Wu T, Zheng F, Tang HY, Li HZ, Cui XY, Ding S, Liu D, Li CY, Jiang JH, Yang RL. Low-intensity pulsed ultrasound reduces alveolar bone resorption during orthodontic treatment via Lamin A/C-Yes-associated protein axis in stem cells. World J Stem Cells 2024; 16(3): 267-286 [PMID: 38577236 DOI: 10.4252/wjsc.v16.i3.267]
Corresponding Author of This Article
Rui-Li Yang, PhD, Professor, Department of Orthodontics, Peking University School and Hospital of Stomatology, National Engineering Laboratory for Digital and Material Technology of Stomatology, Beijing Key Laboratory of Digital Stomatology, No. 22 Zhongguancun South Avenue, Beijing 100081, China. ruiliyangabc@163.com
Research Domain of This Article
Cell Biology
Article-Type of This Article
Basic Study
Open-Access Policy of This Article
This article is an open-access article which was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/
Tong Wu, Fu Zheng, Hong-Yi Tang, Hua-Zhi Li, Xin-Yu Cui, Shuai Ding, Duo Liu, Jiu-Hui Jiang, Rui-Li Yang, Department of Orthodontics, Peking University School and Hospital of Stomatology, National Engineering Laboratory for Digital and Material Technology of Stomatology, Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
Cui-Ying Li, Department of Central Laboratory, Peking University School and Hospital of Stomatology, National Clinical Research Center for Oral Diseases & National Engineering Laboratory for Digital and Material Technology of Stomatology, Beijing Key Laboratory of Digital Stomatology, Beijing 100081, China
Co-corresponding authors: Jiu-Hui Jiang and Rui-Li Yang.
Author contributions: Li CY, Jiang JH, and Yang RL were responsible for the study design and conduction; Jiang JH and Yang RL made equal contributions to the determination of study directions and the design of experimental methods, and they are the co-corresponding authors of this paper; Wu T and Zheng F contributed to the experimental implementation, data analysis, and manuscript writing equally; Tang HY, Li HZ, Cui XY, Ding S, and Liu D participated in some of the experiments; all authors approved the final version for submission.
Supported bythe National Science and Technology Major Project of the Ministry of Science and Technology of China, No. 2022YFA1105800; the National Natural Science Foundation of China, No. 81970940.
Institutional review board statement: The study was approved by Ethical Guidelines of Hospital of Stomatology, Peking University (Approval No. PKUSSIRB-202385020).
Institutional animal care and use committee statement: All procedures involving animals were reviewed and approved by the Ethics Committee for Animal Experiments at Peking University Health Science Center (IACUC protocol number No. LA2022288).
Conflict-of-interest statement: All the authors report no relevant conflicts of interest for this article.
Data sharing statement: No additional data are available.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/
Corresponding author: Rui-Li Yang, PhD, Professor, Department of Orthodontics, Peking University School and Hospital of Stomatology, National Engineering Laboratory for Digital and Material Technology of Stomatology, Beijing Key Laboratory of Digital Stomatology, No. 22 Zhongguancun South Avenue, Beijing 100081, China. ruiliyangabc@163.com
Received: October 26, 2023 Peer-review started: October 26, 2023 First decision: December 17, 2023 Revised: December 30, 2023 Accepted: February 1, 2024 Article in press: February 1, 2024 Published online: March 26, 2024 Processing time: 151 Days and 0.6 Hours
Abstract
BACKGROUND
The bone remodeling during orthodontic treatment for malocclusion often requires a long duration of around two to three years, which also may lead to some complications such as alveolar bone resorption or tooth root resorption. Low-intensity pulsed ultrasound (LIPUS), a noninvasive physical therapy, has been shown to promote bone fracture healing. It is also reported that LIPUS could reduce the duration of orthodontic treatment; however, how LIPUS regulates the bone metabolism during the orthodontic treatment process is still unclear.
AIM
To investigate the effects of LIPUS on bone remodeling in an orthodontic tooth movement (OTM) model and explore the underlying mechanisms.
METHODS
A rat model of OTM was established, and alveolar bone remodeling and tooth movement rate were evaluated via micro-computed tomography and staining of tissue sections. In vitro, human bone marrow mesenchymal stem cells (hBMSCs) were isolated to detect their osteogenic differentiation potential under compression and LIPUS stimulation by quantitative reverse transcription-polymerase chain reaction, Western blot, alkaline phosphatase (ALP) staining, and Alizarin red staining. The expression of Yes-associated protein (YAP1), the actin cytoskeleton, and the Lamin A/C nucleoskeleton were detected with or without YAP1 small interfering RNA (siRNA) application via immunofluorescence.
RESULTS
The force treatment inhibited the osteogenic differentiation potential of hBMSCs; moreover, the expression of osteogenesis markers, such as type 1 collagen (COL1), runt-related transcription factor 2, ALP, and osteocalcin (OCN), decreased. LIPUS could rescue the osteogenic differentiation of hBMSCs with increased expression of osteogenic marker inhibited by force. Mechanically, the expression of LaminA/C, F-actin, and YAP1 was downregulated after force treatment, which could be rescued by LIPUS. Moreover, the osteogenic differentiation of hBMSCs increased by LIPUS could be attenuated by YAP siRNA treatment. Consistently, LIPUS increased alveolar bone density and decreased vertical bone absorption in vivo. The decreased expression of COL1, OCN, and YAP1 on the compression side of the alveolar bone was partially rescued by LIPUS.
