©The Author(s) 2015.
World J Gastroenterol. Feb 21, 2015; 21(7): 2011-2029
Published online Feb 21, 2015. doi: 10.3748/wjg.v21.i7.2011
Published online Feb 21, 2015. doi: 10.3748/wjg.v21.i7.2011
Table 1 Genes expressed by PICM-19 liver stem cells
| Gene ID | Gene abbreviation | Function | Fold Δ1 |
| C22ORF39 | Human chromosome 22 orf39 homolog | Unknown | 11.33 |
| CDO1 | Cysteine dioxygenase type 1 | Tumor suppressor | 6.28 |
| DKK2 | Dickkopf Wnt signaling pathway inhibitor 2 | Cell signaling | 12.20 |
| ENPEP | Glutamyl aminopeptidase | Proteolysis | 4.82 |
| GPX6 | Glutathione peroxidase 6 | Detoxification | 2.18 |
| SRPX2 | Sushi-repeat containing protein, X-linked 2 | Angiogenesis | 17.22 |
Table 2 Genes expressed in PICM-19-CSCs but not in PICM-19 cells
| Gene ID | Gene abbreviation | Fold Δ1 |
| VEGF | Vascular endothelial growth factor | 41718.7 |
| snoZ40 | Small nucleolar RNA Z40 | 16658.2 |
| ssc-mir-195a-1 | MicroRNA mir-195a-1 | 6514.83 |
| ssc-mir-125b-1 | MicroRNA mir-125b-1 | 3627.42 |
| ssc-mir-423 | MicroRNA mir-423 | 3627.42 |
| SNORD53 | Small nucleolar RNA, C/D box53 | 2811.10 |
| ssc-mir-421 | MicroRNA mir-421 | 2811.10 |
| ssc-mir-133a-2 | MicroRNA mir-133a-2 | 2558.12 |
| ssc-mir-365-1 | MicroRNA mir-365-1 | 2558.12 |
| SNORD16 | Small nucleolar RNA, C/D box 16 | 1497.27 |
| ssc-mir-31 | MicroRNA mir-31 | 1144.09 |
| SERP2 | Stress-associated ER protein family member 2 | 1137.16 |
| SNORD94 | Small nucleolar RNA, C/D box 94 | 1126.85 |
| SNORD67 | Small nucleolar RNA, C/D box 67 | 816.01 |
| Y_RNA | Non-coding RNA | 727.41 |
| GRIA | FAD-dependent oxygenase | 370.13 |
| CH242-74M17.6 | GAS locus protein, porcine-specific | 322.43 |
| CH242-74M17.6 | GNAS complex locus, porcine-specific | 322.43 |
| SNORA36 | Small nucleolar RNA, C/D box 36 | 199.10 |
| RBP1 | Retinol-binding protein 1 | 182.72 |
| TIMP-3 | TIMP metallopeptidase inhibitor 3 | 173.55 |
| RNF130 | Ring finger protein 130 | 147.15 |
| MT-ND6 | Mitochondrial NADH dehydrogenase 6 | 141.82 |
| PCDH7 | Protocadherin 7 | 90.60 |
| ND4L | NADH dehydrogenase subunit 4L | 89.11 |
| U12 | Non-coding RNA | 85.94 |
| MT1A | Metallothionein 1A | 84.09 |
| ZFX | Zinc finger protein X-linked | 79.94 |
| CH242-17J7.1 | GNAS complex locus, porcine-specific | 65.88 |
| RNPC1 | RNA binding motif protein 38 | 65.10 |
| GEM1 | Gremlin 1 | 54.41 |
| CADM4 | Cell adhesion molecule 4 | 39.92 |
| CYP1A1 | Cytochrome P450, family 1, subfamily A1 | 39.89 |
| TFAP2A | Transcription factor AP-2 alpha | 39.27 |
| AFP | Alpha-fetoprotein | 33.23 |
| CFD | Complement factor D | 26.62 |
| GNG | Two-component system response regulator GnG/NtrC | 24.20 |
| RNF128 | Ring finger protein 128 | 23.79 |
| MIF | Macrophage migration inhibitory factor | 23.69 |
| IFI27l2 | Interferon, alpha-inducible protein 27-like 2 | 22.72 |
