BPG is committed to discovery and dissemination of knowledge
Basic Study
©The Author(s) 2015.
World J Gastroenterol. Feb 21, 2015; 21(7): 2011-2029
Published online Feb 21, 2015. doi: 10.3748/wjg.v21.i7.2011
Table 1 Genes expressed by PICM-19 liver stem cells
Gene IDGene abbreviationFunctionFold Δ1
C22ORF39Human chromosome 22 orf39 homologUnknown11.33
CDO1Cysteine dioxygenase type 1Tumor suppressor6.28
DKK2Dickkopf Wnt signaling pathway inhibitor 2Cell signaling12.20
ENPEPGlutamyl aminopeptidaseProteolysis4.82
GPX6Glutathione peroxidase 6Detoxification2.18
SRPX2Sushi-repeat containing protein, X-linked 2Angiogenesis17.22
Table 2 Genes expressed in PICM-19-CSCs but not in PICM-19 cells
Gene IDGene abbreviationFold Δ1
VEGFVascular endothelial growth factor41718.7
snoZ40Small nucleolar RNA Z4016658.2
ssc-mir-195a-1MicroRNA mir-195a-16514.83
ssc-mir-125b-1MicroRNA mir-125b-13627.42
ssc-mir-423MicroRNA mir-4233627.42
SNORD53Small nucleolar RNA, C/D box532811.10
ssc-mir-421MicroRNA mir-4212811.10
ssc-mir-133a-2MicroRNA mir-133a-22558.12
ssc-mir-365-1MicroRNA mir-365-12558.12
SNORD16Small nucleolar RNA, C/D box 161497.27
ssc-mir-31MicroRNA mir-311144.09
SERP2Stress-associated ER protein family member 21137.16
SNORD94Small nucleolar RNA, C/D box 941126.85
SNORD67Small nucleolar RNA, C/D box 67816.01
Y_RNANon-coding RNA727.41
GRIAFAD-dependent oxygenase370.13
CH242-74M17.6GAS locus protein, porcine-specific322.43
CH242-74M17.6GNAS complex locus, porcine-specific322.43
SNORA36Small nucleolar RNA, C/D box 36199.10
RBP1Retinol-binding protein 1182.72
TIMP-3TIMP metallopeptidase inhibitor 3173.55
RNF130Ring finger protein 130147.15
MT-ND6Mitochondrial NADH dehydrogenase 6141.82
PCDH7Protocadherin 790.60
ND4LNADH dehydrogenase subunit 4L89.11
U12Non-coding RNA85.94
MT1AMetallothionein 1A84.09
ZFXZinc finger protein X-linked79.94
CH242-17J7.1GNAS complex locus, porcine-specific65.88
RNPC1RNA binding motif protein 3865.10
GEM1Gremlin 154.41
CADM4Cell adhesion molecule 439.92
CYP1A1Cytochrome P450, family 1, subfamily A139.89
TFAP2ATranscription factor AP-2 alpha39.27
AFPAlpha-fetoprotein33.23
CFDComplement factor D26.62
GNGTwo-component system response regulator GnG/NtrC24.20
RNF128Ring finger protein 12823.79
MIFMacrophage migration inhibitory factor23.69
IFI27l2Interferon, alpha-inducible protein 27-like 222.72
PDE6HPhosphodiesterase 6H, cGMP-specific22.54
KLF5Krüppel-like factor 522.53
PRKD1Protein kinase D121.27
SPINT2Serpin peptidase inhibitor, Kunitz type, 218.54
MYCMyelocytomatosis oncogene17.64
CD44Cell surface glycoprotein 4417.14
GPC3Glypican 316.54
ECHS1Enoyl-coA hydratase, short-chain, 115.42
S100A14S100 calcium binding protein A1415.41
LONRF3LON peptidase N-terminal domain and ring finger 315.25
CU463271.1Protein encoded by CU463271.1 locus14.86
MMP16Matrix metalloproteinase 1614.28
S100A16S100 calcium binding protein A1614.14
SLC22A17Solute carrier family 22 member A1714.07
ID1Inhibitor of DNA binding 113.34
ATP5EATP synthase H+ transporting epsilon13.14
ISG12(a)ISG12 protein-like13.03
UQCRHUniquinol-cytochrome c reductase hinge protein12.44
DKK2Dickkopf homolog 212.20
IL17RAInterleukin 17 receptor A12.13
