 16]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
4.  Chen Z, Wu Z, Ning W. Advances in Molecular Mechanisms and Treatment of Radiation-Induced Pulmonary Fibrosis. Transl Oncol. 2019;12:162-169.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 83]  [Cited by in RCA: 78]  [Article Influence: 11.1]  [Reference Citation Analysis (1)]
5.  Huang C, Ogawa R. Role of Inflammasomes in Keloids and Hypertrophic Scars-Lessons Learned from Chronic Diabetic Wounds and Skin Fibrosis. Int J Mol Sci. 2022;23:6820.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 44]  [Article Influence: 11.0]  [Reference Citation Analysis (2)]
6.  Tanjore H, Xu XC, Polosukhin VV, Degryse AL, Li B, Han W, Sherrill TP, Plieth D, Neilson EG, Blackwell TS, Lawson WE. Contribution of epithelial-derived fibroblasts to bleomycin-induced lung fibrosis. Am J Respir Crit Care Med. 2009;180:657-665.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 307]  [Cited by in RCA: 354]  [Article Influence: 20.8]  [Reference Citation Analysis (0)]
7.  Hewlett JC, Kropski JA, Blackwell TS. Idiopathic pulmonary fibrosis: Epithelial-mesenchymal interactions and emerging therapeutic targets. Matrix Biol. 2018;71-72:112-127.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 174]  [Cited by in RCA: 248]  [Article Influence: 31.0]  [Reference Citation Analysis (0)]
8.  Xia H, Gilbertsen A, Herrera J, Racila E, Smith K, Peterson M, Griffin T, Benyumov A, Yang L, Bitterman PB, Henke CA. Calcium-binding protein S100A4 confers mesenchymal progenitor cell fibrogenicity in idiopathic pulmonary fibrosis. J Clin Invest. 2017;127:2586-2597.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 47]  [Cited by in RCA: 82]  [Article Influence: 9.1]  [Reference Citation Analysis (0)]
9.  Lu Y, Zhang Y, Pan Z, Yang C, Chen L, Wang Y, Xu D, Xia H, Wang S, Chen S, Hao YJ, Sun G. Potential "Therapeutic" Effects of Tocotrienol-Rich Fraction (TRF) and Carotene "Against" Bleomycin-Induced Pulmonary Fibrosis in Rats via TGF-β/Smad, PI3K/Akt/mTOR and NF-κB Signaling Pathways. Nutrients. 2022;14:1094.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 15]  [Article Influence: 3.8]  [Reference Citation Analysis (1)]
10.  Julien S, Puig I, Caretti E, Bonaventure J, Nelles L, van Roy F, Dargemont C, de Herreros AG, Bellacosa A, Larue L. Activation of NF-kappaB by Akt upregulates Snail expression and induces epithelium mesenchyme transition. Oncogene. 2007;26:7445-7456.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 352]  [Cited by in RCA: 394]  [Article Influence: 20.7]  [Reference Citation Analysis (4)]
11.  López-Novoa JM, Nieto MA. Inflammation and EMT: an alliance towards organ fibrosis and cancer progression. EMBO Mol Med. 2009;1:303-314.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 568]  [Cited by in RCA: 541]  [Article Influence: 31.8]  [Reference Citation Analysis (2)]
12.  Wang H, Wang HS, Zhou BH, Li CL, Zhang F, Wang XF, Zhang G, Bu XZ, Cai SH, Du J. Epithelial-mesenchymal transition (EMT) induced by TNF-α requires AKT/GSK-3β-mediated stabilization of snail in colorectal cancer. PLoS One. 2013;8:e56664.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 182]  [Cited by in RCA: 232]  [Article Influence: 17.8]  [Reference Citation Analysis (1)]
13.  Kabat M, Bobkov I, Kumar S, Grumet M. Trends in mesenchymal stem cell clinical trials 2004-2018: Is efficacy optimal in a narrow dose range? Stem Cells Transl Med. 2020;9:17-27.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 374]  [Cited by in RCA: 347]  [Article Influence: 57.8]  [Reference Citation Analysis (1)]
