Gene expression profiling of MYC-driven tumor signatures in porcine liver stem cells by transcriptome sequencing

Table 1 Genes expressed by PICM-19 liver stem cells

Gene ID	Gene abbreviation	Function	Fold Δ1
C22ORF39	Human chromosome 22 orf39 homolog	Unknown	11.33
CDO1	Cysteine dioxygenase type 1	Tumor suppressor	6.28
DKK2	Dickkopf Wnt signaling pathway inhibitor 2	Cell signaling	12.20
ENPEP	Glutamyl aminopeptidase	Proteolysis	4.82
GPX6	Glutathione peroxidase 6	Detoxification	2.18
SRPX2	Sushi-repeat containing protein, X-linked 2	Angiogenesis	17.22

¹Normalized to GAPDH expression.

Table 2 Genes expressed in PICM-19-CSCs but not in PICM-19 cells

Gene ID	Gene abbreviation	Fold Δ1
VEGF	Vascular endothelial growth factor	41718.7
snoZ40	Small nucleolar RNA Z40	16658.2
ssc-mir-195a-1	MicroRNA mir-195a-1	6514.83
ssc-mir-125b-1	MicroRNA mir-125b-1	3627.42
ssc-mir-423	MicroRNA mir-423	3627.42
SNORD53	Small nucleolar RNA, C/D box53	2811.10
ssc-mir-421	MicroRNA mir-421	2811.10
ssc-mir-133a-2	MicroRNA mir-133a-2	2558.12
ssc-mir-365-1	MicroRNA mir-365-1	2558.12
SNORD16	Small nucleolar RNA, C/D box 16	1497.27
ssc-mir-31	MicroRNA mir-31	1144.09
SERP2	Stress-associated ER protein family member 2	1137.16
SNORD94	Small nucleolar RNA, C/D box 94	1126.85
SNORD67	Small nucleolar RNA, C/D box 67	816.01
Y_RNA	Non-coding RNA	727.41
GRIA	FAD-dependent oxygenase	370.13
CH242-74M17.6	GAS locus protein, porcine-specific	322.43
CH242-74M17.6	GNAS complex locus, porcine-specific	322.43
SNORA36	Small nucleolar RNA, C/D box 36	199.10
RBP1	Retinol-binding protein 1	182.72
TIMP-3	TIMP metallopeptidase inhibitor 3	173.55
RNF130	Ring finger protein 130	147.15
MT-ND6	Mitochondrial NADH dehydrogenase 6	141.82
PCDH7	Protocadherin 7	90.60
ND4L	NADH dehydrogenase subunit 4L	89.11
U12	Non-coding RNA	85.94
MT1A	Metallothionein 1A	84.09
ZFX	Zinc finger protein X-linked	79.94
CH242-17J7.1	GNAS complex locus, porcine-specific	65.88
RNPC1	RNA binding motif protein 38	65.10
GEM1	Gremlin 1	54.41
CADM4	Cell adhesion molecule 4	39.92
CYP1A1	Cytochrome P450, family 1, subfamily A1	39.89
TFAP2A	Transcription factor AP-2 alpha	39.27
AFP	Alpha-fetoprotein	33.23
CFD	Complement factor D	26.62
GNG	Two-component system response regulator GnG/NtrC	24.20
RNF128	Ring finger protein 128	23.79
MIF	Macrophage migration inhibitory factor	23.69
IFI27l2	Interferon, alpha-inducible protein 27-like 2	22.72
PDE6H	Phosphodiesterase 6H, cGMP-specific	22.54
KLF5	Krüppel-like factor 5	22.53
PRKD1	Protein kinase D1	21.27
SPINT2	Serpin peptidase inhibitor, Kunitz type, 2	18.54
MYC	Myelocytomatosis oncogene	17.64
CD44	Cell surface glycoprotein 44	17.14
GPC3	Glypican 3	16.54
ECHS1	Enoyl-coA hydratase, short-chain, 1	15.42
S100A14	S100 calcium binding protein A14	15.41