| PDE6H | Phosphodiesterase 6H, cGMP-specific | 22.54 |
| KLF5 | Krüppel-like factor 5 | 22.53 |
| PRKD1 | Protein kinase D1 | 21.27 |
| SPINT2 | Serpin peptidase inhibitor, Kunitz type, 2 | 18.54 |
| MYC | Myelocytomatosis oncogene | 17.64 |
| CD44 | Cell surface glycoprotein 44 | 17.14 |
| GPC3 | Glypican 3 | 16.54 |
| ECHS1 | Enoyl-coA hydratase, short-chain, 1 | 15.42 |
| S100A14 | S100 calcium binding protein A14 | 15.41 |
| LONRF3 | LON peptidase N-terminal domain and ring finger 3 | 15.25 |
| CU463271.1 | Protein encoded by CU463271.1 locus | 14.86 |
| MMP16 | Matrix metalloproteinase 16 | 14.28 |
| S100A16 | S100 calcium binding protein A16 | 14.14 |
| SLC22A17 | Solute carrier family 22 member A17 | 14.07 |
| ID1 | Inhibitor of DNA binding 1 | 13.34 |
| ATP5E | ATP synthase H+ transporting epsilon | 13.14 |
| ISG12(a) | ISG12 protein-like | 13.03 |
| UQCRH | Uniquinol-cytochrome c reductase hinge protein | 12.44 |
| DKK2 | Dickkopf homolog 2 | 12.20 |
| IL17RA | Interleukin 17 receptor A | 12.13 |
| STXBP6 | Syntaxin binding protein 6 | 11.63 |
| F2 | Coagulation factor II | 11.57 |
| COX17 | Cytochrome c oxidase copper chaperone | 10.05 |
| MGMT | O-6-methylguanine-DNA methyltransferase | 9.96 |
| SDF4 | Stromal cell derived factor 4 | 9.50 |
| PDPN | Podoplanin | 9.46 |
| DLK2 | Delta-like 2 homolog | 9.24 |
| WNT1 | Wingless-related MMTV integration site family member 1 | 9.03 |
| CISD1 | CDGSH iron sulfur domain 1 | 9.00 |
| MYD88 | Myeloid differentiation primary response 88 | 8.71 |
| SDC4 | Syndecan 4 | 8.68 |
| EPCAM | Epithelial cell adhesion molecule | 8.59 |
| RPS29 | Ribosomal protein S29 | 8.32 |
| P14ARF | p14 ARF protein (porcine-specific) | 8.29 |
| ELAVL2 | ELAV-like neuron-specific RNA binding protein 2 | 8.23 |
| FZD3 | Frizzled homolog 3 | 8.17 |
| XBP1 | X-box binding protein 1 | 8.09 |
| TRIAP1 | TP53 regulated inhibitor of apoptosis 1 | 8.08 |
| ATP5O | ATP synthase H+ transporting O subunit | 8.02 |
| VKORC1 | Vitamin K epoxide reductase complex, subunit 1 | 7.80 |
| FAM84B | Family with sequence similarity 84, member B | 7.70 |
| ECI2 | Enoyl-coA delta isomerase 2 | 7.69 |
| ARHGDIB | Rho GDP dissociation inhibitor beta | 7.41 |
| C20ORF27 | Human chromosome 22 orf39 homolog | 7.31 |
| RAB6B | RAS oncogene family member | 7.28 |
| DDT | D-dopachrome tautomerase | 7.14 |
| AGMAT | Agmatine ureohydrolase (Agmatinase) | 7.12 |
| CHCHD2 | Coiled-coil-helix-coil-helix domain 2 | 6.92 |
| EPHA7 | Eph receptor A7 | 6.72 |
| OSR2 | Odd-skipped related 2 | 6.71 |
| CFI | Complement factor I | 6.55 |
| NDUFB11 | NADH dehydrogenase 1 alpha subcomplex 11 | 6.37 |
| SLC35F1 | Solute carrier family 35 member F1 | 6.37 |
| NUDT14 | Nucleoside diphosphate linked moiety X-type motif 14 | 6.35 |
| SH3GL3 | SH3 domain GRB2-like 3 | 6.32 |
| NDUFA12 | NADH dehydrogenase 1 alpha subcomplex 12 | 6.30 |