14.  Larasati VA, Lembang GV, Tjahjono Y, Winarsih S, Ana ID, Wihadmadyatami H, Kusindarta DL. In Vitro Neuroprotective Effect of the Bovine Umbilical Vein Endothelial Cell Conditioned Medium Mediated by Downregulation of IL-1β, Caspase-3, and Caspase-9 Expression. Vet Sci. 2022;9:48.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 8]  [Article Influence: 2.0]  [Reference Citation Analysis (1)]
15.  An S, Anwar K, Ashraf M, Lee H, Jung R, Koganti R, Ghassemi M, Djalilian AR. Wound-Healing Effects of Mesenchymal Stromal Cell Secretome in the Cornea and the Role of Exosomes. Pharmaceutics. 2023;15:1486.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 10]  [Cited by in RCA: 40]  [Article Influence: 13.3]  [Reference Citation Analysis (0)]
16.  Lai P, Chen X, Guo L, Wang Y, Liu X, Liu Y, Zhou T, Huang T, Geng S, Luo C, Huang X, Wu S, Ling W, Du X, He C, Weng J. A potent immunomodulatory role of exosomes derived from mesenchymal stromal cells in preventing cGVHD. J Hematol Oncol. 2018;11:135.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 151]  [Cited by in RCA: 145]  [Article Influence: 18.1]  [Reference Citation Analysis (4)]
17.  Moeinabadi-Bidgoli K, Rezaee M, Hossein-Khannazer N, Babajani A, Aghdaei HA, Arki MK, Afaghi S, Niknejad H, Vosough M. Exosomes for angiogenesis induction in ischemic disorders. J Cell Mol Med. 2023;27:763-787.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 16]  [Cited by in RCA: 40]  [Article Influence: 13.3]  [Reference Citation Analysis (0)]
18.  Wen S, Dooner M, Cheng Y, Papa E, Del Tatto M, Pereira M, Deng Y, Goldberg L, Aliotta J, Chatterjee D, Stewart C, Carpanetto A, Collino F, Bruno S, Camussi G, Quesenberry P. Mesenchymal stromal cell-derived extracellular vesicles rescue radiation damage to murine marrow hematopoietic cells. Leukemia. 2016;30:2221-2231.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 130]  [Cited by in RCA: 180]  [Article Influence: 18.0]  [Reference Citation Analysis (4)]
19.  Lei X, He N, Zhu L, Zhou M, Zhang K, Wang C, Huang H, Chen S, Li Y, Liu Q, Han Z, Guo Z, Han Z, Li Z. Mesenchymal Stem Cell-Derived Extracellular Vesicles Attenuate Radiation-Induced Lung Injury via miRNA-214-3p. Antioxid Redox Signal. 2021;35:849-862.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 42]  [Cited by in RCA: 93]  [Article Influence: 18.6]  [Reference Citation Analysis (4)]
20.  Wang L, Ouyang M, Xing S, Zhao S, Liu S, Sun L, Yu H. Mesenchymal Stem Cells and their Derived Exosomes Promote Malignant Phenotype of Polyploid Non-Small-Cell Lung Cancer Cells through AMPK Signaling Pathway. Anal Cell Pathol (Amst). 2022;2022:8708202.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 14]  [Article Influence: 3.5]  [Reference Citation Analysis (2)]
21.  Hübner RH, Gitter W, El Mokhtari NE, Mathiak M, Both M, Bolte H, Freitag-Wolf S, Bewig B. Standardized quantification of pulmonary fibrosis in histological samples. Biotechniques. 2008;44:507-511, 514.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 687]  [Cited by in RCA: 641]  [Article Influence: 35.6]  [Reference Citation Analysis (0)]
22.  Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402-408.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 158539]  [Cited by in RCA: 141708]  [Article Influence: 5668.3]  [Reference Citation Analysis (14)]
23.  Tu J, Chen X, Li C, Liu C, Huang Y, Wang X, Liang H, Yuan X. Nintedanib Mitigates Radiation-Induced Pulmonary Fibrosis by Suppressing Epithelial Cell Inflammatory Response and Inhibiting Fibroblast-to-Myofibroblast Transition. Int J Biol Sci. 2024;20:3353-3371.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 30]  [Cited by in RCA: 29]  [Article Influence: 14.5]  [Reference Citation Analysis (0)]
24.  Moss BJ, Ryter SW, Rosas IO. Pathogenic Mechanisms Underlying Idiopathic Pulmonary Fibrosis. Annu Rev Pathol. 2022;17:515-546.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 11]  [Cited by in RCA: 628]  [Article Influence: 157.0]  [Reference Citation Analysis (3)]