STXBP6Syntaxin binding protein 611.63
F2Coagulation factor II11.57
COX17Cytochrome c oxidase copper chaperone10.05
MGMTO-6-methylguanine-DNA methyltransferase9.96
SDF4Stromal cell derived factor 49.50
PDPNPodoplanin9.46
DLK2Delta-like 2 homolog9.24
WNT1Wingless-related MMTV integration site family member 19.03
CISD1CDGSH iron sulfur domain 19.00
MYD88Myeloid differentiation primary response 888.71
SDC4Syndecan 48.68
EPCAMEpithelial cell adhesion molecule8.59
RPS29Ribosomal protein S298.32
P14ARFp14 ARF protein (porcine-specific)8.29
ELAVL2ELAV-like neuron-specific RNA binding protein 28.23
FZD3Frizzled homolog 38.17
XBP1X-box binding protein 18.09
TRIAP1TP53 regulated inhibitor of apoptosis 18.08
ATP5OATP synthase H+ transporting O subunit8.02
VKORC1Vitamin K epoxide reductase complex, subunit 17.80
FAM84BFamily with sequence similarity 84, member B7.70
ECI2Enoyl-coA delta isomerase 27.69
ARHGDIBRho GDP dissociation inhibitor beta7.41
C20ORF27Human chromosome 22 orf39 homolog7.31
RAB6BRAS oncogene family member7.28
DDTD-dopachrome tautomerase7.14
AGMATAgmatine ureohydrolase (Agmatinase)7.12
CHCHD2Coiled-coil-helix-coil-helix domain 26.92
EPHA7Eph receptor A76.72
OSR2Odd-skipped related 26.71
CFIComplement factor I6.55
NDUFB11NADH dehydrogenase 1 alpha subcomplex 116.37
SLC35F1Solute carrier family 35 member F16.37
NUDT14Nucleoside diphosphate linked moiety X-type motif 146.35
SH3GL3SH3 domain GRB2-like 36.32
NDUFA12NADH dehydrogenase 1 alpha subcomplex 126.30
CDO1Cysteine dioxygenase type 16.28
DYNLT1Dynein, light-chain, Tctex-type6.27
HSBP1Heat shock factor binding protein 16.20
CCKChloecystokinin5.98
ANXA1Annexin A25.85
FCGRTFc fragment of IgG, receptor, transporter, alpha5.84
AK5Adenylate kinase 55.83
RDH11Retinol dehydrogenase 115.58
RPS18Ribosomal protein S185.56
TGOLN2Trans-golgi network protein 25.55
RNF150Ring finger protein 1505.54
HIFXHypoxia-inducible factor X5.47
CFHComplement factor H5.43
NPC2Niemann-Pick disease, type C25.34
DCTPP1dCTP pyrophosphatase 15.25
CLVS1Clavesin 15.24
HSF4Heat shock transcription factor 45.23
SERINC2Serine incorporator 25.08
MSMBMicroseminoprotein, beta5.03
CHID1Chitinase domain containing 14.98
LYSMD2LysM, putative peptidoglycan-binding, domain 24.95
SH3BGRL2SH3 domain binding glutamic acid-rich protein-like 24.86
POU3F1POU domain, class 3, transcription factor 14.77
TCN2Transcobalamin II4.76
SORT1Sortilin 14.75
PTGESProstaglandin E synthase4.65
CCND2Cyclin D24.63
GXYLT2Glucoside xylosyltransferase 24.50
CRTAC1Cartilage acidic protein 14.33
MFGE8Milk fat globule-EGF factor 84.29
TNCTenascin C4.28
PCBD1Pterin-4 alpha-carbinolamine4.27
PDE10APhosphodiesterase 10A4.22
RAB27BRAS oncogene family member4.18
INCENPInner centromere protein antigens 135/155kDa4.14
GJB1Gap junction protein, beta 14.09
CEBPGCCAAT/enhancer binding protein, gamma4.04
DUROC-SLA1Src-like adaptor 1 (pig-specific)4.04
ITIH4Inter-alpha-trypsin inhibitor heavy chain family, member 44.03
PEBP1Phosphatidylethanolamine binding protein 14.02
ABTB2Ankyrin repeat and BTB (POZ) domain containing 24.00
GJB5Gap junction protein, beta 53.95
CREB3cAMP responsive element binding protein 33.86
DPM2Dolichyl-phasphate mannosyltranferase polypeptide 23.85
