BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©The Author(s) 2025. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Stem Cells. Dec 26, 2025; 17(12): 106128
Published online Dec 26, 2025. doi: 10.4252/wjsc.v17.i12.106128
Calcifying nanoparticles induce apoptosis and calcification in bone marrow mesenchymal stem cells via the transforming growth factor-β/Smad pathway
Xuan-Li Su, Department of Surgery, The First Affiliated Hospital of Shihezi University, Shihezi 832000, Xinjiang Uygur Autonomous Region, China
Fu-Rong Xu, Jian Yang, San-Qiang Niu, Department of Emergency, The First Affiliated Hospital of Shihezi University, Shihezi 832000, Xinjiang Uygur Autonomous Region, China
Hao-Jie Shi, Pankaj Bagari, Hong-Wei Zhang, Department of General Surgery, The First Affiliated Hospital of Shihezi University, Shihezi 832000, Xinjiang Uygur Autonomous Region, China
Yu-Fan He, Department of General Practice, The First Affiliated Hospital of Shihezi University, Shihezi 832000, Xinjiang Uygur Autonomous Region, China
Zhen-Hao Li, The First Affiliated Hospital of Shihezi University, Shihezi 832000, Xinjiang Uygur Autonomous Region, China
Xiang-Wei Wu, Department of Administrative, Shihezi University School of Medicine, Shihezi 832000, Xinjiang Uygur Autonomous Region, China
Xin-Yu Peng, Department of Administrative, The First Affiliated Hospital of Shihezi University, Shihezi 832000, Xinjiang Uygur Autonomous Region, China
Mei-Yan Wang, Medicine Academy, Shihezi University School of Medicine, Shihezi 832000, Xinjiang Uygur Autonomous Region, China
ORCID number: Xuan-Li Su (0009-0006-3609-2199); Jian Yang (0000-0001-9574-6259); Mei-Yan Wang (0000-0001-8131-4025).
Co-first authors: Xuan-Li Su and Fu-Rong Xu.
Author contributions: Su XL and Xu FR contributed equally to this manuscript and are co-first authors. Su XL mainly contributed to drafting the article, critical revisions, and data interpretation; Xu FR and Yang J equally edited and reviewed the manuscript; Yang J contributed with final approval for publication; Niu SQ, Shi HJ, He YF, Li ZH, Bagari P, Wu XW, Peng XY, Zhang HW, and Wang MY approved the final article.
Supported by the Project of Xinjiang Production and Construction Corps, No. 2022ZD090; the Project of Xinjiang Production and Construction Corps - Young Science and Technology Innovation Talents, No. 2023CB008-31; The First Affiliated Hospital of Shihezi University Medical College, Doctoral Fund Project, No. BS202207; Talent Development Fund-Tianshan Talents, No. CZ001219; and 2024 National Health Commission Central Asian High-Incidence Prevention and Control Key Laboratory, No. KF202405.
Institutional review board statement: This study used commercially available cell lines and did not involve human or animal subjects, thus IRB approval was not required.
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
Data sharing statement: The materials and data used in this study are available from the corresponding author upon reasonable request.
Corresponding author: Jian Yang, Professor, Department of Emergency, The First Affiliated Hospital of Shihezi University, North Fourth Road, Shihezi 832000, Xinjiang Uygur Autonomous Region, China. 125210525@qq.com
Received: March 3, 2025
Revised: May 22, 2025
Accepted: November 10, 2025
Published online: December 26, 2025
Processing time: 299 Days and 9.9 Hours

Abstract
BACKGROUND

Pathological calcification is a common feature of many diseases. Calcifying nanoparticles (CNPs) are considered potential inducers of this abnormal calcification, but their specific effects on bone marrow mesenchymal stem cells (BMSCs) remain unclear. BMSCs are key cells in bone formation and repair, and their aberrant apoptosis and calcification are closely related to disease progression.

AIM

To explore whether CNPs can induce apoptosis and calcification in BMSCs and analyzed the relationship between these processes. The differential effects of CNPs and nanoscale hydroxyapatites (nHAPs) in inducing apoptosis and calcification in BMSCs were also compared.

METHODS

CNPs obtained in the early stage were identified by electron microscopy and particle size analysis. BMSCs were cultured with various treatments, including different concentrations of nHAPs, CNPs [2 McFarland (MCF) turbidity, 4 MCF, 6 MCF], and a transforming growth factor (TGF)-β inhibitor (SB431542) for 72 hours. The isolated CNPs exhibited the expected sizes and shapes.

RESULTS

Exposure to CNPs and nHAPs suppressed cell proliferation and promoted apoptosis in a concentration-dependent manner, with CNPs exhibiting significantly stronger effects. Alizarin Red staining indicated an increase in calcium deposition with exposure to increasing concentrations of nHAPs and CNPs. Quantitative reverse-transcription polymerase chain reaction results indicated that medium concentrations of nHAPs and CNPs significantly enhanced the expression of pro-apoptotic and pro-calcification markers, whereas the expression of anti-apoptotic Bcl-2 was reduced compared with untreated controls. Western blotting results showed that medium concentrations of CNPs and nHAPs increased the expression of osteopontin, bone morphogenetic protein-2, TGF-β/Smad, Bax, and caspase-3 and decreased Bcl-2 expression compared with controls.

CONCLUSION

CNPs and nHAPs induced apoptosis and calcification in BMSCs, with CNPs being the most potent. Additionally, the TGF-β inhibitor SB431542 significantly reduced the occurrence of apoptosis and calcification. A correlation was found between apoptosis and calcification, which is likely mediated through the TGF-β/Smad signaling pathway.

Key Words: Nanoparticles; Bone marrow mesenchymal stem cells; Calcification; Apoptosis; Transforming growth factor-β/Smad signaling pathway; Hydroxyapatite

Core Tip: This study revealed calcifying nanoparticles (CNPs) induce cell apoptosis and calcification on bone marrow mesenchymal stem cells. Through in vitro experiments, we found that CNPs inhibit cell proliferation in a concentration dependent manner and significantly enhance the expression of pro-apoptotic and pro-calcification markers. In addition, the transforming growth factor-β/Smad signaling pathway plays a crucial role in this process. These findings provide a new perspective for understanding the potential applications of CNPs in tissue repair and regenerative medicine.



INTRODUCTION

Echinococcosis is a zoonotic infectious disease caused by Echinococcus eggs and is primarily classified as cystic echinococcosis or alveolar echinococcosis, with the liver being the main target organ. The current treatment for patients with hepatic cystic echinococcosis (HCE) is primarily surgical supported by adjunctive medical therapy[1,2]. Approximately 5%-15% of Echinococcus cyst walls undergo calcification and necrosis[3], which can inhibit disease progression, and patients with calcified cysts generally have a better prognosis[4]. Calcifying nanoparticles (CNPs) have been identified in the cells of calcified cyst walls[5,6]. Although the mechanisms underlying cyst wall calcification remains unclear, evidence suggests that this process is closely associated with cell damage and necrosis, leading to localized disturbances in calcium phosphate metabolism and the formation of calcium phosphate deposits[4]. Thus, investigating the mechanisms underlying cyst wall calcification is crucial for improving treatment strategies for patients with echinococcosis.