CONCLUSION
LIPUS can accelerate tooth movement and reduce alveolar bone resorption by modulating the cytoskeleton-Lamin A/C-YAP axis, which may be a promising strategy to reduce the orthodontic treatment process.
Core Tip: Low-intensity pulsed ultrasound can promote local alveolar bone remodeling and reduce vertical alveolar bone resorption and consequent gingival recession by regulating the osteogenic ability of bone marrow mesenchymal stem cells by upregulating the expression and nuclear translocation of Yes-associated protein decreased by mechanical stress via affecting the cytoskeleton and nuclear skeleton.
Citation: Wu T, Zheng F, Tang HY, Li HZ, Cui XY, Ding S, Liu D, Li CY, Jiang JH, Yang RL. Low-intensity pulsed ultrasound reduces alveolar bone resorption during orthodontic treatment via Lamin A/C-Yes-associated protein axis in stem cells. World J Stem Cells 2024; 16(3): 267-286
Orthodontic treatment for malocclusion usually lasts 2-3 years, which brings great challenges to patient compliance and increases the risk of many complications, such as alveolar bone resorption, gingivitis, and other destructive diseases of the periodontal supporting tissue[1]. The alveolar bone loss caused by long-term orthodontic treatment may be due to imbalanced osteogenic and osteoclast activity.
Low-intensity pulsed ultrasound (LIPUS) usually refers to a pulse-emitted ultrasonic wave with an intensity between 30 and 100 mW/cm2, which is a noninvasive physical mechanical energy source[2]. It is delivered in the form of an acoustic wave and applied to tissue and cells to regulate biochemical functions[3]. As revealed by several clinical trials and animal experiments in vivo, LIPUS can reduce the fracture healing time[4] and effectively treat delayed fracture union[5] and bone nonunion[6], and is safer and noninvasive than other treatments.
LIPUS has also gained attention in the field of orthodontics. In vivo, LIPUS can increase the distance of the teeth movement[7]; a retrospective clinical study also showed that LIPUS reduced the duration of invisible treatment by an average of 49%[8]. In a clinical study, buccal alveolar bone thickness and height did not respond to LIPUS during maxillary arch expansion[9]. In a tooth movement model in rats, LIPUS application increased the number of osteoclasts on the compression side[10]. The increased osteoclasts may lead to alveolar bone resorption and periodontal supporting tissue destruction. It is unclear whether LIPUS regulates alveolar bone remodeling.
Bone marrow mesenchymal stem cells (BMSCs), as bone marrow-derived stem cells, exhibit self-renewal capacity and multiple differentiation potential and can differentiate into multiple types of cells, tissues, and organs under proper conditions[11]. LIPUS could regulate MSC growth[12] and promote chondrogenesis of MSCs seeded on three-dimensionally (3D) printed scaffolds[13]. Besides, MSCs encapsulated in hydrogels of certain stiffness show enhanced osteogenesis ability under LIPUS[14]. Few studies have reported the effect of LIPUS on cells loaded in compression. Whether LIPUS could regulate the property of MSCs under compression force to control the alveolar bone remodeling during orthodontic treatment and the underlying mechanism need to be investigated.
Here, we show that LIPUS could accelerate the orthodontic tooth movement (OTM) and increase alveolar bone density and decreased vertical bone absorption via the Lamin A/C-Yes-associated protein (YAP) axis, suggesting that LIPUS is a promising strategy to accelerate the orthodontic treatment with little side effects.
MATERIALS AND METHODS
Cell culture
The human jawbone tissue sampling protocol gained approval from the Ethical Guidelines of Hospital of Stomatology, Peking University (No. PKUSSIRB-202385020) and was carried out after informed consent was obtained. BMSCs were isolated and cultured following the previously reported protocol[15]. Briefly, we obtained a small piece of cortical bone located above the tooth crown, which required removal during the extraction of the donor’s impacted third molars. The bone was carefully sectioned using a scalpel and subsequently digested using collagenase type I (2 mg/mL; Worthington Biochem, Lakewood, NJ, United States) and dispase II (4 mg/mL; Roche Diagnostic, Indianapolis, IN, United States) for an hour at 37 °C. Single-cell suspensions from the jaw bone were subsequently acquired using 70-μm cell strainers (BD Bioscience, United States). Then, single cells were seeded onto 100-mm dishes at 1 to 1.5 × 106 cells/mL. BMSCs were isolated and cultured following the previously reported protocol[15]. BMSCs were cultivated in Minimum Essential Medium α (VivaCell, Shanghai, China) supplemented with 15% fetal bovine serum (Gibco, Grand Island, NY, United States) and 1% penicillin-streptomycin solution (Cytiva, Shanghai, China) at 37 °C with 5% CO2, and the medium was changed at 3-d intervals. The expression of stem cell surface markers in BMSCs was characterized by flow cytometry according to the manufacturer’s protocol (BD Bioscience).
Transfection of small interfering RNA
Before transfection, the cell culture medium was changed to standard conditions without penicillin-streptomycin solution. The cells were then transfected with control small interfering RNA (siRNA) or YAP1 siRNA (Ribobio, Guangzhou, China) via a riboFECT™ CP Transfection Kit (Ribobio) in accordance with the manufacturer’s instructions. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR), Western blotting, and immunofluorescence staining were subsequently performed to measure the knockdown rate.