LONRF3	LON peptidase N-terminal domain and ring finger 3	15.25
CU463271.1	Protein encoded by CU463271.1 locus	14.86
MMP16	Matrix metalloproteinase 16	14.28
S100A16	S100 calcium binding protein A16	14.14
SLC22A17	Solute carrier family 22 member A17	14.07
ID1	Inhibitor of DNA binding 1	13.34
ATP5E	ATP synthase H+ transporting epsilon	13.14
ISG12(a)	ISG12 protein-like	13.03
UQCRH	Uniquinol-cytochrome c reductase hinge protein	12.44
DKK2	Dickkopf homolog 2	12.20
IL17RA	Interleukin 17 receptor A	12.13
STXBP6	Syntaxin binding protein 6	11.63
F2	Coagulation factor II	11.57
COX17	Cytochrome c oxidase copper chaperone	10.05
MGMT	O-6-methylguanine-DNA methyltransferase	9.96
SDF4	Stromal cell derived factor 4	9.50
PDPN	Podoplanin	9.46
DLK2	Delta-like 2 homolog	9.24
WNT1	Wingless-related MMTV integration site family member 1	9.03
CISD1	CDGSH iron sulfur domain 1	9.00
MYD88	Myeloid differentiation primary response 88	8.71
SDC4	Syndecan 4	8.68
EPCAM	Epithelial cell adhesion molecule	8.59
RPS29	Ribosomal protein S29	8.32
P14ARF	p14 ARF protein (porcine-specific)	8.29
ELAVL2	ELAV-like neuron-specific RNA binding protein 2	8.23
FZD3	Frizzled homolog 3	8.17
XBP1	X-box binding protein 1	8.09
TRIAP1	TP53 regulated inhibitor of apoptosis 1	8.08
ATP5O	ATP synthase H+ transporting O subunit	8.02
VKORC1	Vitamin K epoxide reductase complex, subunit 1	7.80
FAM84B	Family with sequence similarity 84, member B	7.70
ECI2	Enoyl-coA delta isomerase 2	7.69
ARHGDIB	Rho GDP dissociation inhibitor beta	7.41
C20ORF27	Human chromosome 22 orf39 homolog	7.31
RAB6B	RAS oncogene family member	7.28
DDT	D-dopachrome tautomerase	7.14
AGMAT	Agmatine ureohydrolase (Agmatinase)	7.12
CHCHD2	Coiled-coil-helix-coil-helix domain 2	6.92
EPHA7	Eph receptor A7	6.72
OSR2	Odd-skipped related 2	6.71
CFI	Complement factor I	6.55
NDUFB11	NADH dehydrogenase 1 alpha subcomplex 11	6.37
SLC35F1	Solute carrier family 35 member F1	6.37
NUDT14	Nucleoside diphosphate linked moiety X-type motif 14	6.35
SH3GL3	SH3 domain GRB2-like 3	6.32
NDUFA12	NADH dehydrogenase 1 alpha subcomplex 12	6.30
CDO1	Cysteine dioxygenase type 1	6.28
DYNLT1	Dynein, light-chain, Tctex-type	6.27
HSBP1	Heat shock factor binding protein 1	6.20
CCK	Chloecystokinin	5.98
ANXA1	Annexin A2	5.85
FCGRT	Fc fragment of IgG, receptor, transporter, alpha	5.84
AK5	Adenylate kinase 5	5.83
RDH11	Retinol dehydrogenase 11	5.58
RPS18	Ribosomal protein S18	5.56
TGOLN2	Trans-golgi network protein 2	5.55
RNF150	Ring finger protein 150	5.54
HIFX	Hypoxia-inducible factor X	5.47
CFH	Complement factor H	5.43
NPC2	Niemann-Pick disease, type C2	5.34
DCTPP1	dCTP pyrophosphatase 1	5.25
CLVS1	Clavesin 1	5.24
HSF4	Heat shock transcription factor 4	5.23
SERINC2	Serine incorporator 2	5.08