CNPs are protein complexes consisting of hydroxyapatite and were first discovered by Kajander and Ciftçioglu[7] in fetal bovine serum. Ranging from 50-500 nm in diameter, they were once referred to as “special nanobacteria”; however, recent studies have revealed that the so-called “nanobacteria” are actually protein-inorganic complexes[8-10], making the term CNPs a more accurate designation. CNPs have been closely associated with various calcification-related diseases, such as atherosclerosis[11], placental calcification[12], and kidney stones[13].

Nanoscale hydroxyapatites (nHAPs) are inorganic bioceramic materials primarily composed of Ca10(PO4)6(OH)2, which bear significant similarity to the composition of human bones and teeth. nHAPs are widely utilized in bone tissue engineering, soft and hard tissue repair, and as drug delivery carriers due to their high biocompatibility and osteogenic properties[14-17]. Traditional hydroxyapatite particles have a relatively larger particle size, whereas nHAPs, with their smaller particle size and higher crystallinity, exhibit improved dispersibility, bioactivity, and enhanced calcification effects[18,19]. Research indicates that nHAPs provide a microenvironment analogous to natural bone, promoting the apoptosis, differentiation, and calcification of bone marrow mesenchymal stem cells (BMSCs), thereby accelerating bone tissue formation[20]. Furthermore, nHAPs share several similarities with CNPs in terms of their structural composition, biocompatibility, and ability to promote calcification[21,22]. CNPs, like hydroxyapatite, are primarily composed of calcium phosphate with a calcium-to-phosphorus ratio of approximately 1.67, closely resembling that of nHAPs[23,24]. Identifying differences in their activities will facilitate a better understanding of the regulatory processes involved in capsular calcification.

CNPs and nHAPs influence the biological functions of BMSCs through various mechanisms, such as inhibiting cell proliferation, inducing cell apoptosis, or regulating the calcification process[25,26]. The transforming growth factor-β (TGF-β) signaling pathway plays a central role in regulating cell proliferation, differentiation, and matrix calcification through both Smad-dependent and non-Smad-dependent pathways[27,28]. Currently, comprehensive and systematic research on the interactions between CNPs, nHAPs, and the TGF-β signaling pathway has not been sufficiently explored. Understanding this mechanism will not only provide insights into the regulatory processes of HCE cyst wall calcification but may also offer new perspectives for the study of other calcification-related diseases.

BMSCs are a type of stem cell with self-renewal, multipotent differentiation potential, and immunoregulatory functions. They are widely applied in the fields of tissue repair and regenerative medicine. Echinococcus cyst wall cells isolated from patients with HCE are primarily composed of fibroblasts derived from BMSCs[29,30]. Given their strong differentiation and proliferation capabilities, this study focused on BMSCs to explore the biological effects of CNPs and nHAPs on these cells. Using in vitro experiments, this study compared the effects of CNPs and nHAPs on BMSC proliferation, apoptosis, and calcification, while exploring the potential role of the TGF-β signaling pathway in these processes. This study aimed to investigate whether CNPs can induce apoptosis and calcification in BMSCs and analyzed the relationship between these two processes. Additionally, the study compared the differential effects of CNPs and nHAPs in inducing apoptosis and calcification in BMSCs.

MATERIALS AND METHODS
Experimental cell source and culture

Murine BMSCs used in this study were obtained from Cyagen Biosciences, Santa Clara, California. Primary mesenchymal stem cells were cultured in a medium containing stem cell growth factor, 10% fetal bovine serum, and 1% penicillin-streptomycin and incubated under conditions of 37 °C, 5% CO2, and saturated humidity.

Preparation of CNPs and nHAPs

CNPs obtained from prior experimental studies from March 1, 2023 to July 31, 2023 were utilized for analysis. Studies involving human-derived materials complied with all relevant national regulations and institutional policies, adhering to the principles of the Declaration of Helsinki. All methods were conducted in accordance with established guidelines and regulations. This study was approved by the Institutional Review Board of the First Affiliated Hospital of Shihezi University (approval No. KJ2022-221-02; date: February 20, 2023). Prior to any experimental procedures, comprehensive information about the study was provided to all participants, and informed consent was obtained through signed agreements.

The CNPs were observed under an SSX-550 scanning electron microscope (SEM) and an H-7650 transmission electron microscope (TEM), with particle size analysis performed using FlowJo, LLC. Using TEM, XRD semiquantitative analysis, TEM-EDS, and observation of nHAPs (Supplementary Figure 1). The nanoparticles were diluted to concentrations of 2.0, 4.0, and 6.0 McFarland (MCF) turbidity. Commercially sourced nHAPs (Sigma, MO, United States) were dissolved in phosphate-buffered saline (PBS), sonicated for 8 hours, and similarly diluted to 2.0, 4.0, and 6.0 MCF prior to experimental use.

Experimental grouping

BMSCs were used as experimental subjects after reaching the third passage of the primary culture, and adherent monolayer cells were selected for the experiments. Cells were divided into different groups and treated with various concentrations of the reagent for 72 hours. The experimental groups are listed in Table 1. The experimental design flowchart for this study is detailed in the Supplementary Figure 2.

Table 1 Experimental grouping.
Group
Treatment
ControlBMSCs + PBS
L-nHAPs (low concentration)BMSCs + 2 MCF nHAPs
M-nHAPs (medium concentration)BMSCs + 4 MCF nHAPs
H-nHAPs (high concentration)BMSCs + 6 MCF nHAPs
L-CNPs (low concentration)BMSCs + 2 MCF CNPs
M-CNPs (medium concentration)BMSCs + 4 MCF CNPs
H-CNPs (high concentration)BMSCs + 6 MCF CNPs
M-CNPs + SB431542BMSCs + 4 MCF CNPs, followed by 1-hour treatment with 10 μM SB431542 after 3 days of culture
CCK-8 assay for detection of cell proliferation

BMSCs in the logarithmic growth phase were collected and suspended in complete medium to create a single-cell suspension at a concentration of 5 × 104 cells/mL. The suspension was seeded into 96-well plates (100 μL/well) and incubated for 24 hours at 37 °C with 5% CO2. After the cells adhered, the medium was discarded, and the cells were treated according to the experimental groups, with five replicates per group. After intervention, the medium was discarded, and 100 μL of 10% CCK-8 solution (Full Gold Bio, China) was added to each well. The cells were then incubated for 1 hour. Optical density at 450 nm was measured using a microplate reader (Bio-Rad, Hercules, CA, United States), and data analysis was performed using GraphPad Prism v.10.1.2 software.