Osteogenic differentiation, alkaline phosphatase activity, and alizarin red staining
BMSCs (1 × 105/mL) were seeded onto 6-well plates and cultured until the cell confluence reached 70%-80% before the medium was changed to osteogenic differentiation medium supplemented with L-ascorbic acid (50 μg/mL; Sigma, Missouri, United States), β-glycerophosphate (10 mmol/L; Sigma), and dexamethasone (0.1 μM; Sigma). During osteogenic induction of stem cells, the induction differentiation medium was changed every 3 d.
After induction for 14 d, alkaline phosphatase (ALP) staining (Beyotime, Shanghai, China) were conducted in accordance with the protocol, and so did alizarin red staining (Sigma) after induction for 21 d. For the quantification of mineralization, we dissolved red matrix sediment in 10% cetyl-pyridinium chloride (Macklin, Shanghai, China), and the absorbance of the solution was measured to determine the degree of mineralization quantitatively[16].
Application of a compression force
Compression force was applied to the BMSCs to mimic stress during orthodontic movement[17]. Briefly, a rounded glass sheet (30 mm in diameter) was placed over cell layers close to confluence in a 6-well plate. Stainless steel beads were placed above the glass sheet to adjust the static pressure to 1 g/cm2. The cells were under static compression for 24 h.
LIPUS treatment
In this study, the LIPUS device was obtained from the Institute of Acoustics (Chinese Academy of Sciences, Beijing, China). The device has circular transducers with an area of 9.07 cm2 to match the area of a well in a 6-well plate. The cells were stimulated with LIPUS following the following specifications: 1.5 MHz frequency, 0.2 pulse duration ratio, 30 mW/cm2 incident intensity, and 1.0 kHz repetition rate. Stimulation was applied for 20 min every day in vivo and in vitro until the rats and cells were harvested, and the control group and force group were treated by pseudo-LIPUS. In vivo, the rats under anesthesia were placed at a constant location, after which the transducer was pressed against the side of the cheek closest to the maxillary first molar. In vitro, we attached the transducer to the bottom of the plate corresponding to the well[18].
qRT-PCR
After 7 d of osteogenic induction, we utilized TRIzol reagent (Invitrogen, California, United States) to extract total cellular RNA following the previous protocol[19]. Table 1 displays all the primers used. cDNA synthesis kits (Takara Bio, Tokyo, Japan) were used to prepare first-strand cDNA from RNA through reverse transcription in accordance with the protocol. A ViiaTM 7 Real-time PCR System (Applied Biosystems, Washington, Rhode Island, United States) was used for qRT-PCR, which was carried out in triplicate.
Table 1 Primer sequences for quantitative reverse transcription-polymerase chain reaction.
Gene
Primer sequence
GAPDH
Forward
TCATTGACCTCAACTACATG
Reverse
TCGCTCCTGGAAGATGGTGAT
RUNX2
Forward
TGGTTACTGTCATGGCGGGTA
Reverse
TCTCAGATCGTTGAACCTTGCTA
ALP
Forward
ACTGGTACTCAGACAACGAGAT
Reverse
ACGTCAATGTCCCTGATGTTATG
COL1a1
Forward
GTGCGATGACGTGATCTGTGA
Reverse
CGGTGGTTTCTTGGTCGGT
OCN
Forward
CACTCCTCGCCCTATTGGC
Reverse
CAGCAGAGCGACACCCTAGAC
YAP1
Forward
AGAATCAGTCAGAGTGCTCCAGTG
Reverse
CGCAGCCTCTCCTTCTCCATC
Western blot analysis
After 7 d of osteogenic induction, RIPA buffer containing 1 mM phenylmethanesulfonyl fluoride (Solarbio, Beijing, China) was added for cell lysis, followed by centrifugation at 12000 × g for 20 min at 4 °C. Thereafter, the supernatant was quantified with a BCA assay (Beyotime). Total protein was added to loading buffer, and the mixture was subsequently boiled for 10 min at 100 °C. Thereafter, the samples were stored at -20 °C. Equal amounts of total protein (30 μg) were loaded on sodium dodecyl sulfate-polyacrylamide gels and separated prior to electroblotting onto polyvinylidene difluoride membranes (Millipore, Billerica, Massachusetts, United States). After blocking with 5% bovine serum albumin, the membranes were incubated overnight on a shaker at 4 °C. The primary antibodies used were rabbit anti-type 1 collagen (COL1) and anti-osteocalcin (OCN) (1:500; Abcam, Cambridge, Massachusetts, United States), rabbit anti-ALP (1:500; Invitrogen), and mouse anti-GAPDH (1:1000; ProteinTech, Cook, Illinois, United States). Finally, HRP-labeled secondary antibodies (Zsgb-Bio, Beijing, China) were added for another 1-h incubation, followed by visualization via enhanced chemiluminescence (NCM Biotech, Suzhou, China). ImageJ software was used for band intensity analysis.
Immunofluorescence staining
After 7 d of osteogenic induction, 4% paraformaldehyde (PFA) was added for 15 min to fix the cells, after which the cells were rinsed with phosphate buffered saline (PBS) three times prior to 10 min of permeabilization with 0.5% Triton X-100 and washing with PBS. Thereafter, 5% BSA was added to the block cells for an hour before they were incubated with primary antibodies (1:200; Abcam) against YAP1, Lamin A/C, and F-actin at 4 °C overnight. The cells were washed with PBS before further incubation with Alexa Fluor 488- and Alexa Fluor 594-labeled antibodies (1:200; Invitrogen) for one hour. Finally, medium containing DAPI was added to the mount cells after washing. Images were captured with an inverted confocal microscope (Olympus, Tokyo, Japan).