MSMB	Microseminoprotein, beta	5.03
CHID1	Chitinase domain containing 1	4.98
LYSMD2	LysM, putative peptidoglycan-binding, domain 2	4.95
SH3BGRL2	SH3 domain binding glutamic acid-rich protein-like 2	4.86
POU3F1	POU domain, class 3, transcription factor 1	4.77
TCN2	Transcobalamin II	4.76
SORT1	Sortilin 1	4.75
PTGES	Prostaglandin E synthase	4.65
CCND2	Cyclin D2	4.63
GXYLT2	Glucoside xylosyltransferase 2	4.50
CRTAC1	Cartilage acidic protein 1	4.33
MFGE8	Milk fat globule-EGF factor 8	4.29
TNC	Tenascin C	4.28
PCBD1	Pterin-4 alpha-carbinolamine	4.27
PDE10A	Phosphodiesterase 10A	4.22
RAB27B	RAS oncogene family member	4.18
INCENP	Inner centromere protein antigens 135/155kDa	4.14
GJB1	Gap junction protein, beta 1	4.09
CEBPG	CCAAT/enhancer binding protein, gamma	4.04
DUROC-SLA1	Src-like adaptor 1 (pig-specific)	4.04
ITIH4	Inter-alpha-trypsin inhibitor heavy chain family, member 4	4.03
PEBP1	Phosphatidylethanolamine binding protein 1	4.02
ABTB2	Ankyrin repeat and BTB (POZ) domain containing 2	4.00
GJB5	Gap junction protein, beta 5	3.95
CREB3	cAMP responsive element binding protein 3	3.86
DPM2	Dolichyl-phasphate mannosyltranferase polypeptide 2	3.85
GEM	GTP binding protein overexpressed in skeletal muscle	3.85
DOCK8	Dedicator of cytokinesis 8	3.84
TMP-SLA-2	Transmembrane protein, pig-specific	3.83
CYB5B	Cytochrome b5 type B	3.80
TSAN6	Tsan6, Pig-specific protein	3.75
RNASEH2C	Ribonuclease H2, subunit C	3.71
NARS	Asparaginyl-tRNA synthetase	3.70
LSM6	U6 snRNP-associated protein	3.69
MTFP1	Mitochondrial fission process 1	3.66
SLC16A1	Solute carrier family 16 member A1	3.65
RARB	Retinoic acid receptor, beta	3.64
SDSL	Serine dehydrarase-like	3.64
MPC2	Mitochondrial pyruvate carrier 2	3.63
PARVB	Parvin, beta	3.60
RENBP	Renin binding protein	3.55
POC1A	POC1 centrolar protein A	3.54
GUSB	Glucuronidase, beta	3.53
CH242-9E10.1	GNAS complex locus, porcine-specific	3.52
REEP3	Receptor accessory protein 3	3.51
CPT1A	Carnitine palmitoyltransferase 1A	3.40
BHLHB9	Basis helix-loop-helix domain containing B9	3.37
FAAH	Fatty acid amide hydrolase	3.37
MRPL20	Mitochondrial ribosomal protein L20	3.37
HTR2A	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	3.36
TRERF1	Transcriptional regulating factor 1	3.35
XYLB	Xylulokinase	3.32
RBPMS2	RNA binding protein with multiple splicing 2	3.28
FGFR3	Fibroblast growth factor receptor 3	3.27
SLC22A23	Solute carrier family 22 member A23	3.21
NDUFB1	NADH dehydrogenase 1 alpha subcomplex 1	3.18
ZFAND2A	Zinc finger, AN1-type domain 2A	3.16
EPB41	Erythrocyte membrane protein band 4.1	3.11
IGSF23	Immunoglobulin superfamily, member 23	3.11
FAM122C	Family with sequence similarity 122, member C	3.10
AMIGO2	Adhesion molecule with Ig-like domain	3.03
SHROOM4	Shroom family member 4	3.02