Flow cytometry detection of cell apoptosis

After 72 hours of treatment, the cells from the experimental groups were washed with PBS and digested with trypsin. The cells were then centrifuged at 1000 rpm for 5 minutes and resuspended in binding buffer. Annexin V-PE and 7-AAD dyes (Annexin V PE/7AAD Kit, BD Biosciences, CA, United States) were added, and the cells were incubated at 4 °C in the dark for 10 minutes. Apoptosis was analyzed within 30 minutes using a flow cytometer (Urtech, China).

Observation of calcium deposition by eosin staining

BMSCs were seeded in 24-well plates, washed with PBS, and fixed in 10% neutral formalin for 10-30 minutes. Samples were washed twice with PBS. Alizarin Red S staining solution (Calcium Salt Staining Kit, Solarbio, China) was added, and cells were stained for 1-5 minutes. After removing the staining solution, the cells were washed twice with PBS. Calcium deposits were observed under a microscope, with positive cells appearing orange-red.

Quantitative reverse-transcription polymerase chain reaction

Based on preliminary experimental results, a concentration of 4 MCF was selected as the “moderate” dose for polymerase chain reaction (PCR) and western blotting experiments, as it provided a balanced response in apoptosis and calcification induction without excessive cytotoxicity. Cells were seeded in 6-well plates and cultured for 24 hours before experimental intervention (as per the grouping described in Table 1, with treatment for 72 hours). The cell supernatants were collected, and total RNA was extracted using TRIzol reagent. Osteopontin (OPN), bone morphogenetic protein-2 (BMP-2), Bcl-2, caspase3, BAX, TGF-β, and Smad3 gene expression were measured by quantitative reverse-transcription PCR. Each experiment was repeated six times, with GAPDH as the internal control. The relative mRNA expression levels of each gene were determined. The primers used for PCR are listed in Table 2.

Table 2 Primer used for quantitative reverse-transcription polymerase chain reaction for detection of mRNA expression.
GenePrimers (5’-3’)
Forward
Reverse
OPNTCCAATCGTCCCTACAGTCGGGGACTCCTTAGACTCACCG
BMP-2CCGCTCCACAAACGAGAAAACAGCAAGGGGAAAAGGACAC
Bcl-2GCCTTCTTTGAGTTCGGTGGATCAAACAGAGGTCGCATGC
Caspase3CAGCCAACCTCAGAGAGACAACAGGCCCATTTGTCCCATA
BAXAAGAAGCTGAGCGAGTGTCTCCCCAGTTGAAGTTGCCATC
TGF-β1TCGCTTTGTACAACAGCACCACTGCTTCCCGAATGTCTGA
Smad3CAGCCACCATGAATTACGGGTTCTCGGGAATGGAATGGCT
GAPDHTGTTGCCATCAATGACCCCTTCTCCACGACGTACTCAGCG
Western blotting

After overnight culture of BMSCs in 6-well plates, the cells were treated according to the grouping described in Table 1 for 72 hours. The cells were collected and washed with PBS. RIPA lysis buffer was added to extract total protein, and the protein concentration was measured using a BCA protein assay kit. Protein samples were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to polyvinylidene fluoride membranes, and blocked at room temperature for 1 hour. Subsequently, primary antibodies (goat anti-rabbit immunoglobulin G H & L, HRP-conjugated) were incubated overnight at 4 °C for the following targets: OPN (1:500, Affinity, China), BMP-2 (1:400, Affinity, China), Bcl-2 (1:500, Affinity, China), caspase3 (1:400, Affinity, China), BAX (1:500, Affinity, China), TGF-β (1:400, Affinity, China), Smad3 (1:500, Affinity, China), p-Smad3 (1:400, Affinity, China), and β-actin (1:1000, Affinity, China). Subsequently, the corresponding horseradish peroxidase-conjugated secondary antibodies (1:5000/1:10000; Abcam, Cambridge, United Kingdom) were incubated for 1 hour. Finally, the protein bands were visualized and analyzed using the ChemiScope Mini chemiluminescence imaging system (Shanghai Qinxiang Scientific Instrument, China).

Statistical analysis

Data analysis was performed using SPSS (v.26.0; IBM, Chicago, IL, United States) and GraphPad Prism v.10.1.2 software. Normally distributed data are presented as mean ± SD, with all experiments conducted in triplicate. Differences between groups were analyzed using one-way analysis of variance (ANOVA), and a P value of < 0.05 was considered statistically significant.

RESULTS
Characterization of CNPs

SEM revealed that the CNPs were spherical, rod-like, or irregularly shaped (Figure 1A). These nanoparticles generally had uniform internal structures with crystalline features. TEM and particle size analysis (Figure 1B-E) clearly showed that the diameter of the calcified nanoparticles ranged from approximately 100 nm to 500 nm. These particles were distributed in clusters, and further observation revealed numerous needle-like crystals attached to their surfaces. Based on these observations, the cultured CNPs had some similarities with those reported in previous studies[6]. nHAPs were purchased from Sigma (MO, United States) and were characterized using SEM and particle size analysis, as shown in Supplementary Figure 1. These nHAPs exhibited a typical rod-shaped morphology.

Figure 1
Figure 1 Ultrastructural morphology of calcifying nanoparticles observed by scanning electron microscope and transmission electron microscope. A: Scanning electron microscope images of calcifying nanoparticles (CNPs); B-D: Transmission electron microscope images of CNPs at different magnifications; E: Distribution of CNP diameters.
Proliferation of BMSCs

Cell proliferation was assessed using the CCK-8 assay, with the results showing cell survival and apoptosis rates for each group (Table 3). As the concentration of CNPs increased, cell viability gradually decreased (Figure 2). Notably, CNPs exhibited significantly higher toxicity toward BMSCs than nHAPs. Both nHAPs and CNPs had significantly higher cytotoxicity than the control group (P < 0.05; Table 3). Furthermore, the group treated with the TGF-β pathway inhibitor showed greater cell proliferation compared with the M-CNPs group (P < 0.05), with no significant differences when compared with the nHAPs group. In terms of apoptosis, the TGF-β inhibitor group significantly reduced the apoptosis rate compared with the M-nHAPs and M-CNPs groups (P < 0.05).