Rat model of OTM
Male SD rats (6 wk old) weighing 200 ± 20 g were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and housed under laboratory conditions (12 h light/dark cycle, 21 ± 2 °C, 50% humidity, ad libitum access to food and water). All animal protocols utilized in the present work were approved by the Ethics Committee for Animal Experiments at Peking University Health Science Center (No. LA2022288) and were designed to minimize animal pain or discomfort.
In total, 27 male rats were randomized to control (n = 3), force (day 7 and day 14) (n = 6 per group), or force + LIPUS group (day 7 and day 14) (n = 6 per group). Before establishing the experimental OTM model, each rat was administered pentobarbital sodium (40 mg/kg of body weight) for anesthesia. In those latter two groups, the OTM model was established as described in our previous study[20]. A stainless steel ligation wire (0.025 mm in diameter; Tomy International, Inc., Tokyo, Japan) was used to ligate a closed-coil spring (Tomy International, Inc., Tokyo, Japan) to the maxillary first molar and incisor neck. The spring offers 50 g of force to move the maxillary first molar mesially. To enhance the retaining force and prevent the device from falling off, a 0.5 mm deep groove was made by a slow speed mill near the gingival margin of the maxillary incisor to accommodate the ligature wire, which was subsequently filled with flowing resin (3 M, Minnesota, United States). All animals were sacrificed with an overdose of pentobarbital sodium (150 mg/kg) for tissue collection.
Micro-computed tomography imaging and measurements
A microcomputed tomography scanner was used to scan maxillary samples at 8.82 μm resolution, 500 μA tube current, 60 kV tube voltage, and 1500 ms exposure time. Inveon Research Workplace software (Siemens, Munich, Germany) together with Mimics Research 21.0 software (Materialise, Leuven, Belgium) was used for raw data reconstruction. With respect to the reconstructed 3D model, the shortest distance from the first to second molar crown was considered the tooth movement distance (Figure 1B). A straight plane was made at the cementum-enamel boundary (CEJ) on the first molar’s distal buccal side, and the farthest distance between it and the parallel line tangent to alveolar crest resorption was measured to assess the reduction in alveolar bone height. In addition, Inveon Research Workplace software was used to evaluate the BV/TV, Tb.Th, Tb.N, Tb.Sp, and BS/BV in the chosen regions of interest (ROIs) (Figure 1C) by the reviewer, who was blinded to the groupings. All the samples were analyzed thrice to obtain the means.
Figure 1 The bone density decreased, and the alveolar bone height decreased on the compression side.
A: Representative pictures of the rat tooth movement model and 3D model images reconstructed with Mimics software (left) and the statistical diagram of the tooth movement distance (right); B: Representative images of 3D models reconstructed from micro-computed tomography images showing the distance from the alveolar crest to the cemento-enamel junction (left) and the corresponding statistical analysis (right); C: Representative region of interest (ROI) selection diagrams (left) and statistical analysis (right). A certain volume of alveolar bone on the compressed side of the middle 1/2 root of the distal buccal root of the first molar was selected for subsequent analysis. The statistical analysis of the BV/TV, Tb.Th, Tb.N, Tb.Sp and BS/BV values of the ROI region was performed with Siemens software; D: Representative images of hematoxylin and eosin staining; E: Representative images of immunohistochemical staining for type 1 collagen and osteocalcin (left) and quantitative analyses (right); F: Representative images of tartrate-resistant acid phosphatase (TRAP) staining (left) and counting of TRAP-positive multinuclear (> 3 nuclei) cells (right). aP < 0.05 vs control group, bP < 0.01 vs control group. CEJ: Cementum-enamel boundary; HE: Hematoxylin and eosin; TRAP: Tartrate-resistant acid phosphatase; COL1: Type 1 collagen; OCN: Osteocalcin; CT: Computed tomography.
Tissue processing
We set the experimental period at 7 and 14 d following the establishment of the tooth movement device. The rats were sacrificed with an overdose of pentobarbital sodium, after which the maxilla was dissected and immersed in 4% paraformaladehyde. For hematoxylin and eosin (HE), tartrate-resistant acid phosphatase (TRAP), and immunohistochemical staining, the trimmed tissues were decalcified with 5% ethylenediaminetetraacetic acid disodium for 15 d, followed by ethanol dehydration and paraffin embedding. Thereafter, the samples were cut into 5-μm vertical serial sections with a rotary microtome (RM2125RT, Leica, Heidelberger, Germany).
HE, TRAP, and immunohistochemical staining
Sections were stained with an HE staining kit (Sigma, Missouri, United States) or a TRAP staining kit (Solarbio, Beijing, China) following the protocols. Immunohistochemical staining was performed as follows. After xylene deparaffinization and ethanol rehydration, 0.125% trypsin and 20 μg/mL proteinase K solution were added to the sections, which were incubated at 37 °C for a 30-min period. Endogenous peroxidase activity was blocked with 3% H2O2 for a 30-min period at room temperature. The sections were subsequently washed with PBS, blocked with 5% BSA for an hour, and incubated with polyclonal anti-rabbit COL1 and OCN antibodies (1:200; Abcam) overnight at 4 °C, followed by another 1-h incubation with HRP-labeled secondary goat anti-rabbit IgG (Zsgb-Bio, Beijing, China) at room temperature. Diaminobenzidine (Zsgb-Bio) was used for visualization in accordance with the protocol. After hematoxylin counterstaining, gradient ethanol, and xylene dehydration, the sections were mounted using neutral resins.