MAT1A	Methionine adenosyltransferase 1A	3.01
PARN	Poly(A)-specific ribonuclease	3.00
PFKFB1	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1	3.00
TCF25	Transcription factor 25	2.98
PRODH2	Proline dehydrogenase (oxidase) 2	2.95
CHCHD10	Coiled-coil-helix-coil-helix domain 10	2.91
CH242-217H9.3	GNAS complex locus, porcine-specific	2.85
CASC5	Cancer susceptibility candidate 5	2.84
IGLON5	IgLON family member 5	2.84
CDH17	Cadherin 17	2.82
SLC44A4	Solute carrier family 44 member A4	2.82
LRCH2	Leucine-rich repeats and calponin homology domain 2	2.76
DUROC-NEU1	Sialidase 1 (pig-specific)	2.75
CDC45	Cell division cycle 45	2.71
BCKDHB	Branched chain keto acid dehydrogenase E1	2.69
HNF4A	Hepatocyte nuclear factor 4, alpha	2.67
SCG5	Secretogranin V	2.66
BOLA1	BolA family member 1	2.65
PYGL	Phosphorylase, glycogen, liver-specific	2.64
SCARB1	Scavenger receptor class B, member 1	2.64
SERPIND1	Serpin peptidase inhibitor, clade D, member 1	2.63
GAS2L3	Growth arrest-specific 2 like 3	2.61
EFNA2	Ephrin A2	2.60
PDZK1IP1	PDZK1 interacting protein 1	2.59
VIMP	VCP-interacting membrane protein	2.59
PRR5L	Proline-rich 5-like	2.57
ACVR2B	Activin A receptor, type IIB	2.56
ATP9A	ATPase, class II, type 9A	2.55
PLAUR	Plasminogen activator, urokinase receptor	2.53
LDLR	Low density lipoprotein receptor	2.51
FLRT3	Fibronectin leucine-rich transmembrane protein 3	2.50
ADAMTSL3	ADAMTS-like 3	2.49
CINP	Cyclin-dependent kinase 2 interacting protein	2.48
WBSCR22	Williams Beuren syndrome chromosome region 22	2.48
ALDH9A1	Aldehyde dehydrogenase 9 family member 1	2.46
SSC.82438	Sus scrofa Amphiregulin	2.44
NME3	NME/NME23 nucleoside diphosphate kinase 3	2.43
CCS	Copper chaperone for superoxide dismutase	2.40
PITX2	Paired-like homeodomain transcription factor 2	2.38
MRPL3	Mitochondrial ribosomal protein L3	2.33
BNC1	Basonuclin 1	2.32
RPS16	Ribosomal protein S16	2.32
TM7SF2	Transmembrane 7 superfamily member 2	2.30
CRELD2	Cystein-rich with EGF-like domains 2	2.22
HHEX	Hematopoietically expressed homeobox	2.20
RPL31	Ribosomal protein L31	2.20
TGFA	Transforming growth factor, alpha	2.20
IDS	Iduronate 2-sulfatase	2.18
NRG4	Neuregulin 4	2.17
DGAT1	Diacylglycerol O-acyltransferase 1	2.16
GNAZ	Guanine nucleotide binding protein	2.14
ARL3	ADP-ribosylation factor-like 3	2.12
FABP5	Fatty acid binding protein 5	2.12
KIF12	Kinesin family member 12	2.12
IKBKG	Inhibitor of kappa B	2.09
PDZRN3	PDZ domain containing ring finger 3	2.09
PHF19	PHD finger protein 19	2.09
MRPL24	Mitochondrial ribosomal protein L24	2.07
ARAP2	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	2.04
ITGF3	ItgF3-like protein	2.02
POLA2	Polymerase (DNA directed), alpha 2	2.02
ADAMTS7	ADAM metallopeptidase with thrombo- Spondin type 1 motif 7	1.45