25.  Carew RM, Wang B, Kantharidis P. The role of EMT in renal fibrosis. Cell Tissue Res. 2012;347:103-116.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 193]  [Cited by in RCA: 255]  [Article Influence: 17.0]  [Reference Citation Analysis (1)]
26.  Lovisa S, Zeisberg M, Kalluri R. Partial Epithelial-to-Mesenchymal Transition and Other New Mechanisms of Kidney Fibrosis. Trends Endocrinol Metab. 2016;27:681-695.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 150]  [Cited by in RCA: 224]  [Article Influence: 22.4]  [Reference Citation Analysis (0)]
27.  Jarzebska N, Karetnikova ES, Markov AG, Kasper M, Rodionov RN, Spieth PM. Scarred Lung. An Update on Radiation-Induced Pulmonary Fibrosis. Front Med (Lausanne). 2020;7:585756.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 33]  [Article Influence: 6.6]  [Reference Citation Analysis (2)]
28.  Citrin D, Cotrim AP, Hyodo F, Baum BJ, Krishna MC, Mitchell JB. Radioprotectors and mitigators of radiation-induced normal tissue injury. Oncologist. 2010;15:360-371.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 361]  [Cited by in RCA: 338]  [Article Influence: 21.1]  [Reference Citation Analysis (0)]
29.  Liu D, Kong F, Yuan Y, Seth P, Xu W, Wang H, Xiao F, Wang L, Zhang Q, Yang Y, Wang H. Decorin-Modified Umbilical Cord Mesenchymal Stem Cells (MSCs) Attenuate Radiation-Induced Lung Injuries via Regulating Inflammation, Fibrotic Factors, and Immune Responses. Int J Radiat Oncol Biol Phys. 2018;101:945-956.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 58]  [Cited by in RCA: 50]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
30.  Xue J, Li X, Lu Y, Gan L, Zhou L, Wang Y, Lan J, Liu S, Sun L, Jia L, Mo X, Li J. Gene-modified mesenchymal stem cells protect against radiation-induced lung injury. Mol Ther. 2013;21:456-465.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 55]  [Cited by in RCA: 61]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
31.  Li Y, Shen Z, Jiang X, Wang Y, Yang Z, Mao Y, Wu Z, Li G, Chen H. Mouse mesenchymal stem cell-derived exosomal miR-466f-3p reverses EMT process through inhibiting AKT/GSK3β pathway via c-MET in radiation-induced lung injury. J Exp Clin Cancer Res. 2022;41:128.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 78]  [Article Influence: 19.5]  [Reference Citation Analysis (4)]
32.  Guo Z, Chen Y, Luo X, He X, Zhang Y, Wang J. Administration of umbilical cord mesenchymal stem cells in patients with severe COVID-19 pneumonia. Crit Care. 2020;24:420.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 62]  [Cited by in RCA: 51]  [Article Influence: 8.5]  [Reference Citation Analysis (0)]
33.  Huang J, Lu W, Ouyang H, Chen Y, Zhang C, Luo X, Li M, Shu J, Zheng Q, Chen H, Chen J, Tang H, Sun D, Yuan JX, Yang K, Wang J. Transplantation of Mesenchymal Stem Cells Attenuates Pulmonary Hypertension by Normalizing the Endothelial-to-Mesenchymal Transition. Am J Respir Cell Mol Biol. 2020;62:49-60.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 26]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
34.  Xu T, Zhang Y, Chang P, Gong S, Shao L, Dong L. Mesenchymal stem cell-based therapy for radiation-induced lung injury. Stem Cell Res Ther. 2018;9:18.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 34]  [Cited by in RCA: 54]  [Article Influence: 6.8]  [Reference Citation Analysis (1)]
35.  Galipeau J, Sensébé L. Mesenchymal Stromal Cells: Clinical Challenges and Therapeutic Opportunities. Cell Stem Cell. 2018;22:824-833.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1510]  [Cited by in RCA: 1414]  [Article Influence: 176.8]  [Reference Citation Analysis (5)]