Statistical analysis
The data are presented as the mean ± SD and were analyzed with GraphPad Prism 7 software (GraphPad, Inc., La Jolla, CA, United States). Every assay was carried out thrice. Student’s t test was used to evaluate intergroup differences, while one-way analysis of variance (ANOVA) with multiple comparisons was used to evaluate differences among multiple groups. P < 0.05 indicated statistical significance.
RESULTS
Orthodontic force treatment decreases alveolar bone height on the compression side
We detected the movement distance of the maxillary first molars on the 7th d and 14th d after force application and found that the movement distance increased with time under the effect of 50 g of force (P < 0.01, n = 3) (Figure 1A), suggesting that the rat OTM model was successfully constructed. Moreover, the distance between the alveolar crest and CEJ significantly increased on day 7 and day 14, showing that orthodontic force led to vertical resorption of alveolar bone beginning on day 7 (Figure 1B). We selected the alveolar bone mesial to the medial 1/3 of the first molar’s distal buccal root with a certain thickness as the ROI (Figure 1C). Micro-computed tomography results showed that at 7 and 14 d of tooth movement, the alveolar bone BV/TV and Tb.Th decreased after force application, while the BS/BV and Tb.Sp increased after force application (Figure 1C). This result showed that the bone density decreased on the compression side after orthodontic force treatment. HE staining and immunohistochemical staining revealed a decreased number of cells positive for the osteogenic markers COL1 and OCN in alveolar bone on the pressure side (Figure 1D and E), with a greater number of TRAP-positive cells on the pressure side near the alveolar bone edge (Figure 1F).
Osteogenic differentiation of BMSCs is inhibited by force treatment
Static pressure was used in vitro to simulate alveolar bone on the pressurized side. Compared to those in the control group, the osteogenic differentiation of the BMSCs in the force group was decreased, as evidenced by the ALP and alizarin red staining results (Supplementary Figure 1 and Figure 2A-D). Correspondingly, the expression levels of the osteogenesis-related markers ALP, COL1, runt-related transcription factor 2 (RUNX2), and OCN in the force group significantly decreased (Figure 2E and F) compared to the control ones, as detected by qRT-PCR and Western blot.
Figure 2 Static pressure inhibits the osteogenic differentiation of bone marrow mesenchymal stem cells in vitro.
A and B: Representative alkaline phosphatase (ALP) staining images and statistical analysis; C and D: Representative alizarin red staining images and quantitative data from the alirazin red assay; E: mRNA expression of ALP, type 1 collagen (COL1), runt-related transcription factor 2, and osteocalcin (OCN) folded to control group by quantitative reverse transcription-polymerase chain reaction; F: COL1, ALP, and OCN protein expression in bone marrow mesenchymal stem cells analyzed by Western blotting (left), and the band intensities measured with ImageJ software (right). aP < 0.05 vs control group, bP < 0.01 vs control group. ALP: Alkaline phosphatase; RUNX2: Runt-related transcription factor 2; COL1: Type 1 collagen; OCN: Osteocalcin; ARS: Alizarin red staining.
LIPUS induces osteogenic differentiation of BMSCs
The force treatment decreased the osteogenic differentiation of BMSCs, while LIPUS could rescue the impaired osteogenic differentiation of BMSCs caused by force treatment (Figure 3A-D), as shown by ALP and alizarin red staining. Moreover, the expression of ALP, COL1, RUNX2, and OCN was accordingly increased after LIPUS treatment compared with the force group, as assessed by qRT-PCR (Figure 3E) and Western blot (Figure 3F).
Figure 3 Low-intensity pulsed ultrasound promotes the osteogenesis of bone marrow mesenchymal stem cells.
A and B: Representative alkaline phosphatase (ALP) staining images and statistical analysis; C and D: Representative alizarin red staining images and quantitative data from the alirazin red assay; E: mRNA expression of ALP, type 1 collagen (COL1), runt-related transcription factor 2, and osteocalcin (OCN) folded to control group by quantitative reverse transcription-polymerase chain reaction; F: COL1, ALP, and OCN protein expression in rat alveolar bone tissues analyzed via Western blotting (left), and the band intensities measured via ImageJ software (right). aP < 0.05 vs control group, bP < 0.01 vs control group. ALP: Alkaline phosphatase; RUNX2: Runt-related transcription factor 2; COL1: Type 1 collagen; OCN: Osteocalcin; LIPUS: Low-intensity pulsed ultrasound; ARS: Alizarin red staining.
LIPUS decreases alveolar bone resorption in vivo
The movement distance of the first molar in the force + LIPUS group was greater than that of the force group on the 7th and 14th d after force application (P < 0.05) (Figure 4A-D). Moreover, the height of alveolar bone resorption was also reduced in the LIPUS treatment group (P < 0.05) (Figure 4E and F). ROI measurements of the corresponding sites indicated that the BV/TV and Tb.Th of the force + LIPUS group were higher than those of the force group, while the BS/BV and Tb.Sp were decreased (P < 0.05, n = 3) (Figure 4G-I), indicating that LIPUS promoted alveolar bone formation. Furthermore, the expression of COL1 and OCN was increased on the compressed side in the LIPUS treatment group compared with the force group (Figure 5A-D). However, no significant differences in TRAP-positive cell numbers were observed between the force group and the force + LIPUS group (Figure 5B and E).
