©The Author(s) 2017.
World J Gastroenterol. Dec 28, 2017; 23(48): 8533-8543
Published online Dec 28, 2017. doi: 10.3748/wjg.v23.i48.8533
Published online Dec 28, 2017. doi: 10.3748/wjg.v23.i48.8533
Table 1 Technical characteristics of the studied markers
| Gene | ID | Type | Length, bp | Primers | Amplicon, bp |
| CASP8 | rs3834129 | INDEL | 6 | F-5’CTCTTCAATGCTTCCTTGAGGT3’ | 249-255 |
| R-5’CTGCATGCCAGGAGCTAAGTAT3’ | |||||
| CYP2E1 | - | INDEL | 96 | F-5’TGTCCCAATACAGTCACCTCTTT3’ | 303-399 |
| R-5’GGCTTTTATTTGTTTTGCATCTG3’ | |||||
| CYP19A1 | rs11575899 | INDEL | 3 | F-5’TGCATGAGAAAGGCATCATATT3’ | 122-125 |
| R-5’AAAAGGCACATTCATAGACAAAAA3’ | |||||
| IL1A | rs3783553 | INDEL | 4 | F-5’TGGTCCAAGTTGTGCTTATCC3’ | 230-234 |
| R-5’ACAGTGGTCTCATGGTTGTCA3’ | |||||
| IL4 | rs79071878 | VNTR | 70 | F-5’AGGGTCAGTCTGGCTACTGTGT3’ | 147/217/287 |
| R-5’CAAATCTGTTCACCTCAACTGC3’ | |||||
| MDM2 | rs3730485 | INDEL | 40 | F-5’GGAAGTTTCCTTTCTGGTAGGC3’ | 192-232 |
| R-5’TTTGATGCGGTCTCATAAATTG3’ | |||||
| NFKB1 | rs28362491 | INDEL | 4 | F-5’TATGGACCGCATGACTCTATCA3’ | 366-370 |
| R-5’GGCTCTGGCATCCTAGCAG3’ | |||||
| PAR1 | rs11267092 | INDEL | 13 | F-5’AAAACTGAACTTTGCCGGTGT3’ | 265-277 |
| R-5’GGGCCTAGAAGTCCAAATGAG3’ | |||||
| TP53 | rs17878362 | INDEL | 16 | F-5’GGGACTGACTTTCTGCTCTTGT3’ | 148-164 |
| R-5’GGGACTGTAGATGGGTGAAAAG3’ | |||||
| TYMS | rs16430 | INDEL | 6 | F-5’ATCCAAACCAGAATACAGCACA3’ | 213-219 |
| R-5’CTCAAATCTGAGGGAGCTGAGT3’ | |||||
| UGT1A1 | rs8175347 | VNTR | 2 | F-5’CTCTGAAAGTGAACTCCCTGCT3’ | 133/135/137/139 |
| R-5’AGAGGTTCGCCCTCTCCTAT3’ | |||||
| XRCC1 | rs3213239 | INDEL | 4 | F-5’GAACCAGAATCCAAAAGTGACC3’ | 243-247 |
| R-5’AGGGGAAGAGAGAGAAGGAGAG3’ |
Table 2 Demographic data for patient and control groups
| Variable | GC | CRC | Control | P-value | |
| GC vs Control | CRC vs Control | ||||
| n | 120 | 64 | 475 | - | - |
| Age, yr1 | 57.02 ± 1.29 | 52.84 ± 1.90 | 55.59 ± 0.91 | 0.522 | 0.294 |
| Sex, % of male/female | 55.0/45.0 | 45.3/54.70 | 34.7/65.3 | 0.0003 | 0.098 |
| European ancestry2 | 0.42 ± 0.01 | 0.53 ± 0.02 | 0.47 ± 0.01 | 0.0023 | 0.0033 |
| African ancestry2 | 0.26 ± 0.01 | 0.20 ± 0.01 | 0.23 ± 0.01 | 0.071 | 0.0163 |
| Amerindian ancestry2 | 0.32 ± 0.01 | 0.27 ± 0.02 | 0.30 ± 0.01 | 0.114 | 0.100 |
Table 3 Genotypic and allelic distributions of the investigated polymorphisms for patients with gastric cancer in comparison to control group