36.  Cao Q, Huang C, Chen XM, Pollock CA. Mesenchymal Stem Cell-Derived Exosomes: Toward Cell-Free Therapeutic Strategies in Chronic Kidney Disease. Front Med (Lausanne). 2022;9:816656.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 46]  [Cited by in RCA: 40]  [Article Influence: 10.0]  [Reference Citation Analysis (0)]
37.  Wang W, Ji Z, Yuan C, Yang Y. Mechanism of Human Umbilical Cord Mesenchymal Stem Cells Derived-Extracellular Vesicle in Cerebral Ischemia-Reperfusion Injury. Neurochem Res. 2021;46:455-467.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 24]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
38.  Zhu F, Chong Lee Shin OLS, Pei G, Hu Z, Yang J, Zhu H, Wang M, Mou J, Sun J, Wang Y, Yang Q, Zhao Z, Xu H, Gao H, Yao W, Luo X, Liao W, Xu G, Zeng R, Yao Y. Adipose-derived mesenchymal stem cells employed exosomes to attenuate AKI-CKD transition through tubular epithelial cell dependent Sox9 activation. Oncotarget. 2017;8:70707-70726.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 104]  [Cited by in RCA: 104]  [Article Influence: 11.6]  [Reference Citation Analysis (5)]
39.  Ferguson SW, Wang J, Lee CJ, Liu M, Neelamegham S, Canty JM, Nguyen J. The microRNA regulatory landscape of MSC-derived exosomes: a systems view. Sci Rep. 2018;8:1419.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 313]  [Cited by in RCA: 298]  [Article Influence: 37.3]  [Reference Citation Analysis (4)]
40.  Wang S, Kuai Y, Lin S, Li L, Gu Q, Zhang X, Li X, He Y, Chen S, Xia X, Ruan Z, Lin C, Ding Y, Zhang Q, Qi C, Li J, He X, Pathak JL, Zhou W, Liu S, Wang L, Zheng L. NF-κB Activator 1 downregulation in macrophages activates STAT3 to promote adenoma-adenocarcinoma transition and immunosuppression in colorectal cancer. BMC Med. 2023;21:115.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 27]  [Article Influence: 9.0]  [Reference Citation Analysis (0)]
41.  Peng L, Wen L, Shi QF, Gao F, Huang B, Meng J, Hu CP, Wang CM. Scutellarin ameliorates pulmonary fibrosis through inhibiting NF-κB/NLRP3-mediated epithelial-mesenchymal transition and inflammation. Cell Death Dis. 2020;11:978.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 39]  [Cited by in RCA: 307]  [Article Influence: 51.2]  [Reference Citation Analysis (0)]
42.  Ning W, Xu X, Zhou S, Wu X, Wu H, Zhang Y, Han J, Wang J. Effect of high glucose supplementation on pulmonary fibrosis involving reactive oxygen species and TGF-β. Front Nutr. 2022;9:998662.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 11]  [Reference Citation Analysis (1)]
43.  Wang M, Feng Y, Zhang P, Shen K, Su J, Zhong Y, Yang X, Lin S, Lu J. Jiawei Maxing Shigan Tang alleviates radiation-induced lung injury via TGF-β1/Smad signaling pathway mediated by regulatory T cells. J Ethnopharmacol. 2024;320:117389.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 19]  [Reference Citation Analysis (1)]
44.  Pastushenko I, Blanpain C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019;29:212-226.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2351]  [Cited by in RCA: 2163]  [Article Influence: 309.0]  [Reference Citation Analysis (3)]
45.  Hou W, Hu S, Li C, Ma H, Wang Q, Meng G, Guo T, Zhang J. Cigarette Smoke Induced Lung Barrier Dysfunction, EMT, and Tissue Remodeling: A Possible Link between COPD and Lung Cancer. Biomed Res Int. 2019;2019:2025636.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 44]  [Cited by in RCA: 123]  [Article Influence: 17.6]  [Reference Citation Analysis (0)]