Figure 2
Figure 2 The trends of bone marrow mesenchymal stem cell proliferation and apoptosis on exposure to different concentrations of nanoscale hydroxyapatites and different concentrations of calcifying nanoparticles groups compared with controls. A: The trends of bone marrow mesenchymal stem cell proliferation on exposure to different concentrations of nanoscale hydroxyapatites and different concentrations of calcifying nanoparticles groups compared with controls; B: The trends of bone marrow mesenchymal stem cell apoptosis on exposure to different concentrations of nanoscale hydroxyapatites and different concentrations of calcifying nanoparticles groups compared with controls. L-nHAPs: Low concentration nanoscale hydroxyapatites; M-nHAPs: Medium concentration nanoscale hydroxyapatites; H-nHAPs: High concentration nanoscale hydroxyapatites; L-CNPs: Low concentration calcifying nanoparticles; M-CNPs: Medium concentration calcifying nanoparticles; H-CNPs: High concentration calcifying nanoparticles.
Table 3 Statistical analysis of cell proliferation and apoptosis of bone marrow mesenchymal stem cells treated with nanoscale hydroxyapatite and calcifying nanoparticles (mean ± SD, n = 6).
Group
Survival rate
Control100 ± 3.588
L-nHAPs89.253 ± 6.804a
M-nHAPs74.173 ± 9.219a,b
H-nHAPs54.134 ± 6.466a,b,c
L-CNPs84.689 ± 10.851a,c,d
M-CNPs55.06 ± 5.654a,b,c,e
H-CNPs38.757 ± 11.199a,b,c,d,e,f
M-CNPs + SB43154274.504 ± 7.12a,b,d,e,f,g
Concentration-dependent induction of apoptosis in BMSCs by CNPs in vitro

Flow cytometry was used to assess apoptotic cells stained with FITC Annexin V and/or PI in triplicate. In Figure 3, the lower right quadrant represents early apoptotic cells (annexin V-positive, PI-negative), whereas the upper right quadrant indicates the percentage of necrotic and late apoptotic cells (annexin V-positive, PI-positive). After 72 hours of treatment with different concentrations of nHAPs and CNPs, both the CNPs and nHAPs induced apoptosis (Figure 3). The proportions of early apoptotic (Annexin V-positive, PI-negative) and late apoptotic (Annexin V-positive, PI-positive) cells in the CNP-treated group were significantly higher than those in the nHAP-treated group (Figure 3). Specifically, the L-nHAPs group showed a significantly lower proportion of apoptotic cells when compared with the L-CNPs group (11.257% ± 0.895% vs 19.745% ± 1.302%, P < 0.05). Similarly, the M-nHAPs group had a significantly lower proportion of cells in apoptosis compared with the M-CNPs group (22.175% ± 1.776% vs 34.397% ± 2.002%, P < 0.05) and the H-nHAPs group showed a significant difference in the proportion of cells in apoptosis compared with the H-CNPs group (31.618% ± 2.622% vs 43.505% ± 1.96%, P < 0.05). All treatment groups showed significant differences in the proportion of apoptotic cells compared with the control group (P < 0.05) (Table 4). Furthermore, when M-CNPs were combined with SB431542, the apoptosis rate was significantly lower than that observed with M-CNPs alone (16.543% ± 0.76% vs 34.397% ± 2.002%, P < 0.05) (Table 4).

Figure 3
Figure 3 Flow cytometric analysis of apoptosis in bone marrow mesenchymal stem cells on exposure to different concentrations of nanoscale hydroxyapatites and different concentrations of calcifying nanoparticles compared with controls. L-nHAPs: Low concentration nanoscale hydroxyapatites; M-nHAPs: Medium concentration nanoscale hydroxyapatites; H-nHAPs: High concentration nanoscale hydroxyapatites; L-CNPs: Low concentration calcifying nanoparticles; M-CNPs: Medium concentration calcifying nanoparticles; H-CNPs: High concentration calcifying nanoparticles.
Table 4 Statistical analysis of apoptosis in bone marrow mesenchymal stem cells treated with nanoscale hydroxyapatite and calcifying nanoparticles (mean ± SD, n = 6).
Group
Apoptosis rate
Control2.52 ± 0.822
L-nHAPs11.257 ± 0.895a
M-nHAPs22.175 ± 1.776a,b
H-nHAPs31.618 ± 2.622a,b,c
L-CNPs19.745 ± 1.302a,b,d
M-CNPs34.397 ± 2.002a,b,c,e
H-CNPs43.505 ± 1.96a,b,c,d,e,f
M-CNPs + SB43154216.543 ± 0.76a,b,c,d,e,f,g
Calcium deposition in BMSCs was analyzed using Alizarin Red staining

Compared with the control group, both the nHAPs and CNPs groups exhibited significant calcium deposition, with a clear concentration-dependent trend. The H-nHAP group exhibited the most prominent calcium deposition. In addition, the SB431542 + M-CNP group showed significantly lower calcium deposition than that in the M-CNP group. Furthermore, the calcium deposition patterns observed under a microscope differed between the nHAPs and CNPs treatments (Figure 4).

Figure 4
Figure 4 Calcium deposition in bone marrow mesenchymal stem cells after alizarin red staining in the indicated treatment groups (× 100). L-nHAPs: Low concentration nanoscale hydroxyapatites; M-nHAPs: Medium concentration nanoscale hydroxyapatites; H-nHAPs: High concentration nanoscale hydroxyapatites; L-CNPs: Low concentration calcifying nanoparticles; M-CNPs: Medium concentration calcifying nanoparticles; H-CNPs: High concentration calcifying nanoparticles.
Expression of apoptosis and calcification-related genes induced by CNPs in BMSCs

Gene expression was measured using quantitative reverse-transcription PCR. Compared with the control group, both the M-nHAPs and M-CNPs groups significantly promoted the expression of apoptosis-related genes and calcification genes, while downregulating the expression of the anti-apoptotic gene Bcl-2 (P < 0.05; Figure 5). Compared with the M-nHAPs group, the expression of caspase3 in BMSCs treated with CNPs was significantly higher (P < 0.05). As an anti-apoptotic gene, the expression of Bcl-2 in the M-CNPs group was significantly lower than that in the M-nHAPs group (P < 0.01), with a relative expression of 0.3 (Table 5). Meanwhile, no significant differences were observed in the expression of OPN, BMP-2, TGF-β/Smad family genes, and BAX between the nHAPs and CNPs groups. Notably, compared with the M-CNPs group, the M-CNPs + SB431542 group significantly reduced the expression of apoptosis and calcification-related genes and increased the expression of anti-apoptotic genes, suggesting that the TGF-β/Smad pathway may play a key role in this process. These results indicated that nHAPs and CNPs may influence cells by inducing apoptosis and calcification, supporting the hypothesis regarding their potential role in regulating the initiation of calcification and apoptosis mechanisms in cells.

