©The Author(s) 2003.
World J Gastroenterol. Jul 15, 2003; 9(7): 1559-1562
Published online Jul 15, 2003. doi: 10.3748/wjg.v9.i7.1559
Published online Jul 15, 2003. doi: 10.3748/wjg.v9.i7.1559
Table 1 Primer sequences of α1(I), TGF-β1 and Na+/Ca2+ exchanger mRNA
| mRNA | Upstream (5'→3') | Downstream (5'→3') |
| α1(I) | CACCCTCAAGAGCCTGAGTC | GTTCGGGCTGATGTACCAGT |
| TGF-β1 | CTTTGTACAACAGCACCCGC | GTCAAAAGACAGCCACTCAGG |
| NCX | TATTGCCGAACCGGTTTATGT | CTCGTCTCTCCATCTGGGAC |
Table 2 Liver fibrosis-associated enzymes and fibrosis markers in serum (¯x ± s)
| Group | ALT (IU/L) | AST (IU/L) | β-NAG (μmol/L) | PC III (mg/L) | C IV (mg/L) | HA (mg/L) |
| Normal | 87.93 ± 18.61a | 104.3 ± 32.40a | 189.00 ± 26.70a | 89.99 ± 10.85a | 35.69 ± 9.68a | 112.41 ± 45.62a |
| Model | 198.64 ± 71.02 | 514.59 ± 180.22 | 415.77 ± 133.37 | 265.54 ± 98.21 | 159.67 ± 29.64 | 455.79 ± 113.55 |
| Treatment | 114.17 ± 47.89a | 291.62 ± 141.75a | 244.67 ± 46.8a | 164.25 ± 45.68a | 96.73 ± 16.48a | 289.35 ± 75.68a |
Table 3 Histopathological semiquantitative scores in the liver
Table 4 Expression of α1 (I) mRNA (semiquantitative scores and positive ratio)
Table 5 Expression of TGF-β1mRNA (semiquantitative scores and positive ratio)
Table 6 Expression of Na+/Ca2+ exchanger mRNA (semiquantitative scores and positive ratio)
- Citation: Wu XL, Zeng WZ, Wang PL, Lei CT, Jiang MD, Chen XB, Zhang Y, Xu H, Wang Z. Effect of compound rhodiola sachalinensis A Bor on CCl4-induced liver fibrosis in rats and its probable molecular mechanisms. World J Gastroenterol 2003; 9(7): 1559-1562
- URL: https://www.wjgnet.com/1007-9327/full/v9/i7/1559.htm
- DOI: https://dx.doi.org/10.3748/wjg.v9.i7.1559
