©The Author(s) 2003.
World J Gastroenterol. Jun 15, 2003; 9(6): 1337-1341
Published online Jun 15, 2003. doi: 10.3748/wjg.v9.i6.1337
Published online Jun 15, 2003. doi: 10.3748/wjg.v9.i6.1337
Table 1 β-actin primers used for nested PCR analysis
| Primer | Sequence | Primer size(bp) | Size of PCR products(bp) |
| β-actin-outer | |||
| Forward primer | GGCATCCTCACCCTGAAGTA | 20 | 494 |
| Reverse primer | CCATCTCTTGCTCGAAGTCC | 20 | |
| β-actin-inner | |||
| Forward primer | AAATCTGGCACCACACCTTC | 20 | 240 |
| Reverse primer | AGGGCATACCCCTCGTAGAT | 20 |
- Citation: Shi X, Kleeff J, Zhu ZW, Schmied B, Tang WH, Zimmermann A, BÜchler MW, Friess H. Gene-expression analysis of single cells-nested polymerase chain reaction after laser microdissection. World J Gastroenterol 2003; 9(6): 1337-1341
- URL: https://www.wjgnet.com/1007-9327/full/v9/i6/1337.htm
- DOI: https://dx.doi.org/10.3748/wjg.v9.i6.1337