| CDO1 | Cysteine dioxygenase type 1 | 6.28 |
| DYNLT1 | Dynein, light-chain, Tctex-type | 6.27 |
| HSBP1 | Heat shock factor binding protein 1 | 6.20 |
| CCK | Chloecystokinin | 5.98 |
| ANXA1 | Annexin A2 | 5.85 |
| FCGRT | Fc fragment of IgG, receptor, transporter, alpha | 5.84 |
| AK5 | Adenylate kinase 5 | 5.83 |
| RDH11 | Retinol dehydrogenase 11 | 5.58 |
| RPS18 | Ribosomal protein S18 | 5.56 |
| TGOLN2 | Trans-golgi network protein 2 | 5.55 |
| RNF150 | Ring finger protein 150 | 5.54 |
| HIFX | Hypoxia-inducible factor X | 5.47 |
| CFH | Complement factor H | 5.43 |
| NPC2 | Niemann-Pick disease, type C2 | 5.34 |
| DCTPP1 | dCTP pyrophosphatase 1 | 5.25 |
| CLVS1 | Clavesin 1 | 5.24 |
| HSF4 | Heat shock transcription factor 4 | 5.23 |
| SERINC2 | Serine incorporator 2 | 5.08 |
| MSMB | Microseminoprotein, beta | 5.03 |
| CHID1 | Chitinase domain containing 1 | 4.98 |
| LYSMD2 | LysM, putative peptidoglycan-binding, domain 2 | 4.95 |
| SH3BGRL2 | SH3 domain binding glutamic acid-rich protein-like 2 | 4.86 |
| POU3F1 | POU domain, class 3, transcription factor 1 | 4.77 |
| TCN2 | Transcobalamin II | 4.76 |
| SORT1 | Sortilin 1 | 4.75 |
| PTGES | Prostaglandin E synthase | 4.65 |
| CCND2 | Cyclin D2 | 4.63 |
| GXYLT2 | Glucoside xylosyltransferase 2 | 4.50 |
| CRTAC1 | Cartilage acidic protein 1 | 4.33 |
| MFGE8 | Milk fat globule-EGF factor 8 | 4.29 |
| TNC | Tenascin C | 4.28 |
| PCBD1 | Pterin-4 alpha-carbinolamine | 4.27 |
| PDE10A | Phosphodiesterase 10A | 4.22 |
| RAB27B | RAS oncogene family member | 4.18 |
| INCENP | Inner centromere protein antigens 135/155kDa | 4.14 |
| GJB1 | Gap junction protein, beta 1 | 4.09 |
| CEBPG | CCAAT/enhancer binding protein, gamma | 4.04 |
| DUROC-SLA1 | Src-like adaptor 1 (pig-specific) | 4.04 |
| ITIH4 | Inter-alpha-trypsin inhibitor heavy chain family, member 4 | 4.03 |
| PEBP1 | Phosphatidylethanolamine binding protein 1 | 4.02 |
| ABTB2 | Ankyrin repeat and BTB (POZ) domain containing 2 | 4.00 |
| GJB5 | Gap junction protein, beta 5 | 3.95 |
| CREB3 | cAMP responsive element binding protein 3 | 3.86 |
| DPM2 | Dolichyl-phasphate mannosyltranferase polypeptide 2 | 3.85 |
| GEM | GTP binding protein overexpressed in skeletal muscle | 3.85 |
| DOCK8 | Dedicator of cytokinesis 8 | 3.84 |
| TMP-SLA-2 | Transmembrane protein, pig-specific | 3.83 |
| CYB5B | Cytochrome b5 type B | 3.80 |
| TSAN6 | Tsan6, Pig-specific protein | 3.75 |
| RNASEH2C | Ribonuclease H2, subunit C | 3.71 |
| NARS | Asparaginyl-tRNA synthetase | 3.70 |
| LSM6 | U6 snRNP-associated protein | 3.69 |
| MTFP1 | Mitochondrial fission process 1 | 3.66 |
| SLC16A1 | Solute carrier family 16 member A1 | 3.65 |
| RARB | Retinoic acid receptor, beta | 3.64 |
| SDSL | Serine dehydrarase-like | 3.64 |
| MPC2 | Mitochondrial pyruvate carrier 2 | 3.63 |
| PARVB | Parvin, beta | 3.60 |