| Genotype | GC | Control | P value1 | OR (95%CI)1 | Genotype | GC | Control | P value1 | OR (95%CI)1 |
| CASP8 | 120 | 475 | RP2/RP2 | 18 (15.1) | 154 (32.5) | 0.189 | 0.673 (0.372-1.216) | ||
| DEL/DEL | 11 (9.2) | 90 (19.0) | 0.650 | 0.892 (0.545-1.461) | Allele RP1 | 0.54 | 0.41 | ||
| INS/DEL | 70 (58.3) | 230 (48.4) | Allele RP2 | 0.46 | 0.59 | ||||
| INS/INS | 39 (32.5) | 155 (32.6) | 0.080 | 1.936 (0.924-4.058) | NFKB1 | 120 | 473 | ||
| Allele DEL | 0.38 | 0.43 | DEL/DEL | 34 (28.3) | 117 (24.7) | 0.0062 | 2.918 (1.352-6.298) | ||
| Allele INS | 0.62 | 0.57 | INS/DEL | 71 (59.2) | 246 (52.0) | ||||
| MDM2 | 120 | 475 | INS/INS | 15 (12.5) | 110 (23.3) | 0.88 | 0.959 (0.5662-1.610) | ||
| DEL/DEL | 13 (10.8) | 33 (6.9) | 0.199 | 1.365 (0.849-2.192) | Allele DEL | 0.58 | 0.51 | ||
| INS/DEL | 46 (38.3) | 168 (35.4) | Allele INS | 0.42 | 0.49 | ||||
| INS/INS | 61 (50.9) | 274 (57.7) | 0.0212 | 0.409 (0.192-0.872) | PAR1 | 113 | 473 | ||
| Allele DEL | 0.30 | 0.25 | DEL/DEL | 66 (58.4) | 273 (57.7) | 0.068 | 0.482 (0.221-1.054) | ||
| Allele INS | 0.70 | 0.75 | INS/DEL | 36 (31.9) | 169 (35.7) | ||||
| TP53 | 120 | 475 | INS/INS | 11 (9.7) | 31 (6.6) | 0.949 | 0.984 (0.601-1.610) | ||
| DEL/DEL | 91 (75.8) | 350 (73.7) | 0.999 | 138214253.0 (0.000) | Allele DEL | 0.74 | 0.76 | ||
| INS/DEL | 27 (22.5) | 116 (24.4) | Allele INS | 0.26 | 0.24 | ||||
| INS/INS | 2 (1.7) | 9 (1.9) | 0.247 | 0.708 (0.395-1.270) | CYP2E1 | 116 | 475 | ||
| Allele DEL | 0.87 | 0.86 | DEL/DEL | 94 (81.0) | 398 (83.8) | 0.999 | 276187721.0 (0.000) | ||
| Allele INS | 0.13 | 0.14 | INS/DEL | 21 (18.1) | 73 (15.4) | ||||
| TYMS | 120 | 475 | INS/INS | 1 (0.9) | 4 (0.8) | 0.574 | 1.193 (0.644-2.212) | ||
| DEL/DEL | 16 (13.3) | 65 (13.7) | 0.409 | 1.231 (0.752-2.015) | Allele DEL | 0.90 | 0.91 | ||
| INS/DEL | 53 (44.2) | 224 (47.2) | Allele INS | 0.10 | 0.09 | ||||
| INS/INS | 51 (42.5) | 186 (39.2) | 0.867 | 1.060 (0.536-2.096) | CYP19A1 | 120 | 475 | ||
| Allele DEL | 0.35 | 0.37 | DEL/DEL | 18 (15.0) | 76 (16.0) | 0.654 | 1.127 (0.669-1.897) | ||
| Allele INS | 0.65 | 0.63 | INS/DEL | 67 (55.8) | 248 (52.2) | ||||
| XRCC1 | 119 | 474 | INS/INS | 35 (29.2) | 151 (31.8) | 0.415 | 1.334 (0.667-2.671) | ||
| DEL/DEL | 10 (8.4) | 35 (7.4) | 0.346 | 1.257 (0.781-2.021) | Allele DEL | 0.43 | 0.42 | ||
| INS/DEL | 48 (40.3) | 179 (37.8) | Allele INS | 0.57 | 0.58 | ||||