Figure 4 Low-intensity pulsed ultrasound accelerates tooth movement, inhibits alveolar bone resorption, and promotes bone formation.
A: Schematic diagram of the animal experiment procedure. The orthodontic tooth movement model was established on day 0. From day 1 to the end point, the force + low-intensity pulsed ultrasound (LIPUS) group was stimulated with LIPUS for 20 min every day until the samples were harvested on days 7 and 14; B: Schematic representation of LIPUS stimulating the maxillary first molar at the corresponding position on the buccal side; C-F: Representative images (C) and 3D reconstructed model images (E). Tooth movement distances (D) and distances from the alveolar crest to the cementum-enamel boundary (F) were measured with Mimics software; G-I: Representative region of interest (ROI) region selection diagrams and statistical analysis of the BV/TV, Tb.Th, Tb.N, Tb.Sp, and BS/BV values of the ROI. aP < 0.05 vs control group, bP < 0.01 vs control group. CT: Computed tomography; LIPUS: Low-intensity pulsed ultrasound.
Figure 5 Low-intensity pulsed ultrasound promotes bone formation.
A: Representative images of hematoxylin and eosin staining; B: Representative images of immunohistochemical staining for type 1 collagen and osteocalcin and tartrate-resistant acid phosphatase staining (TRAP); C-E: Statistical analyses of the immunohistochemical staining and TRAP staining results. aP < 0.05 vs control group, bP < 0.01 vs control group. HE: Hematoxylin and eosin; TRAP: Tartrate-resistant acid phosphatase; COL1: Type 1 collagen; OCN: Osteocalcin; LIPUS: Low-intensity pulsed ultrasound.
LIPUS activates YAP1 signaling via Lamin A/C
To explore the role of LIPUS in regulating the cytoskeleton in BMSCs, we performed F-actin and Lamin A/C immunofluorescence co-staining in vitro. The results showed that the compressive force treatment downregulated the expression of F-actin, disrupted the cytoskeleton, and inhibited the Lamin A/C ratio in BMSCs, while LIPUS effectively reversed these changes (Figure 6A). Lamin A/C was reported to mediate the YAP1 nuclear localization by regulating nuclear stiffness[21,22]. Next, we analyzed the expression of YAP1. The results showed that the expression of YAP1 was decreased by force treatment, whereas LIPUS restored the expression of YAP1 and increased the nuclear localization of YAP1, as shown by immunofluorescence staining and Western blot (Figure 6B and C). Consistently, the expression of YAP1 was decreased in the force group, while its expression was increased in the LIPUS treatment group in vivo, as analyzed by immunochemical staining (Figure 6D).
Figure 6 Low-intensity pulsed ultrasound reverses the stress-induced decrease in LaminA/C, F-actin, and Yes-associated protein expression.
A: Representative immunofluorescence images of F-actin (red), LaminA/C (green), and DAPI (blue) staining (left) and statistical analyses (middle), as well as representative 3D merged images constructed with Imaris software (right); B: Representative immunofluorescence images of Yes-associated protein (YAP1) (red) and DAPI (blue) staining (left) and statistical analyses (right); C: YAP1 protein expression analyzed by Western blotting; D: Representative images of immunohistochemical staining for YAP1 (left) and statistical analysis (right). aP < 0.05 vs control group, bP < 0.01 vs control group. LIPUS: Low-intensity pulsed ultrasound; YAP1: Yes-associated protein.
Knockdown of YAP1 blocks osteogenic differentiation of BMSCs induced by LIPUS
To verify the role of YAP1 on the property of BMSCs, we used YAP1 siRNA to treat BMSCs (Figure 7A), and the results showed that the expression of osteogenic differentiation-related markers ALP, COL1, RUNX2 and OCN increased by LIPUS treatment could be blocked by YAP1 siRNA treatment (Figure 7B and C). The osteogenic differentiation of BMSCs increased by LIPUS treatment could also be inhibited by YAP1 siRNA treatment, as assessed by ALP and alizarin red staining (Figure 7D and E). Our results demonstrated that LIPUS can accelerate tooth movement and reduce alveolar bone resorption by modulating the cytoskeleton-Lamin A/C-YAP axis (Figure 8).
Figure 7 siYAP1 blocks the effect of low-intensity pulsed ultrasound-induced osteogenic differentiation of bone marrow mesenchymal stem cells.
A: Representative immunofluorescence images of Yes-associated protein (YAP1) (red) and DAPI (blue) staining (left) and statistical analyses (right); B: Western blotting results for type 1 collagen, YAP1, runt-related transcription factor 2 (RUNX2), and alkaline phosphatase (ALP); C: mRNA expression of ALP, RUNX2, and YAP1 in the force group by quantitative reverse transcription-polymerase chain reaction; D and E: Representative ALP and alizarin red staining staining images and statistical analysis. aP < 0.05 vs control group, bP < 0.01 vs control group. ALP: Alkaline phosphatase; COL1: Type 1 collagen; LIPUS: Low-intensity pulsed ultrasound; RUNX2: Runt-related transcription factor 2; YAP1: Yes-associated protein; ARS: Alizarin red staining.