| RENBP | Renin binding protein | 3.55 |
| POC1A | POC1 centrolar protein A | 3.54 |
| GUSB | Glucuronidase, beta | 3.53 |
| CH242-9E10.1 | GNAS complex locus, porcine-specific | 3.52 |
| REEP3 | Receptor accessory protein 3 | 3.51 |
| CPT1A | Carnitine palmitoyltransferase 1A | 3.40 |
| BHLHB9 | Basis helix-loop-helix domain containing B9 | 3.37 |
| FAAH | Fatty acid amide hydrolase | 3.37 |
| MRPL20 | Mitochondrial ribosomal protein L20 | 3.37 |
| HTR2A | 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled | 3.36 |
| TRERF1 | Transcriptional regulating factor 1 | 3.35 |
| XYLB | Xylulokinase | 3.32 |
| RBPMS2 | RNA binding protein with multiple splicing 2 | 3.28 |
| FGFR3 | Fibroblast growth factor receptor 3 | 3.27 |
| SLC22A23 | Solute carrier family 22 member A23 | 3.21 |
| NDUFB1 | NADH dehydrogenase 1 alpha subcomplex 1 | 3.18 |
| ZFAND2A | Zinc finger, AN1-type domain 2A | 3.16 |
| EPB41 | Erythrocyte membrane protein band 4.1 | 3.11 |
| IGSF23 | Immunoglobulin superfamily, member 23 | 3.11 |
| FAM122C | Family with sequence similarity 122, member C | 3.10 |
| AMIGO2 | Adhesion molecule with Ig-like domain | 3.03 |
| SHROOM4 | Shroom family member 4 | 3.02 |
| MAT1A | Methionine adenosyltransferase 1A | 3.01 |
| PARN | Poly(A)-specific ribonuclease | 3.00 |
| PFKFB1 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 | 3.00 |
| TCF25 | Transcription factor 25 | 2.98 |
| PRODH2 | Proline dehydrogenase (oxidase) 2 | 2.95 |
| CHCHD10 | Coiled-coil-helix-coil-helix domain 10 | 2.91 |
| CH242-217H9.3 | GNAS complex locus, porcine-specific | 2.85 |
| CASC5 | Cancer susceptibility candidate 5 | 2.84 |
| IGLON5 | IgLON family member 5 | 2.84 |
| CDH17 | Cadherin 17 | 2.82 |
| SLC44A4 | Solute carrier family 44 member A4 | 2.82 |
| LRCH2 | Leucine-rich repeats and calponin homology domain 2 | 2.76 |
| DUROC-NEU1 | Sialidase 1 (pig-specific) | 2.75 |
| CDC45 | Cell division cycle 45 | 2.71 |
| BCKDHB | Branched chain keto acid dehydrogenase E1 | 2.69 |
| HNF4A | Hepatocyte nuclear factor 4, alpha | 2.67 |
| SCG5 | Secretogranin V | 2.66 |
| BOLA1 | BolA family member 1 | 2.65 |
| PYGL | Phosphorylase, glycogen, liver-specific | 2.64 |
| SCARB1 | Scavenger receptor class B, member 1 | 2.64 |
| SERPIND1 | Serpin peptidase inhibitor, clade D, member 1 | 2.63 |
| GAS2L3 | Growth arrest-specific 2 like 3 | 2.61 |
| EFNA2 | Ephrin A2 | 2.60 |
| PDZK1IP1 | PDZK1 interacting protein 1 | 2.59 |
| VIMP | VCP-interacting membrane protein | 2.59 |
| PRR5L | Proline-rich 5-like | 2.57 |
| ACVR2B | Activin A receptor, type IIB | 2.56 |
| ATP9A | ATPase, class II, type 9A | 2.55 |
| PLAUR | Plasminogen activator, urokinase receptor | 2.53 |
| LDLR | Low density lipoprotein receptor | 2.51 |
| FLRT3 | Fibronectin leucine-rich transmembrane protein 3 | 2.50 |
| ADAMTSL3 | ADAMTS-like 3 | 2.49 |