| INS/INS | 61 (51.3) | 260 (54.8) | 0.396 | 0.697 (0.303-1.604) | UGT1A1 | 120 | 464 | ||
| Allele DEL | 0.29 | 0.26 | *1/*1 | 49 (40.8) | 206 (44.5) | 0.792 | 1.109 (0.515-2.386) | ||
| Allele INS | 0.71 | 0.74 | *1/*28 | 57 (47.5) | 209 (45.0) | ||||
| IL1A | 120 | 475 | *28/*28 | 12 (10.0) | 46 (9.9) | 0.445 | 1.205 (0.746-1.946) | ||
| DEL/DEL | 17 (14.2) | 86 (18.1) | 0.626 | 0.882 (0.522-1.460) | *36/*1 | 2 (1.7) | 3 (0.6) | ||
| INS/DEL | 63 (52.5) | 246 (51.8) | *36/*37 | 0 (0.0) | 0 (0.0) | 0.585 | 1.941 (0.180-20.973) | ||
| INS/INS | 40 (33.3) | 143 (30.1) | 0.143 | 1.705 (0.835-3.482) | *1/*37 | 0 (0.0) | 0 (0.0) | ||
| Allele DEL | 0.40 | 0.44 | Allele *36 | 0.01 | 0.01 | ||||
| Allele INS | 0.60 | 0.56 | Allele *1 | 0.65 | 0.67 | ||||
| IL4 | 119 | 474 | Allele *28 | 0.34 | 0.32 | ||||
| RP1/RP1 | 28 (23.6) | 69 (14.5) | 0.0022 | 2.857 (1.490-5.479) | Allele *37 | 0.00 | 0.00 | ||
| RP1/RP2 | 73 (61.3) | 251 (53.0) |
Table 4 Genotypic and allelic distributions of the investigated polymorphisms for patients with colorectal cancer in comparison to control group
| Genotype | CRC | Control | P value1 | OR (95%CI)a | Genotype | CRC | Control | P-value1 | OR (95%CI)1 |
| CASP8 | 63 | 475 | RP2/RP2 | 16 (25.4) | 154 (32.5) | 0.871 | 1.068 (0.482-2.368) | ||
| DEL/DEL | 13 (20.6) | 90 (19.0) | 0.676 | 0.888 (0.508-1.552) | Allele RP1 | 0.44 | 0.41 | ||
| INS/DEL | 28 (44.4) | 230 (48.4) | Allele RP2 | 0.56 | 0.59 | ||||
| INS/INS | 22 (35.0) | 155 (32.6) | 0.939 | 0.974 (0.503-1.887) | NFKB1 | 63 | 473 | ||
| Allele DEL | 0.43 | 0.43 | DEL/DEL | 16 (25.4) | 117 (24.7) | 0.0062 | 3.732 (1.451-9.599) | ||
| Allele INS | 0.57 | 0.57 | INS/DEL | 42 (66.7) | 246 (52.0) | ||||
| MDM2 | 64 | 475 | INS/INS | 5 (7.9) | 110 (23.3) | 0.829 | 0.935 (0.508-1.723) | ||
| DEL/DEL | 7 (10.9) | 33 (6.9) | 0.412 | 1.166 (0.143-9.487) | Allele DEL | 0.60 | 0.51 | ||
| INS/DEL | 25 (39.1) | 168 (35.4) | Allele INS | 0.40 | 0.49 | ||||
| INS/INS | 32 (50.0) | 274 (57.7) | 0.986 | 0.995 (0.546-1.811) | PAR1 | 63 | 473 | ||
| Allele DEL | 0.30 | 0.25 | DEL/DEL | 37 (58.7) | 273 (57.7) | 0.464 | 0.704 (0.275-1.801) | ||
| Allele INS | 0.70 | 0.75 | INS/DEL | 20 (31.8) | 169 (35.7) | ||||
| TP53 | 64 | 475 | INS/INS | 6 (9.5) | 31 (6.6) | 0.813 | 0.937 (0.546-1.608) | ||
| DEL/DEL | 47 (73.4) | 350 (73.7) | 0.886 | 1.166 (0.143-9.487) | Allele DEL | 0.75 | 0.76 | ||