GEMGTP binding protein overexpressed in skeletal muscle3.85
DOCK8Dedicator of cytokinesis 83.84
TMP-SLA-2Transmembrane protein, pig-specific3.83
CYB5BCytochrome b5 type B3.80
TSAN6Tsan6, Pig-specific protein3.75
RNASEH2CRibonuclease H2, subunit C3.71
NARSAsparaginyl-tRNA synthetase3.70
LSM6U6 snRNP-associated protein3.69
MTFP1Mitochondrial fission process 13.66
SLC16A1Solute carrier family 16 member A13.65
RARBRetinoic acid receptor, beta3.64
SDSLSerine dehydrarase-like3.64
MPC2Mitochondrial pyruvate carrier 23.63
PARVBParvin, beta3.60
RENBPRenin binding protein3.55
POC1APOC1 centrolar protein A3.54
GUSBGlucuronidase, beta3.53
CH242-9E10.1GNAS complex locus, porcine-specific3.52
REEP3Receptor accessory protein 33.51
CPT1ACarnitine palmitoyltransferase 1A3.40
BHLHB9Basis helix-loop-helix domain containing B93.37
FAAHFatty acid amide hydrolase3.37
MRPL20Mitochondrial ribosomal protein L203.37
HTR2A5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled3.36
TRERF1Transcriptional regulating factor 13.35
XYLBXylulokinase3.32
RBPMS2RNA binding protein with multiple splicing 23.28
FGFR3Fibroblast growth factor receptor 33.27
SLC22A23Solute carrier family 22 member A233.21
NDUFB1NADH dehydrogenase 1 alpha subcomplex 13.18
ZFAND2AZinc finger, AN1-type domain 2A3.16
EPB41Erythrocyte membrane protein band 4.13.11
IGSF23Immunoglobulin superfamily, member 233.11
FAM122CFamily with sequence similarity 122, member C3.10
AMIGO2Adhesion molecule with Ig-like domain3.03
SHROOM4Shroom family member 43.02
MAT1AMethionine adenosyltransferase 1A3.01
PARNPoly(A)-specific ribonuclease3.00
PFKFB16-phosphofructo-2-kinase/fructose-2,6-biphosphatase 13.00
TCF25Transcription factor 252.98
PRODH2Proline dehydrogenase (oxidase) 22.95
CHCHD10Coiled-coil-helix-coil-helix domain 102.91
CH242-217H9.3GNAS complex locus, porcine-specific2.85
CASC5Cancer susceptibility candidate 52.84
IGLON5IgLON family member 52.84
CDH17Cadherin 172.82
SLC44A4Solute carrier family 44 member A42.82
LRCH2Leucine-rich repeats and calponin homology domain 22.76
DUROC-NEU1Sialidase 1 (pig-specific)2.75
CDC45Cell division cycle 452.71
BCKDHBBranched chain keto acid dehydrogenase E12.69
HNF4AHepatocyte nuclear factor 4, alpha2.67
SCG5Secretogranin V2.66
BOLA1BolA family member 12.65
PYGLPhosphorylase, glycogen, liver-specific2.64
SCARB1Scavenger receptor class B, member 12.64
SERPIND1Serpin peptidase inhibitor, clade D, member 12.63
GAS2L3Growth arrest-specific 2 like 32.61
EFNA2Ephrin A22.60
PDZK1IP1PDZK1 interacting protein 12.59
VIMPVCP-interacting membrane protein2.59
PRR5LProline-rich 5-like2.57
ACVR2BActivin A receptor, type IIB2.56
ATP9AATPase, class II, type 9A2.55
PLAURPlasminogen activator, urokinase receptor2.53
LDLRLow density lipoprotein receptor2.51
FLRT3Fibronectin leucine-rich transmembrane protein 32.50
ADAMTSL3ADAMTS-like 32.49
CINPCyclin-dependent kinase 2 interacting protein2.48
WBSCR22Williams Beuren syndrome chromosome region 222.48
ALDH9A1Aldehyde dehydrogenase 9 family member 12.46
SSC.82438Sus scrofa Amphiregulin2.44
NME3NME/NME23 nucleoside diphosphate kinase 32.43
CCSCopper chaperone for superoxide dismutase2.40