| CINP | Cyclin-dependent kinase 2 interacting protein | 2.48 |
| WBSCR22 | Williams Beuren syndrome chromosome region 22 | 2.48 |
| ALDH9A1 | Aldehyde dehydrogenase 9 family member 1 | 2.46 |
| SSC.82438 | Sus scrofa Amphiregulin | 2.44 |
| NME3 | NME/NME23 nucleoside diphosphate kinase 3 | 2.43 |
| CCS | Copper chaperone for superoxide dismutase | 2.40 |
| PITX2 | Paired-like homeodomain transcription factor 2 | 2.38 |
| MRPL3 | Mitochondrial ribosomal protein L3 | 2.33 |
| BNC1 | Basonuclin 1 | 2.32 |
| RPS16 | Ribosomal protein S16 | 2.32 |
| TM7SF2 | Transmembrane 7 superfamily member 2 | 2.30 |
| CRELD2 | Cystein-rich with EGF-like domains 2 | 2.22 |
| HHEX | Hematopoietically expressed homeobox | 2.20 |
| RPL31 | Ribosomal protein L31 | 2.20 |
| TGFA | Transforming growth factor, alpha | 2.20 |
| IDS | Iduronate 2-sulfatase | 2.18 |
| NRG4 | Neuregulin 4 | 2.17 |
| DGAT1 | Diacylglycerol O-acyltransferase 1 | 2.16 |
| GNAZ | Guanine nucleotide binding protein | 2.14 |
| ARL3 | ADP-ribosylation factor-like 3 | 2.12 |
| FABP5 | Fatty acid binding protein 5 | 2.12 |
| KIF12 | Kinesin family member 12 | 2.12 |
| IKBKG | Inhibitor of kappa B | 2.09 |
| PDZRN3 | PDZ domain containing ring finger 3 | 2.09 |
| PHF19 | PHD finger protein 19 | 2.09 |
| MRPL24 | Mitochondrial ribosomal protein L24 | 2.07 |
| ARAP2 | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 | 2.04 |
| ITGF3 | ItgF3-like protein | 2.02 |
| POLA2 | Polymerase (DNA directed), alpha 2 | 2.02 |
| ADAMTS7 | ADAM metallopeptidase with thrombo- Spondin type 1 motif 7 | 1.45 |
Table 3 Genes upregulated by MYC in PICM-19-CSCs
| Gene ID | Gene abbreviation | Function | log2 ratio |
| CH242-278B18.2 | GNAS Complex, porcine-specific | Unknown | 10.25 |
| NFKB1 | Nuclear factor κB | Inflammation | 8.94 |
| SEMA3F | Semaphorin 3F | Cell signaling | 8.27 |
| NME1-NME2 | NME1-NME2 read-through | Inflammation | 8.22 |
| SERPINA1 | Serpin protease inhibitor, clade A1 | Inflammation | 8.17 |
| VLDLR | Very low density lipoprotein receptor | Metabolism | 8.01 |
| APOE | Apolipoprotein E | Metabolism | 7.57 |
| ITGA3 | Integrin, alpha 3 | Migration, Cell adhesion, Invasion | 7.41 |
| IGF2BP2 | Insulin-like growth factor 2 mRNA binding protein 2 | Gene regulation | 7.33 |
| MT-ATP6 | Mitochondrial ATP synthase 6 | Metabolism | 7.21 |
| HIF1A | Hypoxia-inducible factor 1α | Angiogenesis | 7.12 |
| APOA1 | Apolipoprotein A1 | Metabolism | 7.06 |
| ITGB7 | Integrin, beta 7 | Cell adhesion | 7.03 |
| NKAIN1 | Na+/K+ transporting ATPase | Ion transport | 7.00 |
| FGG | Fibrinogen gamma chain | Cell adhesion | 6.79 |
| CTSB | Cathepsin B | Carcinogenesis | 6.74 |
| NTN1 | Netrin 1 | Inflammation | 6.65 |
| JUP | Junction plakoglobin | Cell adhesion | 6.61 |
| PLG | Plasminogen | Cell proliferation | 6.60 |
| MT-ND2 | Mitochondrial NADH dehydrogenase 2 | Metabolism | 6.37 |