Figure 8 Putative mechanism of the effect of low-intensity pulsed ultrasound on alveolar bone during orthodontic treatment.
Low-intensity pulsed ultrasound has little effect on osteoclast differentiation but may rescue osteogenic gene expression suppressed by static force and promote osteoblastic differentiation by reordering the cytoskeleton, upregulating the expression of F-actin and Lamin A/C, and increasing the nuclear translocation of Yes-associated protein 1, thereby contributing to alveolar bone homeostasis and morphology while accelerating tooth movement during orthodontic treatment. COL1: Type 1 collagen; LIPUS: Low-intensity pulsed ultrasound; RUNX2: Runt-related transcription factor 2; BMSC: Bone marrow mesenchymal stem cell; YAP1: Yes-associated protein.
DISCUSSION
The process of orthodontic treatment is a bone remodeling process. The force applied to drive tooth movement in some extent led to some adverse reactions, such as root resorption and bone mineral density decline. LIPUS has been reported to alleviate chondrocyte damage in temporomandibular disorders[23], reduce root resorption[24], and enhance bone remodeling[10]. However, there is a lack of research on the effect of LIPUS on the aesthetic problem of gingival recession due to the loss of alveolar bone height during orthodontic treatment. Changes in alveolar bone morphology affect the aesthetic effect, safety, and stability[25] of orthodontic treatment. Clinical studies have shown that alveolar bone height loss often leads to insufficient periodontal supporting tissue, decreased dental stability, and aesthetic problems in the anterior teeth[26]. Our experiments showed that LIPUS could effectively ameliorate the aesthetic and health problems caused by alveolar bone height loss by reducing vertical alveolar bone resorption and improving the morphology of alveolar bone remodeling, and filled the research gap in the relevant field.
Clinical studies have used cone beam computed tomography to assess changes in periodontal bone mineral density during orthodontic treatment. On average, the alveolar bone mineral density decreases by 24% after 7 mo of orthodontic treatment, while the region with the largest reduction in bone mineral density seems to be related to the direction of tooth movement[27,28]. Consistently, in the present study, we found that bone mineral density decreased at 7 and 14 d after stress. Mechanical stress can modulate osteoclasts and osteoblasts, thereby promoting bone reconstruction[29,30]. Excessive compressive force can cause stem cell apoptosis[31], aggravate mitochondrial dysfunction, ATP consumption, and oxidative stress in stem cells[32], and inhibit the proliferation, colony formation, and migration of stem cells[33]. Bone mineral density is positively correlated with OCN protein level[34]. In our study, static pressure on BMSCs inhibited the mRNA and protein expression of osteogenic differentiation markers such as COL1 and OCN, which partly explained the reduction in alveolar bone mineral density around moving teeth under orthodontic force.
Previous studies have shown that LIPUS plays a role in bone metabolism and remodeling by regulating osteogenic and osteoclast activity[35-37]. In our study, on day 7 and day 14, the number of osteoclasts in the force group was not significantly different from that in the force + LIPUS group, indicating that LIPUS may promote bone remodeling by promoting osteoclast activity but not by increasing the number of osteoclasts. As shown in numerous clinical trials and animal studies, LIPUS promotes osteogenesis, resulting in improved and quicker fracture healing[38,39]. It can also stimulate condylar growth and increase mandibular ramus height in rabbits[40,41]. LIPUS is effective in various cell processes, such as growth, differentiation[42,43], extracellular matrix formation, and mineralization of osteoblasts[44], and involves multiple signaling pathways, such as the hedgehog and TRPM7 pathways[45,46]. In addition to osteoblasts, LIPUS can promote the differentiation of adipose-derived stromal cells[47], mesenchymal stem cells[48], periodontal ligament stem cells[49], and rat osteosarcoma cell lines[50] and increase the expression of RUNX2 and COL1. LIPUS stimulation of BMSCs can enhance cell activity, promote osteogenic differentiation, and increase COL1 and OCN gene expression[51]. To date, few reports have focused on the role of LIPUS in cellular functions under loading conditions. In our study, LIPUS increased COL1, RUNX2, and OCN expression at the mRNA and protein levels, and rescued the inhibitory effect of compression force on the osteoblastic differentiation of BMSCs, demonstrating a positive effect on alveolar bone remodeling during orthodontic processing at the cellular level.
The way that mechanical signals can be transmitted from the plasma membrane to the nucleus directly via the cytoskeleton is considered to be an important mechanical signal transduction pathway[52]. The nucleus is considered a key mechanoreceptor that can directly influence chromatin organization, epigenetic modifications, and gene expression[53]. Lamin A/C, as LMNA-encoded Lamin proteins, participate in nuclear mechanics[54] and the transduction of mechanical signals[55,56], thereby regulating the fate of stem cells. The lincRNAs (linkers of cytoskeleton and nucleoskeleton) complex links Lamin A/C to the cytoskeleton, thereby mediating the transmission of mechanical signals from the cytoskeleton to the nucleus[57]. The Lamin A level is known to increase during osteogenic differentiation of MSCs but decrease during adipogenic differentiation[58,59]. In our study, Lamin A/C and F-actin were consistently downregulated after compression force application, and the cytoskeleton was more disordered under compression. To our knowledge, our study is the first to show that LIPUS increases Lamin A/C and F-actin expression and reorders the cytoskeleton under compression, thus reversing the decrease in osteogenesis of BMSCs induced by static force.