Figure 5
Figure 5 Polymerase chain reaction gene detection of apoptosis and calcification gene expression in the indicated intervention groups. A: Osteopontin expression in the indicated intervention groups; B: Bone morphogenetic protein-2 expression in the indicated intervention groups; C: Bcl-2 expression in the indicated intervention groups; D: Caspase3 expression in the indicated intervention groups; E: BAX expression in the indicated intervention groups; F: Smad3 expression in the indicated intervention groups; G: Transforming growth factor-β expression in the indicated intervention groups. aP < 0.05, bP < 0.01. OPN: Osteopontin; BMP-2: Bone morphogenetic protein-2; TGF-β: Transforming growth factor-β; M-nHAPs: Medium concentration nanoscale hydroxyapatites; M-CNPs: Medium concentration calcifying nanoparticles.
Table 5 Gene expression of bone marrow mesenchymal stem cells treated with nanoscale hydroxyapatite and calcifying nanoparticles, mean ± SD.
Group
OPN
BMP-2
Bcl-2
Caspase3
Bax
TGF-β
Smad3
Control1.016 ± 0.2051.018 ± 0.2081.007 ± 0.1331.008 ± 0.1471.002 ± 0.0751.010 ± 0.1611.007 ± 0.118
M-nHAPs2.384 ± 0.577a1.996 ± 0.332a0.584 ± 0.134a2.169 ± 0.232a1.919 ± 0.210a1.714 ± 0.305a1.617 ± 0.210a
M-CNPs2.437 ± 0.535a2.131 ± 0.362a0.324 ± 0.049a,b1.839 ± 0.207a,b1.767 ± 0.105a1.930 ± 0.258a1.861 ± 0.341a
M-CNPs + SB4315421.520 ± 0.447b,c1.356 ± 0.266b,c0.878 ± 0.113b,c1.329 ± 0.182a,b,c1.208 ± 0.227b,c1.279 ± 0.156b,c1.177 ± 0.253b,c

In this study, the expression of OPN, BMP-2 (calcification-related proteins), and p-Smad3, as well as apoptosis markers BAX, caspase3, and TGF-β, were significantly higher in the CNPs treatment group compared with the nHAPs group or the control group (P < 0.05). Additionally, the expression of Bcl-2 in the CNPs group was significantly lower than that in the control group (P < 0.05; Figures 6 and 7, Table 6). However, the expression of Smad3 protein was higher in the M-nHAPs group than that in the CNPs group but still showed a statistically significant difference compared with the control group (P < 0.05). This may have been influenced by experimental conditions, leading to errors in protein detection levels. Nevertheless, phosphorylated Smad3 expression in the CNPs group was significantly higher than that in the nHAPs group (P < 0.05). These results suggest that nHAPs may have a similar effect as CNPs in inducing Smad3 expression, but CNPs demonstrate a more pronounced advantage in promoting Smad3 phosphorylation.

Figure 6
Figure 6 Western blotting analysis of calcification- and apoptosis-related proteins in bone marrow mesenchymal stem cells. OPN: Osteopontin; BMP-2: Bone morphogenetic protein-2; TGF-β: Transforming growth factor-β; M-nHAPs: Medium concentration nanoscale hydroxyapatites; M-CNPs: Medium concentration calcifying nanoparticles.
Figure 7
Figure 7 Western blotting quantification of protein levels. A-H: Western blotting quantification of osteopontin (A), bone morphogenetic protein-2 (B), Bcl-2 (C), caspase3 (D), BAX (E), Smad3 (F), p-Smad3 (G), transforming growth factor-β (H) levels. aP < 0.05, bP < 0.01, NS: P > 0.05. OPN: Osteopontin; BMP-2: Bone morphogenetic protein-2; TGF-β: Transforming growth factor-β; M-nHAPs: Medium concentration nanoscale hydroxyapatites; M-CNPs: Medium concentration calcifying nanoparticles.
Table 6 Protein expression of bone marrow mesenchymal stem cells treated with nanoscale hydroxyapatite and calcifying nanoparticles, mean ± SD.
Protein
Control
M-nHAPs
M-CNPs
M-CNPs + SB431542
OPN0.307 ± 0.0140.463 ± 0.042a0.629 ± 0.047a,b0.471 ± 0.034a,c
BMP-20.319 ± 0.0350.411 ± 0.040a0.552 ± 0.031a,b0.398 ± 0.062a,c
Bcl-20.684 ± 0.0530.568 ± 0.059a0.446 ± 0.025a,b0.545 ± 0.036a,c
Caspase30.370 ± 0.0500.481 ± 0.043a0.673 ± 0.092a,b0.489 ± 0.050a,c
BAX0.364 ± 0.0320.448 ± 0.035a0.527 ± 0.032a,b0.451 ± 0.024a,c
TGF-β0.383 ± 0.0590.500 ± 0.054a0.638 ± 0.040a,b0.495 ± 0.055a,c
Smad30.639 ± 0.0340.687 ± 0.056a0.660 ± 0.025a,b0.683 ± 0.046a,c
p-Smad30.721 ± 0.0360.778 ± 0.041a0.877 ± 0.021a,b0.767 ± 0.041a,c
DISCUSSION

The origin of CNPs remains controversial. Some studies suggest that CNPs originate from the calcification process within the organism, whereas others propose that they may be a special form of microorganisms, even referred to as “nanobacteria”[31]. An increasing number of studies suggest that CNPs are inorganic mineral nanoparticles, primarily composed of fetuin-A, with a strong calcium-phosphorus affinity[9,13,32]. This study characterized the morphology of the CNPs using SEM and TEM, and the results showed that these were irregularly aggregated crystals[33], further confirming their calcification properties[18]. CNPs stimulate the expression of apoptosis- and calcification-related proteins and inhibit cell proliferation[34]. Compared with traditional nHAPs, CNPs exerted a stronger cell-inhibitory effect and demonstrated a concentration-dependent response. CCK-8 assays showed that CNPs significantly inhibited the proliferation of BMSCs (Figure 2). Flow cytometry analysis indicated that CNPs not only induced apoptosis in BMSCs but also exhibited a stronger effect than that of nHAPs (Figure 3). This apoptosis-inducing effect may be attributed to the hydroxyapatite components in both nHAPs and CNPs, which interact with the cell membrane and internal cellular structures. This interaction triggers cellular stress responses and damages signaling pathways, leading to cytotoxicity and inhibition of cell growth[35,36]. As organic composites, CNPs exhibit stronger cell adhesion, enabling them to be engulfed by cells. Their accumulation within the cells induces cytotoxicity, thereby triggering apoptosis. Additionally, CNPs may promote local calcium phosphate deposition by facilitating the release of intracellular calcium ions, ultimately leading to calcification of the cell membrane. Alizarin Red staining further confirmed the role of CNPs in calcium deposition. The nHAPs group showed significant calcium deposition, whereas the CNPs group exhibited less marked calcium deposition, which may be related to the higher calcium content in the nHAPs. The results of this study suggested that CNPs play a role in calcific diseases by inducing apoptosis and calcification[37,38].

CNP-induced cell apoptosis and calcification can be detected not only through CCK-8, flow cytometry, and Alizarin Red staining assays, but also indirectly by the upregulation of the expression of pro-apoptotic BAX, caspase, and pro-calcification OPN and BMP-2, as well as by the downregulation the expression of anti-apoptotic Bcl-2 protein. Exposure to CNPs upregulated the expression of the pro-apoptotic genes BAX and caspase and downregulated the expression of the anti-apoptotic gene Bcl-2 (Figures 5 and 7). Apoptotic pathways are classified into the mitochondrial and death receptor pathways. The mitochondrial pathway promotes apoptosis through activation of the Bcl-2 family, caspases, and mitochondrial apoptotic factors[39,40]. In the Bcl-2 family, pro-apoptotic proteins increase the permeability of the mitochondrial membrane, promote the release of cytochrome c, and activate downstream caspases, thereby triggering cell apoptosis[41-43].

