Increased circulating circular RNA_103516 is a novel biomarker for inflammatory bowel disease in adult patients

Table 1 Sequences of primers used for quantitative reverse transcription–polymerase chain reaction

Gene	Primer sequence	Produce size (bp)
β-actin	F: 5'‑GTGGCCGAGGACTTTGATTG 3'	73
	R: 5'CCTGTAACAACGCATCTCATATT-3'
circRNA_103516	F: 5'-GCACCAATTGACAACGGTTC-3'	123
	R: 5'-CTGGTCTTCTCGGGTGATGT-3'

Circular RNA: CircRNA; F: Forward; R: Reverse.

Table 2 Clinical characteristics of patients and controls

Characteristic	CD (n = 90)	UC (n = 90)	HCs (n = 80)	PCs (n = 35)
Male/female	48/42	38/52	46/34	19/16
Mean age (yr)	39.94 ± 11.80	41.69 ± 12.40	37.64 ± 9.30	42.40 ± 10.20
Range (yr)	17-67	20-73	20-72	18-70
Tobacco smoking (n)
Never	60	67	50	20
Past or current use	30	23	30	15
Disease duration (yr)	5.1 ± 3.1	5.1 ± 3.4
Disease location: CD, n (%)
L1	37 (41.1)
L2	20 (22.2)
L3	33 (36.7)
Disease activity: CDAI, n (%)
Remission	16 (17.8)
Mild	19 (21.1)
Moderate	40 (44.4)
Severe	15 (16.7)
Disease behavior:CD, n (%)
B1	39 (43.3)
B2	33 (36.7)
B3	18 (20.0)
Disease location: UC, n (%)
E1		36 (40.0)
E2		29 (32.2)
E3		25 (27.8)
Disease severity, n (%)
Remission		14 (15.6)
Mild		30 (33.3)
Moderate		31 (34.4)
Severe		15 (16.7)
Medications, n (%)
5-ASA	80 (88.9)	87 (96.7)
Corticosteroids	50 (11.7)	41 (45.5)
Immunosuppressants	28 (31.1)	14 (15.6)
Anti-TNF-α	13 (14.4)	4 (4.4)
Surgery	4 (4.4)	1 (1.1)

The data are presented as the mean ± SD. Patients with isolated upper disease (L4) were excluded. L1: Terminal ileum; L2: Colon; L3: Ileocolon; B1: Non-stricture and non-penetrating; B2: Stricturing; B3: Penetrating; E1: Rectum; E2: Left side; E3: Extensive. CD: Crohn’s disease; UC: Ulcerative colitis; HCs: Healthy controls; PCs: Patient controls; 5-ASA: 5-aminosalicylic acid; TNF-α: Tumor necrosis factor α.

Table 3 Laboratory measures and disease activity scores of inflammatory bowel disease patients and control groups

Parameter	CD (n = 90)	UC (n = 90)	HCs (n = 80)	PCs (n = 35)
CRP (mg/L)	79.95 (18.47-121.22)	58.10 (16.43-123.67)	3.49 (3.30-6.09)	5.73 (3.84-7.94)
ESR (mm/H)	38.50 (17.75-67.00)	30.00 (15.00-58.00)	12.02 (4.87-14.25)	17.32 (3.87-26.85)
TNF-α (pg/mL)	6.83 (3.89-12.26)	6.70 (3.45-9.45)	--
INF-γ (pg/mL)	9.29 (5.77-12.35)	6.70 (4.4-10.65)	--
IL-10 (pg/mL)	10.99 (6.21-19.27)	11.3 (6.66-25.08)	--
CDAI score	270.15 (170.60-376.58)	--	--
Mayo score	--	5.00 (3.00-10.00)	--

The data are presented as medians (1/4-3/4 quarters). CD: Crohn’s disease; UC: Ulcerative colitis; HCs: Healthy controls; PCs: Patient controls; CRP: C reactive protein; ESR: Erythrocyte sedimentation rate; TNF-α: Tumor necrosis factor α; INF-γ: Interferon γ; IL-10: Interleukin-10; CDAI: Crohn’s disease activity index.