46.  Zhang Z, Shang J, Yang Q, Dai Z, Liang Y, Lai C, Feng T, Zhong D, Zou H, Sun L, Su Y, Yan S, Chen J, Yao Y, Shi Y, Huang X. Exosomes derived from human adipose mesenchymal stem cells ameliorate hepatic fibrosis by inhibiting PI3K/Akt/mTOR pathway and remodeling choline metabolism. J Nanobiotechnology. 2023;21:29.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 104]  [Cited by in RCA: 103]  [Article Influence: 34.3]  [Reference Citation Analysis (4)]
47.  Xu Q, Liu X, Liu Z, Zhou Z, Wang Y, Tu J, Li L, Bao H, Yang L, Tu K. MicroRNA-1296 inhibits metastasis and epithelial-mesenchymal transition of hepatocellular carcinoma by targeting SRPK1-mediated PI3K/AKT pathway. Mol Cancer. 2017;16:103.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 92]  [Cited by in RCA: 151]  [Article Influence: 16.8]  [Reference Citation Analysis (0)]
48.  Liang L, Li Y, Ying B, Huang X, Liao S, Yang J, Liao G. Mutation-associated transcripts reconstruct the prognostic features of oral tongue squamous cell carcinoma. Int J Oral Sci. 2023;15:1.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 18]  [Reference Citation Analysis (1)]
49.  Saito S, Zhuang Y, Shan B, Danchuk S, Luo F, Korfei M, Guenther A, Lasky JA. Tubastatin ameliorates pulmonary fibrosis by targeting the TGFβ-PI3K-Akt pathway. PLoS One. 2017;12:e0186615.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 53]  [Cited by in RCA: 101]  [Article Influence: 11.2]  [Reference Citation Analysis (0)]
50.  Wang J, Hu K, Cai X, Yang B, He Q, Wang J, Weng Q. Targeting PI3K/AKT signaling for treatment of idiopathic pulmonary fibrosis. Acta Pharm Sin B. 2022;12:18-32.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 67]  [Cited by in RCA: 366]  [Article Influence: 91.5]  [Reference Citation Analysis (0)]
51.  Zhang R, Guo N, Yan G, Wang Q, Gao T, Zhang B, Hou N. Ginkgolide C attenuates lipopolysaccharideinduced acute lung injury by inhibiting inflammation via regulating the CD40/NFκB signaling pathway. Int J Mol Med. 2021;47:62.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 12]  [Article Influence: 2.4]  [Reference Citation Analysis (0)]
52.  Li X, Ma X, Miao Y, Zhang J, Xi B, Li W, Zhang Q, Chen L, Yang Y, Li H, Wei L, Zhou H, Yang C. Duvelisib attenuates bleomycin-induced pulmonary fibrosis via inhibiting the PI3K/Akt/mTOR signalling pathway. J Cell Mol Med. 2023;27:422-434.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 23]  [Reference Citation Analysis (0)]
53.  Chen G, Li J, Liu H, Zhou H, Liu M, Liang D, Meng Z, Gan H, Wu Z, Zhu X, Han P, Liu T, Gu R, Liu S, Dou G. Cepharanthine Ameliorates Pulmonary Fibrosis by Inhibiting the NF-κB/NLRP3 Pathway, Fibroblast-to-Myofibroblast Transition and Inflammation. Molecules. 2023;28:753.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 24]  [Reference Citation Analysis (0)]
54.  Yao F, Xu M, Dong L, Shen X, Shen Y, Jiang Y, Zhu T, Zhang C, Yu G. Sinomenine attenuates pulmonary fibrosis by downregulating TGF-β1/Smad3, PI3K/Akt and NF-κB signaling pathways. BMC Pulm Med. 2024;24:229.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 27]  [Reference Citation Analysis (0)]
55.  Xiao K, He W, Guan W, Hou F, Yan P, Xu J, Zhou T, Liu Y, Xie L. Mesenchymal stem cells reverse EMT process through blocking the activation of NF-κB and Hedgehog pathways in LPS-induced acute lung injury. Cell Death Dis. 2020;11:863.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 203]  [Cited by in RCA: 195]  [Article Influence: 32.5]  [Reference Citation Analysis (1)]
56.  Tomasik B, Chałubińska-Fendler J, Chowdhury D, Fendler W. Potential of serum microRNAs as biomarkers of radiation injury and tools for individualization of radiotherapy. Transl Res. 2018;201:71-83.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 24]  [Cited by in RCA: 30]  [Article Influence: 3.8]  [Reference Citation Analysis (1)]