Previous experimental studies have shown that selecting 2 MCF or 6 MCF may negatively affect cell proliferation or apoptosis, thereby reducing their biological effects. We used PCR and western blotting to analyze an intermediate 4 MCF of hydroxyapatite and nanoparticles. The results revealed that CNPs significantly upregulated gene and protein expression of BAX and caspase, while downregulating the anti-apoptotic protein Bcl-2, indicating that CNPs promote BMSCs apoptosis by activating the mitochondrial pathway. Although the PCR results showed a deviation in the expression of the caspase gene contrary to expectations (Table 5), the western blotting results were consistent with the anticipated outcomes, confirming that the final biological effects were primarily driven at the protein level. This suggests that although gene transcription is regulated by multiple factors, effective protein translation can still reflect its biological function. Additionally, BMSCs are capable of phagocytosing CNPs and internalizing them in the mitochondria. Compared with nHAPs, CNPs can induce a stronger apoptotic response[13,37,38]. Intracellular calcium ions as secondary messengers regulate various cellular functions. During apoptosis, the release of calcium ions further promotes calcification processes[44]. Smooth muscle cells undergo apoptosis. The released apoptotic bodies are rich in calcification-related proteins, which promote calcium-phosphorus deposition and transformation to hydroxyapatite[45,46]. Regarding the calcification mechanism, both the CNPs and nHAPs groups showed significantly upregulated expression of OPN and BMP-2; however, the expression in the CNPs group was higher than that observed in the nHAPs group (Table 6). Although previous studies have reported the potential of nHAPs in promoting BMSCs calcification, this study was the first to highlight the dual role of CNPs in promoting both apoptosis and calcification. Both processes are causally related and mutually reinforcing, with CNPs being more effective than nHAPs at promoting apoptosis and calcification.

The dual role of the TGF-β/Smad signaling pathway in both cell apoptosis and calcification has been widely studied[47,48]. In terms of promoting apoptosis, TGF-β activates Smad3 and forms p-Smad3, which in turn regulates the expression of downstream genes, promoting cell apoptosis. This includes upregulating pro-apoptotic factors such as BAX and BIM, while inhibiting anti-apoptotic factors such as Bcl-2 and Bcl-XL[49]. Although the TGF-β/Smad pathway is the main regulator in this study, potential cross-talk with BMP signaling should be considered, as evidenced by the changes in BMP-2 expression. Further studies are needed to explore this interaction. In terms of promoting cell calcification, TGF-β induces the differentiation of mesenchymal cells into chondrocytes and promotes calcification and osteogenesis, enhancing the effect of BMP-2. OPN, a downstream gene in the BMP-2 signaling pathway, works with BMP-2 during calcification to regulate calcium deposition. In this study, when the TGF-β pathway inhibitor SB431542 was co-cultured with CNPs, cell viability in the inhibitor treated group was significantly higher than that in the CNPs and nHAPs groups (Figure 2), and calcium deposition was notably lower than that in the M-CNP group (Figure 3). PCR and western blotting analysis further revealed that the expression of TGF-β and Smad3 was upregulated in the CNPs and nHAPs groups, with the CNPs group showing a more significant regulatory effect on key TGF-β/Smad family proteins. On exposure to the inhibitor, the expression of TGF-β pathway-related proteins, such as Smad3, OPN, BMP-2, BAX, and caspases, was significantly downregulated, whereas Bcl-2 expression was upregulated. Overall, the TGF-β/Smad signaling pathway plays a crucial role in CNPs-induced cell apoptosis and calcification, suggesting that this pathway may serve as an important target for regulating the biological functions of CNPs.

This study has several limitations that should be acknowledged. The study was limited to in vitro experiments, which differ significantly from the complex in vivo microenvironment. Future studies should investigate the in vivo relevance of CNPs in models such as the murine liver hydatid cyst model, which could better mimic the human disease environment. Future studies in vivo should explore the impact of CNPs on the calcification of hydatid cyst walls and their potential role in other calcifying diseases. Moreover, this study only used TGF-β signaling pathway inhibitors to evaluate the expression of apoptosis and calcification genes and proteins, without delving into the specific regulatory mechanisms. It remains to be clarified how this signaling pathway precisely transmits signals to regulate cell fate during apoptosis and calcification, which is an important direction for future research.

CONCLUSION

In conclusion, our study revealed that CNPs regulate the survival status of BMSCs through multiple signaling pathways, promoting their proliferation inhibition, apoptosis, and calcium deposition, with these processes being modulated by the TGF-β signaling pathway.

ACKNOWLEDGEMENTS

I would like to express my gratitude to my supervisor for the invaluable guidance and support throughout this research.