¹Normalized to GAPDH expression.

Table 3 Genes upregulated by MYC in PICM-19-CSCs

Gene ID	Gene abbreviation	Function	log2 ratio
CH242-278B18.2	GNAS Complex, porcine-specific	Unknown	10.25
NFKB1	Nuclear factor κB	Inflammation	8.94
SEMA3F	Semaphorin 3F	Cell signaling	8.27
NME1-NME2	NME1-NME2 read-through	Inflammation	8.22
SERPINA1	Serpin protease inhibitor, clade A1	Inflammation	8.17
VLDLR	Very low density lipoprotein receptor	Metabolism	8.01
APOE	Apolipoprotein E	Metabolism	7.57
ITGA3	Integrin, alpha 3	Migration, Cell adhesion, Invasion	7.41
IGF2BP2	Insulin-like growth factor 2 mRNA binding protein 2	Gene regulation	7.33
MT-ATP6	Mitochondrial ATP synthase 6	Metabolism	7.21
HIF1A	Hypoxia-inducible factor 1α	Angiogenesis	7.12
APOA1	Apolipoprotein A1	Metabolism	7.06
ITGB7	Integrin, beta 7	Cell adhesion	7.03
NKAIN1	Na+/K+ transporting ATPase	Ion transport	7.00
FGG	Fibrinogen gamma chain	Cell adhesion	6.79
CTSB	Cathepsin B	Carcinogenesis	6.74
NTN1	Netrin 1	Inflammation	6.65
JUP	Junction plakoglobin	Cell adhesion	6.61
PLG	Plasminogen	Cell proliferation	6.60
MT-ND2	Mitochondrial NADH dehydrogenase 2	Metabolism	6.37
SERPINA3-2	Serpin protease inhibitor, clade A3-2	Inflammation	6.31
RBP4	Retinol binding protein 4	Metabolism	6.18
FTL	Ferritin, light polypeptide	Iron metabolism	6.08
DUSP4	Dual specificity phosphatase 4	Cell proliferation	6.02
MT-CO1	Mitochondrial cytochrome c oxidase I	Inflammation	6.00

Table 4 Genes downregulated by MYC in PICM-19-CSCs

Gene ID	Gene abbreviation	Function	log2 ratio
ASPN	Asporin	Extracellular matrix	8.20
IGF1	Insulin-like growth factor 1	Cell growth	7.44
OGN	Osteoglycin	Metabolism	6.52
GPM6B	Glycoprotein M6B	Membrane trafficking, cell-to-cell communication	6.23
ISLR	Immunoglobulin superfamily containing leucine-rich repeat	Unknown	6.19
ANGPT1	Angiopoietin 1	Angiogenesis	5.53
WDR66	WD repeat domain 66	EMT modulator	5.49
RSPO2	R-spondin 2 homolog	Wnt modulator	5.46
COL6A2	Collagen, type VI, alpha 2	Fibrosis	5.14
TNR	Tenascin R	Extracellular matrix	5.03
FAM5C	Family with sequence similarity 5, member C	Unknown	4.97
FIGF	c-Fos iduced growth factor	Angiogenesis	4.92
ADAM23	ADAM metallopeptidase domain 23	Metabolism	4.84
MAB21L2	Mab-21-like 2	Cell survival	4.83
PDE1A	Phosphodiesterase 1A	Metabolism, Apoptosis	4.83
CLMP	CXADR-like membrane protein	Cell adhesion	4.74
COL28A1	Collagen, type XXVIII, alpha 1	Fibrosis	4.74
GJA1	Gap junction protein, alpha 1	Oxidative stress	4.67
SELENBP1	Selenium binding protein 1	Tumor suppressor	4.58
CPED1	Cadherin-like and PC-esterase domain containing 1	Unknown	4.52
COL5A3	Collagen, type V, alpha 3	Fibrosis	4.51
ADAMTS2	ADAM metallopeptidase with thrombospondin typ1 motif 2	Metabolism	4.50
PDE8B	Phosphodiesterase 8B	Metabolism	4.47
SGCE	Sarcoglycan, epsilon	Cytoskeleton	4.42
GDPD2	Glycerophosphodiester phosphodiesterase domain containing 2	Cell growth	4.00

Table 5 Genes expressed by both PICM-19 and PICM-19-CSCs that were not affected by MYC overexpression