PITX2Paired-like homeodomain transcription factor 22.38
MRPL3Mitochondrial ribosomal protein L32.33
BNC1Basonuclin 12.32
RPS16Ribosomal protein S162.32
TM7SF2Transmembrane 7 superfamily member 22.30
CRELD2Cystein-rich with EGF-like domains 22.22
HHEXHematopoietically expressed homeobox2.20
RPL31Ribosomal protein L312.20
TGFATransforming growth factor, alpha2.20
IDSIduronate 2-sulfatase2.18
NRG4Neuregulin 42.17
DGAT1Diacylglycerol O-acyltransferase 12.16
GNAZGuanine nucleotide binding protein2.14
ARL3ADP-ribosylation factor-like 32.12
FABP5Fatty acid binding protein 52.12
KIF12Kinesin family member 122.12
IKBKGInhibitor of kappa B2.09
PDZRN3PDZ domain containing ring finger 32.09
PHF19PHD finger protein 192.09
MRPL24Mitochondrial ribosomal protein L242.07
ARAP2ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 22.04
ITGF3ItgF3-like protein2.02
POLA2Polymerase (DNA directed), alpha 22.02
ADAMTS7ADAM metallopeptidase with thrombo- Spondin type 1 motif 71.45
Table 3 Genes upregulated by MYC in PICM-19-CSCs
Gene IDGene abbreviationFunctionlog2 ratio
CH242-278B18.2GNAS Complex, porcine-specificUnknown10.25
NFKB1Nuclear factor κBInflammation8.94
SEMA3FSemaphorin 3FCell signaling8.27
NME1-NME2NME1-NME2 read-throughInflammation8.22
SERPINA1Serpin protease inhibitor, clade A1Inflammation8.17
VLDLRVery low density lipoprotein receptorMetabolism8.01
APOEApolipoprotein EMetabolism7.57
ITGA3Integrin, alpha 3Migration, Cell adhesion, Invasion7.41
IGF2BP2Insulin-like growth factor 2 mRNA binding protein 2Gene regulation7.33
MT-ATP6Mitochondrial ATP synthase 6Metabolism7.21
HIF1AHypoxia-inducible factor 1αAngiogenesis7.12
APOA1Apolipoprotein A1Metabolism7.06
ITGB7Integrin, beta 7Cell adhesion7.03
NKAIN1Na+/K+ transporting ATPaseIon transport7.00
FGGFibrinogen gamma chainCell adhesion6.79
CTSBCathepsin BCarcinogenesis6.74
NTN1Netrin 1Inflammation6.65
JUPJunction plakoglobinCell adhesion6.61
PLGPlasminogenCell proliferation6.60
MT-ND2Mitochondrial NADH dehydrogenase 2Metabolism6.37
SERPINA3-2Serpin protease inhibitor, clade A3-2Inflammation6.31
RBP4Retinol binding protein 4Metabolism6.18
FTLFerritin, light polypeptideIron metabolism6.08
DUSP4Dual specificity phosphatase 4Cell proliferation6.02
MT-CO1Mitochondrial cytochrome c oxidase IInflammation6.00
Table 4 Genes downregulated by MYC in PICM-19-CSCs
Gene IDGene abbreviationFunctionlog2 ratio
ASPNAsporinExtracellular matrix8.20
IGF1Insulin-like growth factor 1Cell growth7.44
OGNOsteoglycinMetabolism6.52
GPM6BGlycoprotein M6BMembrane trafficking, cell-to-cell communication6.23
ISLRImmunoglobulin superfamily containing leucine-rich repeatUnknown6.19
ANGPT1Angiopoietin 1Angiogenesis5.53
WDR66WD repeat domain 66EMT modulator5.49
RSPO2R-spondin 2 homologWnt modulator5.46
COL6A2Collagen, type VI, alpha 2Fibrosis5.14
TNRTenascin RExtracellular matrix5.03
FAM5CFamily with sequence similarity 5, member CUnknown4.97
FIGFc-Fos iduced growth factorAngiogenesis4.92
ADAM23ADAM metallopeptidase domain 23Metabolism4.84
MAB21L2Mab-21-like 2Cell survival4.83
PDE1APhosphodiesterase 1AMetabolism, Apoptosis4.83
CLMPCXADR-like membrane proteinCell adhesion4.74
COL28A1Collagen, type XXVIII, alpha 1Fibrosis4.74