References
1.  Peng X, Zhang S, Niu J, Wu X, Pan H, Mu L, Chen Y, Yang H. [Total subadventitial cystectomy for the treatment of 30 patients with hepatic hydatid cyst]. Zhonghua Putong Waike Zazhi. 2002;17:529-530.  [PubMed]  [DOI]  [Full Text]
2.  Guidelines for treatment of cystic and alveolar echinococcosis in humans. WHO Informal Working Group on Echinococcosis. Bull World Health Organ. 1996;74:231-242.  [PubMed]  [DOI]
3.  Alshoabi SA, Alkalady AH, Almas KM, Magram AO, Algaberi AK, Alareqi AA, Hamid AM, Alhazmi FH, Qurashi AA, Abdulaal OM, Aloufi KM, Alsharif WM, Alsultan KD, Omer AM, Gareeballah A. Hydatid Disease: A Radiological Pictorial Review of a Great Neoplasms Mimicker. Diagnostics (Basel). 2023;13:1127.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 29]  [Cited by in RCA: 39]  [Article Influence: 13.0]  [Reference Citation Analysis (1)]
4.  Wang SB, Sun HH, Ma YB, Dai Y, Ren Q, Liu YQ, Shi CH, Toa J, Li J. Whole-transcriptome sequencing and bioinformatics analysis of calcified outer-layer tissue from cystic echinococcosis. Trop Biomed. 2024;41:20-28.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
5.  Shi H, Niu S, Su X, Xu F, Wu X, Zhang H, Wang Y, Yang J. Characterization of Calcifying Nanoparticles Isolated and Cultured in the Outer Capsule Wall of Hepatic Hydatid Cyst and their Correlation with Autophagy. Acta Parasitol. 2025;70:148.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
6.  Yang J, Wang M, Yang J, Chu Z, Chen X, Wu X, Peng X. Calcifying nanoparticles initiate the calcification process of mesenchymal stem cells in vitro through the activation of the TGF-β1/smad signaling pathway and promote the decay of echinococcosis. Open Life Sci. 2022;17:1335-1346.  [PubMed]  [DOI]  [Full Text]
7.  Kajander EO, Ciftçioglu N. Nanobacteria: an alternative mechanism for pathogenic intra- and extracellular calcification and stone formation. Proc Natl Acad Sci U S A. 1998;95:8274-8279.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 348]  [Cited by in RCA: 276]  [Article Influence: 9.9]  [Reference Citation Analysis (1)]
8.  Martel J, Young JD. Purported nanobacteria in human blood as calcium carbonate nanoparticles. Proc Natl Acad Sci U S A. 2008;105:5549-5554.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 109]  [Cited by in RCA: 81]  [Article Influence: 4.5]  [Reference Citation Analysis (0)]
9.  Raoult D, Drancourt M, Azza S, Nappez C, Guieu R, Rolain JM, Fourquet P, Campagna B, La Scola B, Mege JL, Mansuelle P, Lechevalier E, Berland Y, Gorvel JP, Renesto P. Nanobacteria are mineralo fetuin complexes. PLoS Pathog. 2008;4:e41.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 68]  [Cited by in RCA: 72]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
10.  Kajander EO. Nanobacteria--propagating calcifying nanoparticles. Lett Appl Microbiol. 2006;42:549-552.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 26]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
11.  Hunter LW, Charlesworth JE, Yu S, Lieske JC, Miller VM. Calcifying nanoparticles promote mineralization in vascular smooth muscle cells: implications for atherosclerosis. Int J Nanomedicine. 2014;9:2689-2698.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 17]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
12.  Agababov RM, Abashina TN, Suzina NE, Vainshtein MB, Schwartsburd PM. Link between the early calcium deposition in placenta and nanobacterial-like infection. J Biosci. 2007;32:1163-1168.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 22]  [Cited by in RCA: 26]  [Article Influence: 1.4]  [Reference Citation Analysis (0)]
13.  Hong X, Wang X, Wang T, Yu C, Li H. Role of nanobacteria in the pathogenesis of kidney stone formation. Am J Transl Res. 2016;8:3227-3234.  [PubMed]  [DOI]
14.  Jian H, Wang D, Ruan J, Zhu W. [Biocompatibility study of nano-hydroxyapatite artificial bone]. Zhongguo Xiandai Yixue Zazhi. 2005;15:1477-1480.  [PubMed]  [DOI]  [Full Text]
15.  Alam MK, Sahadat Hossain M, Kawsar M, Bahadur NM, Ahmed S. Synthesis of nano-hydroxyapatite using emulsion, pyrolysis, combustion, and sonochemical methods and biogenic sources: a review. RSC Adv. 2024;14:3548-3559.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 15]  [Article Influence: 7.5]  [Reference Citation Analysis (0)]
16.  Inam H, Sprio S, Tavoni M, Abbas Z, Pupilli F, Tampieri A. Magnetic Hydroxyapatite Nanoparticles in Regenerative Medicine and Nanomedicine. Int J Mol Sci. 2024;25:2809.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 16]  [Reference Citation Analysis (1)]
17.  Tian J, Zhang B, Li S, Yan Q. [Application research of nanohydroxyapatite in biomedical field]. Liaoning Huagong. 2009;38:828-830, 833.  [PubMed]  [DOI]  [Full Text]
18.  Ding Y, Jin C, Mo X, Yu C, Ma L, Ni C.   Research progress and review of nanohydroxyapatite in biomedical field. Proceedings of the 7th China Academic Conference on Functional Materials and Their Applications; 2010 Oct 15; Changsha, Hunan, China. United States: Scientific Research Publishing Inc., 2011: 197-200.  [PubMed]  [DOI]
19.  Zhang P  [Preparation and modification of nanohydroxyapatite]. M.Sc. Thesis, Henan Normal University. 2015. Available from: https://cdmd.cnki.com.cn/Article/CDMD-10476-1015416479.htm.  [PubMed]  [DOI]
20.  Li L, Shu J, Zheng L, Cui Y, Niu Y, Wang Q, Wang Q. [Interactions between bone marrow stromal stem cells and nano-hydroxyapatite]. Zhongguo Zuzhi Gongcheng Yanjiu. 2019;23:132-138.  [PubMed]  [DOI]
21.  Yang Z, Lei Y, Meng Z. [Therapeutic implication of nano-hydroxyapatite in orthopedics]. Zhongguo Zuzhi Gongcheng Yanjiu. 2012;16:9629-9634.  [PubMed]  [DOI]  [Full Text]
22.  Liu Q, Luo Y, Zhao Y, Xiang P, Zhu J, Jing W, Jin W, Chen M, Tang R, Yu H. Nano-hydroxyapatite accelerates vascular calcification via lysosome impairment and autophagy dysfunction in smooth muscle cells. Bioact Mater. 2022;8:478-493.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 24]  [Cited by in RCA: 21]  [Article Influence: 5.3]  [Reference Citation Analysis (1)]
23.  Wang Y, Li G, Li G, Liu X. [Research progress in genetic susceptibility genes and related pathogenic factors and treatment of neoplastic calcinosis]. Guoji Shengwu Yixue Gongcheng Zazhi. 2021;44:496-500, 515.  [PubMed]  [DOI]  [Full Text]
24.  Dorozhkin SV. Calcium orthophosphates in nature, biology and medicine. Materials. 2009;2:399-498.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 606]  [Cited by in RCA: 323]  [Article Influence: 19.0]  [Reference Citation Analysis (1)]
25.  Ma X, Luan Z, Li J. Inorganic Nanoparticles-Based Systems in Biomedical Applications of Stem Cells: Opportunities and Challenges. Int J Nanomedicine. 2023;18:143-182.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 24]  [Reference Citation Analysis (1)]
26.  Alizadeh R, Asghari A, Taghizadeh-Hesary F, Moradi S, Farhadi M, Mehdizadeh M, Simorgh S, Nourazarian A, Shademan B, Susanabadi A, Kamrava K. Intranasal delivery of stem cells labeled by nanoparticles in neurodegenerative disorders: Challenges and opportunities. Wiley Interdiscip Rev Nanomed Nanobiotechnol. 2023;15:e1915.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 4]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
27.  Aashaq S, Batool A, Mir SA, Beigh MA, Andrabi KI, Shah ZA. TGF-β signaling: A recap of SMAD-independent and SMAD-dependent pathways. J Cell Physiol. 2022;237:59-85.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 156]  [Article Influence: 31.2]  [Reference Citation Analysis (3)]
