BPG is committed to discovery and dissemination of knowledge
Clinical Trials Study
Copyright ©The Author(s) 2015.
World J Gastroenterol. Jul 21, 2015; 21(27): 8398-8407
Published online Jul 21, 2015. doi: 10.3748/wjg.v21.i27.8398
Table 1 Risk level access of gastrointestinal stromal tumor
Risk levelTumor size (cm)Mitotic count (50/HPF)Primary tumor location
Very low ≤ 2.0 ≤ 5Any
Low2.1-5.0 ≤ 5Any
Medium2.1-5.0> 5Stomach
< 5.06-10Any
5.1-10.0 ≤ 5Stomach
HighAnyAnyTumor rupture
> 10.0AnyAny
Any> 10Any
> 5.0> 5Any
2.1-5.0> 5Non stomach
5.1-10.0 ≤ 5Non stomach
Table 2 Quantitative real-time PCR primer for candidate genes and endogenous reference gene
Gene namePrimerSequence (5'-3')Tm (°C)Amplicon size (bp)
SLITRK3ForwardTTCCATAGCTGAGATGCTTCACA61.487
ReverseGGAATCGGGGTAGTCCATCC61.2
18SForwardGTAACCCGTTGAACCCCATT60.4151
ReverseCCATCCAATCGGTAGTAGCG61.7
Table 3 Patient and tumor characteristics
Clinicopathological factorsn (%)
GenderMale226 (54.2)
Female191 (45.8)
Age (yr) ≤ 60223 (53.5)
> 60194 (46.5)
Median60
Gastrointestinal bleedingNo315 (75.5)
Yes102 (24.5)
Primary tumor siteStomach229 (54.9)
Small bowel123 (29.5)
Colon21 (5.0)
Others44 (10.6)
Predominant cell typeSpindle271 (65.0)
Epithelioid54 (12.9)
Mixed92 (22.1)
Primary tumor size (cm)0-5202 (48.4)
5.1-10138 (33.1)
> 1077 (18.5)
Median5.5
Mitotic index (per 50 HPFs)0-5309 (74.1)
6-1060 (14.4)
> 1048 (11.5)
NIH stageVery low risk33 (7.9)
Low risk154 (36.5)
Intermediate risk67 (16.1)
High risk163 (39.1)
RecurrenceNo331 (79.4)
Yes71 (17.0)
Insufficient data15 (3.6)
Death from illnessNo376 (90.2)
Yes26 (6.2)
Insufficient data15 (3.6)
Table 4 Expression levels of SLITRK3 in gastrointestinal stromal tumor and adjacent non-tumor tissues n (%)
TissueSLITRK3 level
-++++++
Tumor14 (11)37 (28)49 (37)31 (24)
Non-tumor tissue91 (69)33 (25)5 (4)2 (2)
Table 5 Correlations between SLITRK3 expression and clinicopathological factors in 417 gastrointestinal stromal tumor patients
Clinicopathological factors1SLITRK3 expression
Number of patientsχ2P value2
LowHigh
GenderMale1001232240.0011.000
Female85104189
Age (yr) ≤ 60991212200.0001.000
> 6087106193
Gastrointestinal bleedingNo1531603137.7220.006
Yes3367100
Primary tumor siteStomach12010622624.730< 0.0013
Small bowel3488122
Colon14721
Others182644
Predominant cell typeSpindle1261442702.5520.279
Epithelioid262753
Mixed345690
Primary tumor size ≤ 5 cm1168319927.260< 0.0013
> 5 cm70144214
Mitotic index ≤ 5/50 HPF15714930618.763< 0.0013
> 5/50 HPF2978107
NIH stageVery low risk2833153.340< 0.0013
Low risk8767154
Intermediate risk254166
High risk46116162
Table 6 Univariate analysis of factors influencing overall survival in 402 patients with gastrointestinal stromal tumor
Factor5-yr OS rate (%)OS HR (95%CI)P value
GenderMale: Female81.3: 89.20.508 (0.221-1.169)0.111
Age (yr) ≤ 60: > 6088.9: 80.02.186 (0.989-4.832)0.053
Gastrointestinal bleedingNo: Yes86.8: 81.21.259 (0.559-2.837)0.578
Primary tumor siteGastric: Non-gastric83.0: 86.81.143 (0.529-2.470)0.733
Predominant cell typeSpindle: Epithelioid: Mixed87.7: 82.4: 88.80.935 (0.586-1.491)0.778
Primary tumor size (cm) ≤ 5: > 599.2: 74.022.726 (3.079-167.742)0.0021
Mitotic index (HPFs) ≤ 5/50: 6-10/50: > 10/5096.5: 83.0: 39.74.727 (2.887-7.740)< 0.0011
NIH stageVery low: Low: Mid: High100.0: 100.0: 88.6: 70.38.005 (2.365-27.098)0.0011
SLITRK3 expression(-): (+): (++): (+++)100.0: 99.0: 86.7: 57.44.164 (2.227-7.786)< 0.0011
Table 7 Univariate analysis of factors influencing disease-free survival in 402 patients with gastrointestinal stromal tumor
Factor5-yr DFS rate (%)DFS HR (95%CI)P value
GenderMale: Female69.0: 69.70.643 (0.398-1.038)0.071
Age (yr) ≤ 60: > 6072.1: 65.61.285 (0.806-2.049)0.292
Gastrointestinal bleedingNo: Yes71.6: 65.71.425 (0.874-2.322)0.155
Primary tumor siteGastric: Non-gastric81.5: 59.42.669 (1.623-4.388)0.0011
Predominant cell typeSpindle: Epithelioid: Mixed72.0: 67.1: 71.30.877 (0.661-1.164)0.365
Primary tumor size (cm) ≤ 5: > 592.2: 50.88.183 (3.921-17.079)< 0.0011
Mitotic index (HPFs) ≤ 5/50: 6-10/50: > 10/5084.2: 50.7: 19.03.289 (2.545-4.253)< 0.0011
NIH stageVery low: Low: Mid: High100.0: 93.3: 87.1: 40.05.421 (3.249-9.045)< 0.0011
SLITRK3 expression(-): (+): (++): (+++)91.7: 78.6: 71.6: 41.82.082 (1.575-2.753)< 0.0011
Table 8 Multivariate analysis of factors influencing disease-free survival in 402 patients with gastrointestinal stromal tumor
FactorModel A
Model B
Model C
DFS HR(95%CI)P valueDFS HR(95%CI)P valueDFS HR(95%CI)P value
Primary tumor siteGastric: Non-gastric1.762 (1.036-2.999)0.03712.046 (1.232-3.401)0.00621.593 (0.928-2.733)0.091
Primary tumor size (cm) ≤ 5: > 51.388 (0.567-3.398)0.4733.370 (1.545-7.351)0.00221.183 (0.477-2.934)0.717
Mitotic index (HPFs) ≤ 5/50: 6-10/50: > 10/502.027 (1.494-2.749)< 0.00122.549 (1.930-3.366)< 0.00122.032 (1.496-2.760)< 0.0012
NIH stageVery low: Low: Mid: High2.753 (1.426-5.314)0.00322.707 (1.387-5.283)0.0042
SLITRK3 expression(-): (+): (++): (+++)1.508 (1.151-1.976)0.00321.465 (1.114-1.928)0.0062