Gene targeted and immune therapies for nodal and gastrointestinal follicular lymphomas

Table 1 MicroRNAs involved in follicular lymphoma development and proliferation

MicroRNA(s)	Role in FL development	Sequence (5’ to 3’)	Ref.
miR-17	Involved in cell proliferation and apoptosis	UAAAGUGCUUACAGUGCAGGUAG	[23-26]
miR-18a	Role in angiogenesis and tumorigenesis	UAAGGUGCAUCUAGUGCAGAUAG	[26]
miR-19a	Promotes cell survival	UGUGCAAAUCUAUGCAAAACUGA	[26]
miR-20a	Involved in cell cycle regulation	UAAAGUGCUCAUAGUGCAGGUAG
miR-19b-1	Promotes cell survival	UGUGCAAAUCCAUGCAAAUCUGA
miR-92a	Role in angiogenesis	UAUUGCACUUGUCCCGGCCUGU	[26]
miR-155	B-cell transformation in follicular lymphoma	UUAAUGCUAAUUGUGAUAGGGGU	[27-35]
miR-21	Overexpressed and promotes tumor progression	UAGCUUAUCAGACUGAUGUUGA	[35]
miR-155-5p	Role for diagnosis of FL	UUAAUGCUAAUCGUGAUAGGGGU	[33,36]
miR-150	Influences B-cell differentiation	UCUCACAUUGGUCUACAAUCU	[33,36,41]
miR-9-3p	Role for diagnosis of FL and in B-cell malignancies	UCUUUGGUUAUCUAGCUGUAUGA	[36-40]
miR-29 family	Epigenetic regulation and tumorigenesis	Varies by family member	[42]
miR-5008	Regulation of endogenous mRNA levels	Sequence is not available	[43]
miR-7e-5p	Downregulation by c-MYC over-expression arise poor prognosis of FL	UGAGGUAGGAGGUUGUAUAGUU	[44]
miR-451	Involved in cell cycle progression	AAACCGUUACCAUUACUGAGUU	[45]
miR-338-5p	Possible role in cellular proliferation	UAAUGACUGCACUGACCUUUGA	[45]
miR-142	Role in hematopoiesis and B-cell function	UGUAGUGUUUCCUACUUUAUGGA	[46]
miR-376 cluster	Involvement in cellular differentiation	Varies by cluster member	[42]

FL: Follicular lymphoma.

Table 2 Lugano staging of gastrointestinal tract lymphoma[60]

Stage
I	Tumor confined to GI tract
	Primary site or multiple, non-contiguous lesions
II	Tumor extends into the abdomen from primary GI site
	Nodal involvement
II1	Local: Paragastric in cases of gastric lymphoma and para-intestinal for intestinal lymphoma
II2	Distant: Mesenteric in case of an intestinal primary lymphoma; otherwise paraaortic, paracaval, pelvic, or inguinal
IIE	Penetration of serosa involving adjacent organs or tissues: Enumerate sites of involvement, e.g., IIE (pancreas), IIE (large intestine), IIE (post-intestinal wall)
	Where there is nodal involvement and penetration involving adjacent organs, the stage is denoted using a subscript (1 or 2) and E, e.g., II1E (pancreas)
IV	Disseminated extra-nodal involvement or a GI tract lesion with supradiaphragmatic nodal involvement

GI: Gastrointestinal.