57.  Li Y, Zou L, Chu L, Ye L, Ni J, Chu X, Guo T, Yang X, Zhu Z. Identification and Integrated Analysis of circRNA and miRNA of Radiation-Induced Lung Injury in a Mouse Model. J Inflamm Res. 2021;14:4421-4431.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 4]  [Cited by in RCA: 15]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
58.  Liu B, Li H, Liu X, Li F, Chen W, Kuang Y, Zhao X, Li L, Yu B, Jin X, Li Q. CircZNF208 enhances the sensitivity to X-rays instead of carbon-ions through the miR-7-5p /SNCA signal axis in non-small-cell lung cancer cells. Cell Signal. 2021;84:110012.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 14]  [Article Influence: 2.8]  [Reference Citation Analysis (0)]
59.  Zhang N, Song GY, Hu YJ, Wang X, Chao TZ, Wu YY, Xu P. Analysis of lncRNA-miRNA-mRNA Expression in the Troxerutin-Mediated Prevention of Radiation-Induced Lung Injury in Mice. J Inflamm Res. 2023;16:2387-2399.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 3]  [Reference Citation Analysis (1)]
60.  Li BB, Li DL, Chen C, Liu BH, Xia CY, Wu HJ, Wu CQ, Ji GQ, Liu S, Ni W, Yao DK, Zeng ZY, Chen DG, Qin BD, Xin X, Yan GL, Dan Tang, Liu HM, He J, Yan H, Zhu WJ, Yu HY, Zhu L. Potentials of the elevated circulating miR-185 level as a biomarker for early diagnosis of HBV-related liver fibrosis. Sci Rep. 2016;6:34157.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 19]  [Cited by in RCA: 23]  [Article Influence: 2.3]  [Reference Citation Analysis (0)]
61.  Fang S, Xu C, Zhang Y, Xue C, Yang C, Bi H, Qian X, Wu M, Ji K, Zhao Y, Wang Y, Liu H, Xing X. Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-β/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016;5:1425-1439.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 512]  [Cited by in RCA: 479]  [Article Influence: 47.9]  [Reference Citation Analysis (6)]
62.  Tan W, Gu Z, Leng J, Zou X, Chen H, Min F, Zhou W, Zhang L, Li G. Let-7f-5p ameliorates inflammation by targeting NLRP3 in bone marrow-derived mesenchymal stem cells in patients with systemic lupus erythematosus. Biomed Pharmacother. 2019;118:109313.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 18]  [Cited by in RCA: 50]  [Article Influence: 7.1]  [Reference Citation Analysis (1)]
63.  Sharma A. Role of stem cell derived exosomes in tumor biology. Int J Cancer. 2018;142:1086-1092.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 70]  [Cited by in RCA: 103]  [Article Influence: 11.4]  [Reference Citation Analysis (5)]
64.  Dong L, Pu Y, Zhang L, Qi Q, Xu L, Li W, Wei C, Wang X, Zhou S, Zhu J, Wang X, Liu F, Chen X, Su C. Human umbilical cord mesenchymal stem cell-derived extracellular vesicles promote lung adenocarcinoma growth by transferring miR-410. Cell Death Dis. 2018;9:218.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 76]  [Cited by in RCA: 149]  [Article Influence: 18.6]  [Reference Citation Analysis (0)]
65.  Chen J, Hu C, Pan P. Extracellular Vesicle MicroRNA Transfer in Lung Diseases. Front Physiol. 2017;8:1028.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 55]  [Cited by in RCA: 87]  [Article Influence: 9.7]  [Reference Citation Analysis (5)]
66.  Monsel A, Zhu YG, Gudapati V, Lim H, Lee JW. Mesenchymal stem cell derived secretome and extracellular vesicles for acute lung injury and other inflammatory lung diseases. Expert Opin Biol Ther. 2016;16:859-871.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 157]  [Cited by in RCA: 152]  [Article Influence: 15.2]  [Reference Citation Analysis (1)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Cell and tissue engineering

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade B

Novelty: Grade B

Creativity or Innovation: Grade C

Scientific Significance: Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Liu S S-Editor: Wang JJ L-Editor: A P-Editor: Zhang XD

Write to the Help Desk