Gene ID	Gene abbreviation	Function	Fold Δ1
SSC-MIR-425	MicroRNA mir-425	Gene regulation	7925.28
SNORD53	Small nucleolar RNA, C/D box 53	Gene regulation	4969.50
SSC-MIR-378-1	MicroRNA mir-378-1	Gene regulation	3962.64
SSC-MIR-99A	MicroRNA mir-99a	Gene regulation	3761.27
SSC-MIR-101-2	MicroRNA mir-101-2	Gene regulation	3400.56
SSC-LET-7F-2	MicroRNA let-7f-2	Gene regulation	2814.68
5s rRNA	5S ribosomal RNA	Protein synthesis	2255.63
SSC-MIR-210	MicroRNA mir-210	Gene regulation	1730.53
U6	Small nucleolar RNA U6	RNA interference	1187.43
SSC-MIR-196A-2	MicroRNA mir-196a-2	Gene regulation	1127.81
SCARNA15	Small Cajal body-specific RNA 15	Gene regulation	287.24
SNORA72	Small nucleolar RNA, H/ACA box 72	Gene regulation	255.25
SCARNA11	Small Cajal body-specific RNA 11	Gene regulation	163.50
RAMP2	Receptor (G protein-coupled) activity modifying protein 2	Protein transport	56.66
CCNI2	Cyclin I family member 2	Cell cycle	10.67
P4HTM	Prolyl 4-hydroxylase, transmembrane	Hypoxia	6.25
SPDYA	Speedy/RINGO cell cycle regulator family member A	Cell cycle	5.56
PARK2	Parkin RBR E3 ubiquitin ligase	Unknown	5.09
GRPR	Gastrin-releasing peptide receptor	Cell proliferation	4.52
ATG10	Autophagy related 10	Autophagy	3.76
PHYHIP	Phytanoyl-CoA hydroxylase interacting protein	Cell proliferation	3.41
DPEP1	Dipeptidase 1	Metabolism	2.72
DUROC-C2	Nuclear receptor corepressor 2	DNA binding	2.64
HIST1H2BH	Histone cluster 1, H2bh	Histone modification	2.58
PHKG1	Phosphorylase kinase, gamma 1	Glycogenolysis	2.52
TMEM79	Transmembrane protein 79	Protein secretion	2.04
APH1B	APH1B gamma secretase subunit	Protein transport	2.01
IRAK4	Interleukin-1 receptor-associated kinase 4	Cell signaling	2.01

¹Normalized to GAPDH expression.

Table 6 Procine-specific primers used in real-time polymerase chain reaction

Gene	Gene ID	GenBank#	Primer sequences	Product size (bp)
CTSB	100370961	NM_001097458.1	F: AGCCTGGAACTTCTGGACAA	190
			R: TTTGTAGGACGGGGTGTAGC
HIF-1A α-subunit	396696	NM_001123124.1	F: GCCAGAACCTCCTGTAACCA	204
			R: CCTTTTCCTGCTCTGTTTGG
SERPINA3-2	396686	NM_213787.1	F: TGAAAGTTTCCCAGGTGGTC	200
			R: CTAGGGCTTGGTGACTTTGC
ITGA3	100517053	XM_005668879.1	F: CTTCAAACGGAACCAGAGGA	203
			R: AGAAGCTTTGTAGCCGGTGA
SELENBP1	100152724	XM_001929643.3	F: GGTACCAGCCTCGACACAAT	203
			R: GTTGTGCAGGAATCGGATCT
RSPO2	100154008	NM_001293141.1	F: GTCCAGATGGTTTTGCACCT	202
			R: CTCCTGGATTCAGCAATGGT
FIGF	100155670	XM_001928382.3	F: TCCCCAACCCTGTCATTTTA	202
			R: TCCTTCTCCATTCCTTGGTG
ANGPT1	397009	NM_213959.1	F: GGGGGAGGTTGGACTGTAAT	203
			R: TGTGAATAGGCTCGGTTTCC
CDO1	100312964	NM_001167643.1	F: TCTGAAGATGCTGCAAGGAA	208
			R: CGTATCGAAGGGTGGACTGT
DKK2	100519672	XM_003129269.2	F: CTGGTACCCGCTGCAATAAT	198
			R: GACAGGGATCTCCTTCATGC
β-actin	45269029	AY550069.1	F: GGACCTGACCGACTACCTCA	180
			R: GGCAGCTCGTAGCTCTTCTC