| INS/DEL | 16 (25.0) | 116 (24.4) | Allele INS | 0.25 | 0.24 | ||||
| INS/INS | 1 (1.6) | 9 (1.9) | 0.986 | 0.995 (0.546-1.811) | CYP2E1 | 62 | 475 | ||
| Allele DEL | 0.86 | 0.86 | DEL/DEL | 56 (90.3) | 398 (83.8) | 0.999 | 189364591.0 (0.000) | ||
| Allele INS | 0.14 | 0.14 | INS/DEL | 6 (9.7) | 73 (15.4) | ||||
| TYMS | 63 | 475 | INS/INS | 0 (0.0) | 4 (0.8) | 0.351 | 0.655 (0.269-1.593) | ||
| DEL/DEL | 11 (17.5) | 65 (13.7) | 0.304 | 1.342 (0.765-2.354) | Allele DEL | 0.95 | 0.91 | ||
| INS/DEL | 31 (49.2) | 224 (47.2) | Allele INS | 0.05 | 0.09 | ||||
| INS/INS | 21 (33.3) | 186 (39.2) | 0.429 | 0.751 (0.369-1.526) | CYP19A1 | 64 | 475 | ||
| Allele DEL | 0.42 | 0.37 | DEL/DEL | 7 (10.9) | 76 (16.0) | 0.297 | 0.747 (0.431-1.293) | ||
| Allele INS | 0.58 | 0.63 | INS/DEL | 33 (51.6) | 248 (52.2) | ||||
| XRCC1 | 64 | 474 | INS/INS | 24 (37.5) | 151 (31.8) | 0.313 | 1.532 (0.669-3.508) | ||
| DEL/DEL | 4 (6.2) | 35 (7.4) | 0.771 | 1.082 (0.637-1.838) | Allele DEL | 0.37 | 0.42 | ||
| INS/DEL | 27 (42.2) | 179 (37.8) | Allele INS | 0.63 | 0.58 | ||||
| INS/INS | 33 (51.6) | 260 (54.8) | 0.445 | 1.528 (0.515-4.535) | UGT1A1 | 63 | 464 | ||
| Allele DEL | 0.27 | 0.26 | *1/*1 | 20 (31.7) | 206 (44.5) | 0.098 | 0.541 (0.262-1.120) | ||
| Allele INS | 0.73 | 0.74 | *1/*28 | 32 (50.8) | 209 (45.0) | ||||
| IL1A | 64 | 475 | *28/*28 | 6 (9.5) | 46 (9.9) | 0.370 | 1.282 (0.745-2.205) | ||
| DEL/DEL | 10 (15.6) | 86 (18.1) | 0.657 | 0.880 (0.500-1.548) | *36/*1 | 3 (4.8) | 3 (0.6) | ||
| INS/DEL | 33 (51.6) | 246 (51.8) | *36/*37 | 1 (1.6) | 0 (0.0) | 0.0012 | 12.849 (2.906-56.817) | ||
| INS/INS | 21 (32.8) | 143 (30.1) | 0.610 | 1.208 (0.584-2.368) | *1/*37 | 1 (1.6) | 0 (0.0) | ||
| Allele DEL | 0.41 | 0.44 | Allele *36 | 0.03 | 0.01 | ||||
| Allele INS | 0.59 | 0.56 | Allele *1 | 0.60 | 0.67 | ||||
| IL4 | 63 | 474 | Allele *28 | 0.35 | 0.32 | ||||
| RP1/RP1 | 8 (12.7) | 69 (14.5) | 0.195 | 1.493 (0.814-2.740) | Allele *37 | 0.02 | 0.00 | ||
| RP1/RP2 | 39 (61.9) | 251 (53.0) |
- Citation: Cavalcante GC, Amador MA, Ribeiro dos Santos AM, Carvalho DC, Andrade RB, Pereira EE, Fernandes MR, Costa DF, Santos NP, Assumpção PP, Ribeiro dos Santos Â, Santos S. Analysis of 12 variants in the development of gastric and colorectal cancers. World J Gastroenterol 2017; 23(48): 8533-8543
- URL: https://www.wjgnet.com/1007-9327/full/v23/i48/8533.htm
- DOI: https://dx.doi.org/10.3748/wjg.v23.i48.8533