| SERPINA3-2 | Serpin protease inhibitor, clade A3-2 | Inflammation | 6.31 |
| RBP4 | Retinol binding protein 4 | Metabolism | 6.18 |
| FTL | Ferritin, light polypeptide | Iron metabolism | 6.08 |
| DUSP4 | Dual specificity phosphatase 4 | Cell proliferation | 6.02 |
| MT-CO1 | Mitochondrial cytochrome c oxidase I | Inflammation | 6.00 |
Table 4 Genes downregulated by MYC in PICM-19-CSCs
| Gene ID | Gene abbreviation | Function | log2 ratio |
| ASPN | Asporin | Extracellular matrix | 8.20 |
| IGF1 | Insulin-like growth factor 1 | Cell growth | 7.44 |
| OGN | Osteoglycin | Metabolism | 6.52 |
| GPM6B | Glycoprotein M6B | Membrane trafficking, cell-to-cell communication | 6.23 |
| ISLR | Immunoglobulin superfamily containing leucine-rich repeat | Unknown | 6.19 |
| ANGPT1 | Angiopoietin 1 | Angiogenesis | 5.53 |
| WDR66 | WD repeat domain 66 | EMT modulator | 5.49 |
| RSPO2 | R-spondin 2 homolog | Wnt modulator | 5.46 |
| COL6A2 | Collagen, type VI, alpha 2 | Fibrosis | 5.14 |
| TNR | Tenascin R | Extracellular matrix | 5.03 |
| FAM5C | Family with sequence similarity 5, member C | Unknown | 4.97 |
| FIGF | c-Fos iduced growth factor | Angiogenesis | 4.92 |
| ADAM23 | ADAM metallopeptidase domain 23 | Metabolism | 4.84 |
| MAB21L2 | Mab-21-like 2 | Cell survival | 4.83 |
| PDE1A | Phosphodiesterase 1A | Metabolism, Apoptosis | 4.83 |
| CLMP | CXADR-like membrane protein | Cell adhesion | 4.74 |
| COL28A1 | Collagen, type XXVIII, alpha 1 | Fibrosis | 4.74 |
| GJA1 | Gap junction protein, alpha 1 | Oxidative stress | 4.67 |
| SELENBP1 | Selenium binding protein 1 | Tumor suppressor | 4.58 |
| CPED1 | Cadherin-like and PC-esterase domain containing 1 | Unknown | 4.52 |
| COL5A3 | Collagen, type V, alpha 3 | Fibrosis | 4.51 |
| ADAMTS2 | ADAM metallopeptidase with thrombospondin typ1 motif 2 | Metabolism | 4.50 |
| PDE8B | Phosphodiesterase 8B | Metabolism | 4.47 |
| SGCE | Sarcoglycan, epsilon | Cytoskeleton | 4.42 |
| GDPD2 | Glycerophosphodiester phosphodiesterase domain containing 2 | Cell growth | 4.00 |
Table 5 Genes expressed by both PICM-19 and PICM-19-CSCs that were not affected by MYC overexpression
| Gene ID | Gene abbreviation | Function | Fold Δ1 |
| SSC-MIR-425 | MicroRNA mir-425 | Gene regulation | 7925.28 |
| SNORD53 | Small nucleolar RNA, C/D box 53 | Gene regulation | 4969.50 |
| SSC-MIR-378-1 | MicroRNA mir-378-1 | Gene regulation | 3962.64 |
| SSC-MIR-99A | MicroRNA mir-99a | Gene regulation | 3761.27 |
| SSC-MIR-101-2 | MicroRNA mir-101-2 | Gene regulation | 3400.56 |
| SSC-LET-7F-2 | MicroRNA let-7f-2 | Gene regulation | 2814.68 |
| 5s rRNA | 5S ribosomal RNA | Protein synthesis | 2255.63 |
| SSC-MIR-210 | MicroRNA mir-210 | Gene regulation | 1730.53 |
| U6 | Small nucleolar RNA U6 | RNA interference | 1187.43 |
| SSC-MIR-196A-2 | MicroRNA mir-196a-2 | Gene regulation | 1127.81 |