GJA1Gap junction protein, alpha 1Oxidative stress4.67
SELENBP1Selenium binding protein 1Tumor suppressor4.58
CPED1Cadherin-like and PC-esterase domain containing 1Unknown4.52
COL5A3Collagen, type V, alpha 3Fibrosis4.51
ADAMTS2ADAM metallopeptidase with thrombospondin typ1 motif 2Metabolism4.50
PDE8BPhosphodiesterase 8BMetabolism4.47
SGCESarcoglycan, epsilonCytoskeleton4.42
GDPD2Glycerophosphodiester phosphodiesterase domain containing 2Cell growth4.00
Table 5 Genes expressed by both PICM-19 and PICM-19-CSCs that were not affected by MYC overexpression
Gene IDGene abbreviationFunctionFold Δ1
SSC-MIR-425MicroRNA mir-425Gene regulation7925.28
SNORD53Small nucleolar RNA, C/D box 53Gene regulation4969.50
SSC-MIR-378-1MicroRNA mir-378-1Gene regulation3962.64
SSC-MIR-99AMicroRNA mir-99aGene regulation3761.27
SSC-MIR-101-2MicroRNA mir-101-2Gene regulation3400.56
SSC-LET-7F-2MicroRNA let-7f-2Gene regulation2814.68
5s rRNA5S ribosomal RNAProtein synthesis2255.63
SSC-MIR-210MicroRNA mir-210Gene regulation1730.53
U6Small nucleolar RNA U6RNA interference1187.43
SSC-MIR-196A-2MicroRNA mir-196a-2Gene regulation1127.81
SCARNA15Small Cajal body-specific RNA 15Gene regulation287.24
SNORA72Small nucleolar RNA, H/ACA box 72Gene regulation255.25
SCARNA11Small Cajal body-specific RNA 11Gene regulation163.50
RAMP2Receptor (G protein-coupled) activity modifying protein 2Protein transport56.66
CCNI2Cyclin I family member 2Cell cycle10.67
P4HTMProlyl 4-hydroxylase, transmembraneHypoxia6.25
SPDYASpeedy/RINGO cell cycle regulator family member ACell cycle5.56
PARK2Parkin RBR E3 ubiquitin ligaseUnknown5.09
GRPRGastrin-releasing peptide receptorCell proliferation4.52
ATG10Autophagy related 10Autophagy3.76
PHYHIPPhytanoyl-CoA hydroxylase interacting proteinCell proliferation3.41
DPEP1Dipeptidase 1Metabolism2.72
DUROC-C2Nuclear receptor corepressor 2DNA binding2.64
HIST1H2BHHistone cluster 1, H2bhHistone modification2.58
PHKG1Phosphorylase kinase, gamma 1Glycogenolysis2.52
TMEM79Transmembrane protein 79Protein secretion2.04
APH1BAPH1B gamma secretase subunitProtein transport2.01
IRAK4Interleukin-1 receptor-associated kinase 4Cell signaling2.01
Table 6 Procine-specific primers used in real-time polymerase chain reaction
GeneGene IDGenBank#Primer sequencesProduct size (bp)
CTSB100370961NM_001097458.1F: AGCCTGGAACTTCTGGACAA190
R: TTTGTAGGACGGGGTGTAGC
HIF-1A α-subunit396696NM_001123124.1F: GCCAGAACCTCCTGTAACCA204
R: CCTTTTCCTGCTCTGTTTGG
SERPINA3-2396686NM_213787.1F: TGAAAGTTTCCCAGGTGGTC200
R: CTAGGGCTTGGTGACTTTGC
ITGA3100517053XM_005668879.1F: CTTCAAACGGAACCAGAGGA203
R: AGAAGCTTTGTAGCCGGTGA
SELENBP1100152724XM_001929643.3F: GGTACCAGCCTCGACACAAT203
R: GTTGTGCAGGAATCGGATCT
RSPO2100154008NM_001293141.1F: GTCCAGATGGTTTTGCACCT202
R: CTCCTGGATTCAGCAATGGT
FIGF100155670XM_001928382.3F: TCCCCAACCCTGTCATTTTA202
R: TCCTTCTCCATTCCTTGGTG
ANGPT1397009NM_213959.1F: GGGGGAGGTTGGACTGTAAT203
R: TGTGAATAGGCTCGGTTTCC
CDO1100312964NM_001167643.1F: TCTGAAGATGCTGCAAGGAA208
R: CGTATCGAAGGGTGGACTGT
DKK2100519672XM_003129269.2F: CTGGTACCCGCTGCAATAAT198
R: GACAGGGATCTCCTTCATGC
β-actin45269029AY550069.1F: GGACCTGACCGACTACCTCA180
R: GGCAGCTCGTAGCTCTTCTC


Write to the Help Desk