28.  Zhang Y, Alexander PB, Wang XF. TGF-β Family Signaling in the Control of Cell Proliferation and Survival. Cold Spring Harb Perspect Biol. 2017;9:a022145.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 232]  [Cited by in RCA: 526]  [Article Influence: 58.4]  [Reference Citation Analysis (2)]
29.  Albani CM, Cumino AC, Elissondo MC, Denegri GM. Development of a cell line from Echinococcus granulosus germinal layer. Acta Trop. 2013;128:124-129.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 14]  [Cited by in RCA: 15]  [Article Influence: 1.2]  [Reference Citation Analysis (1)]
30.  Shams M, Javanmardi E, Nosrati MC, Ghasemi E, Shamsinia S, Yousefi A, Kordi B, Majidiani H, Nourmohammadi H. Bioinformatics features and immunogenic epitopes of Echinococcus granulosus Myophilin as a promising target for vaccination against cystic echinococcosis. Infect Genet Evol. 2021;89:104714.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 19]  [Article Influence: 3.8]  [Reference Citation Analysis (1)]
31.  Miller VM, Rodgers G, Charlesworth JA, Kirkland B, Severson SR, Rasmussen TE, Yagubyan M, Rodgers JC, Cockerill FR 3rd, Folk RL, Rzewuska-Lech E, Kumar V, Farell-Baril G, Lieske JC. Evidence of nanobacterial-like structures in calcified human arteries and cardiac valves. Am J Physiol Heart Circ Physiol. 2004;287:H1115-H1124.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 110]  [Cited by in RCA: 102]  [Article Influence: 4.6]  [Reference Citation Analysis (0)]
32.  Young JD, Martel J, Young L, Wu CY, Young A, Young D. Putative nanobacteria represent physiological remnants and culture by-products of normal calcium homeostasis. PLoS One. 2009;4:e4417.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 77]  [Cited by in RCA: 75]  [Article Influence: 4.4]  [Reference Citation Analysis (0)]
33.  Wong TY, Wu CY, Martel J, Lin CW, Hsu FY, Ojcius DM, Lin PY, Young JD. Detection and characterization of mineralo-organic nanoparticles in human kidneys. Sci Rep. 2015;5:15272.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 28]  [Cited by in RCA: 31]  [Article Influence: 2.8]  [Reference Citation Analysis (1)]
34.  Du M, Chen J, Liu K, Xing H, Song C. Recent advances in biomedical engineering of nano-hydroxyapatite including dentistry, cancer treatment and bone repair. Compos Part B Eng. 2021;215:108790.  [PubMed]  [DOI]  [Full Text]
35.  Wang Y, Wu H, Chen Z, Cao J, Zhu X, Zhang X. Nano-hydroxyapatite promotes cell apoptosis by co-activating endoplasmic reticulum stress and mitochondria damage to inhibit glioma growth. Regen Biomater. 2024;11:rbae038.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 11]  [Reference Citation Analysis (1)]
36.  Kunishige R, Mizoguchi M, Tsubouchi A, Hanaoka K, Miura Y, Kurosu H, Urano Y, Kuro-O M, Murata M. Calciprotein particle-induced cytotoxicity via lysosomal dysfunction and altered cholesterol distribution in renal epithelial HK-2 cells. Sci Rep. 2020;10:20125.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 5]  [Cited by in RCA: 24]  [Article Influence: 4.0]  [Reference Citation Analysis (1)]
37.  Wu JH, Deng YL, Liu Q, Yu JC, Liu YL, He ZQ, Guan XF. Induction of apoptosis and autophagy by calcifying nanoparticles in human bladder cancer cells. Tumour Biol. 2017;39:1010428317707688.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 10]  [Article Influence: 1.1]  [Reference Citation Analysis (0)]
38.  Zhang M, Yang J, Shu J, Fu C, Liu S, Xu G, Zhang D. Cytotoxicity induced by nanobacteria and nanohydroxyapatites in human choriocarcinoma cells. Nanoscale Res Lett. 2014;9:616.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 4]  [Article Influence: 0.3]  [Reference Citation Analysis (0)]
39.  Joubert V, Bourthoumieu S, Leveque P, Yardin C. Apoptosis is induced by radiofrequency fields through the caspase-independent mitochondrial pathway in cortical neurons. Radiat Res. 2008;169:38-45.  [PubMed]  [DOI]  [Full Text]
40.  Indran IR, Tufo G, Pervaiz S, Brenner C. Recent advances in apoptosis, mitochondria and drug resistance in cancer cells. Biochim Biophys Acta. 2011;1807:735-745.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 368]  [Cited by in RCA: 412]  [Article Influence: 27.5]  [Reference Citation Analysis (0)]
41.  Li P, Nijhawan D, Budihardjo I, Srinivasula SM, Ahmad M, Alnemri ES, Wang X. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell. 1997;91:479-489.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5808]  [Cited by in RCA: 5463]  [Article Influence: 188.4]  [Reference Citation Analysis (4)]
42.  Bhattacharjee M, Acharya S, Ghosh A, Sarkar P, Chatterjee S, Kumar P, Chaudhuri S. Bax and Bid act in synergy to bring about T11TS-mediated glioma apoptosis via the release of mitochondrial cytochrome c and subsequent caspase activation. Int Immunol. 2008;20:1489-1505.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 23]  [Cited by in RCA: 25]  [Article Influence: 1.4]  [Reference Citation Analysis (1)]
43.  Czabotar PE, Garcia-Saez AJ. Mechanisms of BCL-2 family proteins in mitochondrial apoptosis. Nat Rev Mol Cell Biol. 2023;24:732-748.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 491]  [Article Influence: 163.7]  [Reference Citation Analysis (3)]
44.  Moon DO. Calcium's Role in Orchestrating Cancer Apoptosis: Mitochondrial-Centric Perspective. Int J Mol Sci. 2023;24:8982.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 79]  [Cited by in RCA: 74]  [Article Influence: 24.7]  [Reference Citation Analysis (1)]
45.  De Broe M. Calcium regulates key components of vascular smooth muscle cell– derived matrix vesicles to enhance mineralization. Kidney Int. 2011;80:791-792.  [PubMed]  [DOI]
46.  Neels JG, Gollentz C, Chinetti G. Macrophage death in atherosclerosis: potential role in calcification. Front Immunol. 2023;14:1215612.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1]  [Cited by in RCA: 41]  [Article Influence: 13.7]  [Reference Citation Analysis (1)]
47.  Hogan BL. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 1996;10:1580-1594.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 1554]  [Cited by in RCA: 1503]  [Article Influence: 50.1]  [Reference Citation Analysis (0)]
48.  Fabregat I, Herrera B, Sánchez A. Editorial Special Issue TGF-beta/BMP Signaling Pathway. Cells. 2020;9:2363.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 10]  [Reference Citation Analysis (5)]
49.  Deng Z, Fan T, Xiao C, Tian H, Zheng Y, Li C, He J. TGF-β signaling in health, disease, and therapeutics. Signal Transduct Target Ther. 2024;9:61.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 887]  [Cited by in RCA: 864]  [Article Influence: 432.0]  [Reference Citation Analysis (4)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Corresponding Author's Membership in Professional Societies: Surgery Branch of Xinjiang Production and Construction Corps Medical Association, 50525717-8.

Specialty type: Cell biology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade B, Grade B, Grade C

Novelty: Grade A, Grade B, Grade C

Creativity or Innovation: Grade A, Grade B, Grade C

Scientific Significance: Grade A, Grade A, Grade C

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Osman H, PhD, Professor, Saudi Arabia; Zhang S, PhD, China S-Editor: Wang JJ L-Editor: A P-Editor: Wang CH

Write to the Help Desk