As a transcriptional coactivator protein, YAP1 is closely associated with changes in the mechanical state of cellular microenvironments[60]. YAP1 can relocate to the nucleus from the cytoplasm, interact with the TEA domain[61], and promote transcription. In mechanical transduction, it is also a downstream signal for the assembly and contraction of actin filaments[62]. Pressure can promote F-actin depolymerization and lead to cytoplasmic translocation of YAP1[63]. YAP1 was found to participate in multiple cellular activities. For example, YAP1 was reported to be activated during inflammation in endothelial cells induced by lipopolysaccharide[64] and was essential for epithelial cell proliferation[65]. In the inflammatory microenvironment in periodontitis, YAP1 expression and nuclear translocation are decreased[66]. In the force group, the YAP1 level decreased, while in the force + LIPUS group, the YAP1 level increased both in vitro and in vivo, suggesting that YAP1 exerts a crucial effect on the regulation of BMSC osteogenesis by mechanical force and LIPUS and might be a downstream effector of the cytoskeleton and nuclear skeleton.
This study has some limitations. Osteoblasts and osteoclasts jointly participate in the process of bone metabolism. This study mainly focused on the effect of LIPUS on the osteogenic function of stem cells, and whether LIPUS could regulate the crosstalk of osteoclasts and osteoblasts is unclear, which needs further investigation. In addition, the underlying mechanism of how LIPUS controls cytoskeleton changes remains unclear.
CONCLUSION
In summary, LIPUS can promote local alveolar bone remodeling, increase bone mineral density, and reduce vertical alveolar bone resorption and consequent gingival recession by regulating the osteogenic ability of BMSCs. In terms of mechanism, LIPUS upregulates the expression and nuclear translocation of YAP, which is decreased by mechanical stress through effects on the cytoskeleton and nuclear skeleton, thereby affecting the osteogenic differentiation of BMSCs.
ARTICLE HIGHLIGHTS
Research background
The bone remodeling during orthodontic treatment for malocclusion often requires a long duration, which also may lead to some complications such as alveolar bone resorption. Low-intensity pulsed ultrasound (LIPUS), a noninvasive physical therapy, has been shown to promote bone fracture healing and reduce the duration of orthodontic treatment; however, how LIPUS regulates the bone metabolism during the orthodontic treatment process is still unclear.
Research motivation
How to shorten the orthodontic treatment duration and reduce the side effects caused by orthodontic treatment such as alveolar bone resorption has become a very important clinical problem. LIPUS, as a non-invasive physical therapy, has been reported to promote the fracture healing process, and may also play a good role in orthodontic treatment.
Research objectives
This study was to investigate the effects of LIPUS on bone remodeling in an orthodontic tooth movement (OTM) model and explore the underlying mechanisms.
Research methods
We established a rat model of OTM, and alveolar bone remodeling and tooth movement rate were evaluated via micro-computed tomography and staining of tissue sections. In vitro, human bone marrow mesenchymal stem cells (hBMSCs) were isolated to detect their osteogenic differentiation potential under compression and LIPUS stimulation and to investigate the underlying mechanisms.
Research results
The force treatment inhibited the expression of osteogenesis markers and osteogenic differentiation potential of hBMSCs, which could be rescued by LIPUS treatment. Mechanically, the expression of LaminA/C, F-actin, and Yes-associated protein (YAP1) was downregulated after force application, which could be rescued by LIPUS treatment. Moreover, the osteogenic differentiation of MSCs increased by LIPUS treatment could be attenuated by YAP small interfering RNA treatment. Consistently, LIPUS increased alveolar bone density and decreased vertical bone absorption in vivo. The decreased expression of type 1 collagen, osteocalcin, and YAP1 on the compression side of the alveolar bone was partially rescued by the LIPUS treatment.
Research conclusions
By regulating the cytoskeleton-Lamin A/C-YAP axis, LIPUS can effectively accelerate tooth movement and reduce bone resorption. Therefore, LIPUS can be used as an effective auxiliary method for orthodontic treatment.
Research perspectives
These results may provide an adjunctive treatment strategy for orthodontic treatment and enrich the theoretical basis for LIPUS application.
Footnotes
Provenance and peer review: Unsolicited article; Externally peer reviewed.
Koushki N, Ghagre A, Srivastava LK, Molter C, Ehrlicher AJ. Nuclear compression regulates YAP spatiotemporal fluctuations in living cells.Proc Natl Acad Sci U S A. 2023;120(28) e2301285120. [PMID:37399392 DOI: 10.1073/pnas.2301285120].
[PubMed] [DOI]
Elosegui-Artola A, Andreu I, Beedle AEM, Lezamiz A, Uroz M, Kosmalska AJ, Oria R, Kechagia JZ, Rico-Lastres P, Le Roux AL, Shanahan CM, Trepat X, Navajas D, Garcia-Manyes S, Roca-Cusachs P. Force Triggers YAP Nuclear Entry by Regulating Transport across Nuclear Pores.Cell. 2017;171:1397-1410.e14.
[RCA] [PubMed] [DOI] [Full Text][Cited by in Crossref: 660][Cited by in RCA: 944][Article Influence: 118.0][Reference Citation Analysis (0)]
El-Bialy T, El-Shamy I, Graber TM. Growth modification of the rabbit mandible using therapeutic ultrasound: is it possible to enhance functional appliance results?Angle Orthod. 2003;73:631-639.
[PubMed] [DOI] [Full Text]