| SCARNA15 | Small Cajal body-specific RNA 15 | Gene regulation | 287.24 |
| SNORA72 | Small nucleolar RNA, H/ACA box 72 | Gene regulation | 255.25 |
| SCARNA11 | Small Cajal body-specific RNA 11 | Gene regulation | 163.50 |
| RAMP2 | Receptor (G protein-coupled) activity modifying protein 2 | Protein transport | 56.66 |
| CCNI2 | Cyclin I family member 2 | Cell cycle | 10.67 |
| P4HTM | Prolyl 4-hydroxylase, transmembrane | Hypoxia | 6.25 |
| SPDYA | Speedy/RINGO cell cycle regulator family member A | Cell cycle | 5.56 |
| PARK2 | Parkin RBR E3 ubiquitin ligase | Unknown | 5.09 |
| GRPR | Gastrin-releasing peptide receptor | Cell proliferation | 4.52 |
| ATG10 | Autophagy related 10 | Autophagy | 3.76 |
| PHYHIP | Phytanoyl-CoA hydroxylase interacting protein | Cell proliferation | 3.41 |
| DPEP1 | Dipeptidase 1 | Metabolism | 2.72 |
| DUROC-C2 | Nuclear receptor corepressor 2 | DNA binding | 2.64 |
| HIST1H2BH | Histone cluster 1, H2bh | Histone modification | 2.58 |
| PHKG1 | Phosphorylase kinase, gamma 1 | Glycogenolysis | 2.52 |
| TMEM79 | Transmembrane protein 79 | Protein secretion | 2.04 |
| APH1B | APH1B gamma secretase subunit | Protein transport | 2.01 |
| IRAK4 | Interleukin-1 receptor-associated kinase 4 | Cell signaling | 2.01 |
Table 6 Procine-specific primers used in real-time polymerase chain reaction
| Gene | Gene ID | GenBank# | Primer sequences | Product size (bp) |
| CTSB | 100370961 | NM_001097458.1 | F: AGCCTGGAACTTCTGGACAA | 190 |
| R: TTTGTAGGACGGGGTGTAGC | ||||
| HIF-1A α-subunit | 396696 | NM_001123124.1 | F: GCCAGAACCTCCTGTAACCA | 204 |
| R: CCTTTTCCTGCTCTGTTTGG | ||||
| SERPINA3-2 | 396686 | NM_213787.1 | F: TGAAAGTTTCCCAGGTGGTC | 200 |
| R: CTAGGGCTTGGTGACTTTGC | ||||
| ITGA3 | 100517053 | XM_005668879.1 | F: CTTCAAACGGAACCAGAGGA | 203 |
| R: AGAAGCTTTGTAGCCGGTGA | ||||
| SELENBP1 | 100152724 | XM_001929643.3 | F: GGTACCAGCCTCGACACAAT | 203 |
| R: GTTGTGCAGGAATCGGATCT | ||||
| RSPO2 | 100154008 | NM_001293141.1 | F: GTCCAGATGGTTTTGCACCT | 202 |
| R: CTCCTGGATTCAGCAATGGT | ||||
| FIGF | 100155670 | XM_001928382.3 | F: TCCCCAACCCTGTCATTTTA | 202 |
| R: TCCTTCTCCATTCCTTGGTG | ||||
| ANGPT1 | 397009 | NM_213959.1 | F: GGGGGAGGTTGGACTGTAAT | 203 |
| R: TGTGAATAGGCTCGGTTTCC | ||||
| CDO1 | 100312964 | NM_001167643.1 | F: TCTGAAGATGCTGCAAGGAA | 208 |
| R: CGTATCGAAGGGTGGACTGT | ||||
| DKK2 | 100519672 | XM_003129269.2 | F: CTGGTACCCGCTGCAATAAT | 198 |
| R: GACAGGGATCTCCTTCATGC | ||||
| β-actin | 45269029 | AY550069.1 | F: GGACCTGACCGACTACCTCA | 180 |
| R: GGCAGCTCGTAGCTCTTCTC |
- Citation: Aravalli RN, Talbot NC, Steer CJ. Gene expression profiling of MYC-driven tumor signatures in porcine liver stem cells by transcriptome sequencing. World J Gastroenterol 2015; 21(7): 2011-2029
- URL: https://www.wjgnet.com/1007-9327/full/v21/i7/2011.htm
- DOI: https://dx.doi.org/10.3748/wjg.v21.i7.2011