Table 4 Receiver-operating characteristic analysis of circular RNA_103516 in peripheral blood mononuclear cells from inflammatory bowel disease

Group	AUC (95%CI)	P value	Cutoff value	Sensitivity (95%CI)	Specificity (95%CI)	PPV	NPV	LR +	LR -	Diagnostic accuracy
CD vs HC	0.790 (0.722-0.857)	< 0.001	1.412	66.67 (55.95%-76.26%)	78.75 (68.17%-87.11%)	77.63%	67.02%	3.137	0.423	71.76%
UC vs HC	0.687 (0.608-0.767)	< 0.001	1.151	66.67 (55.95%-76.26%)	62.50 (50.96%-73.08%)	66.67%	62.50%	1.778	0.533	64.71%
CD vs UC	0.631 (0.550-0.712)	0.002	1.963	54.44 (43.6%- 64.98%)	68.89 (58.26% to 78.23%)	55.05%	55.75%	1.750	0.661	59.41%

AUC: Area under the curve; CD:Crohn’s disease; UC: Ulcerative colitis; HC: Healthy control; PPV: Positive predictive value; NPV: Negative predictive value; LR +: Positive likelihood ratio; LR -: Negative likelihood ratio.

Table 5 Univariate logistic regression analysis showing the disease phenotypes of Crohn’s disease in correlation to circular RNA_103516 status as dependent variable

Clinical variable	n	CircRNA_103765 + (%)	Crude			Adjusted
			OR	95%CI	P value	OR	95%CI	P value
Gender
Male	48	66.7
Female	42	64.3	1.11	0.465-2.655	0.813	NS
Age
< 40 yr	47	57.4
≥ 40 yr	43	74.4	2.155	0.879-5.281	0.093	NS
Smoking status
Never	60	68.3
Past or current use	30	60.0	1.439	0.579-3.577	0.434	NS
Disease location of CD
L1	37	64.7
L2	20	64.7	0.524	0.094-2.930	0.462	NS
L3	33	63.3	0.522	0.082-3.364	0.496
Disease activity of CD
Mild	19	47.4
Moderate	40	82.5	5.238	1.554-17.653	0.008	4.886	1.384-17.251	0.014
Severe	15	80.0	4.444	0.941-21.001	0.025	4.416	0.084-22.054	0.043
Disease behavior of CD
B1	39	48.7
B2	33	78.8	3.910	1.376-11.110	0.011	3.641	1.245-10.650	0.018
B3	18	77.8	3.684	1.028-13.202	0.045	4.375	1.147-16.690	0.031
Medications
5-ASA	80	73.8	1.309	0.340-5.035	0.696	NS
Corticosteroids	50	74.0	2.329	0.959-5.655	0.062	NS
Immunosuppressants	28	67.9	1.161	0.450-2.998	0.758	NS
Anti-TNF-α	13	76.9	1.905	0.483-7.505	0.357	NS
Surgery	4	75.0	1.607	0.160-16.130	0.687	NS

The data are shown with crude and adjusted odds ratios and 95% confidence intervals accordingly. L1: Terminal ileum; L2: Colon; L3: Ileocolon; B1: Non-stricture and non-penetrating; B2: Stricturing; B3: Penetrating; CD: Crohn’s disease; 5-ASA: 5-aminosalicylic acid; TNF-α: Tumor necrosis factor α; NS: No significance; OR: Odds ratio; CI: Confidence interval; CircRNA: Circular RNA.

Table 6 Univariate logistic regression analysis showing the disease phenotypes of ulcerative colitis in correlation to circular RNA_103516 status as dependent variable

Clinical variable	n	CircRNA_103765 + (%)	Crude			Adjusted
			OR	95%CI	P value	OR	95%CI	P value
Gender
Male	38	52.6%
Female	52	59.6%	1.329	0.571-3.090	0.509	NS
Age
< 40 yr	40	60.0%
≥ 40 yr	50	54.0%	0.783	0.337-1.817	0.568	NS
Smoking status
Never	67	69.7%
Past or current use	23	47.8%	0.619	0.239-1.604	0.323	NS
Disease location of UC
E1	36	44.4%
E2	30	60.0%	1.875	0.702-5.009	0.210	NS
E3	24	70.8%	3.036	1.012-9.107	0.048
Disease severity of UC
Mild	30	60.0%
Moderate	31	70.9%	1.630	0.562-4.729	0.369	NS
Severe	15	93.3%	9.333	1.080-80.627	0.042	10.803	1.171-94.687	0.036
Medications: n (%)
5-ASA	87	57.5%	0.786	0.143-2.037	0.342	NS
Corticosteroids	41	70.7%	1.827	0.762-5.234	0.084	NS
Immunosuppressants	14	71.4%	1.234	0.673-3.238	0.705	NS
Anti-TNF-α	4	50.0%	0.385	0.051-2.919	0.355	NS
Surgery	1	0.0%	0.000	0.000-	1.000	NS

The data are shown with crude and adjusted odds ratios and 95% confidence intervals accordingly. E1: Rectum; E2: Left side; E3: Extensive; UC: Ulcerative colitis; 5-ASA: 5-aminosalicylic acid; TNF-α: Tumor necrosis factor α; NS: No significance; OR: Odds ratios; CI: Confidence intervals; CircRNA: Circular RNA.