SLITRK3 expression correlation to gastrointestinal stromal tumor risk rating and prognosis

Table 1 Risk level access of gastrointestinal stromal tumor

Risk level	Tumor size (cm)	Mitotic count (50/HPF)	Primary tumor location
Very low	≤ 2.0	≤ 5	Any
Low	2.1-5.0	≤ 5	Any
Medium	2.1-5.0	> 5	Stomach
	< 5.0	6-10	Any
	5.1-10.0	≤ 5	Stomach
High	Any	Any	Tumor rupture
	> 10.0	Any	Any
	Any	> 10	Any
	> 5.0	> 5	Any
	2.1-5.0	> 5	Non stomach
	5.1-10.0	≤ 5	Non stomach

Table 2 Quantitative real-time PCR primer for candidate genes and endogenous reference gene

Gene name	Primer	Sequence (5'-3')	Tm (°C)	Amplicon size (bp)
SLITRK3	Forward	TTCCATAGCTGAGATGCTTCACA	61.4	87
	Reverse	GGAATCGGGGTAGTCCATCC	61.2
18S	Forward	GTAACCCGTTGAACCCCATT	60.4	151
	Reverse	CCATCCAATCGGTAGTAGCG	61.7

Table 3 Patient and tumor characteristics

Clinicopathological factors		n (%)
Gender	Male	226 (54.2)
	Female	191 (45.8)
Age (yr)	≤ 60	223 (53.5)
	> 60	194 (46.5)
	Median	60
Gastrointestinal bleeding	No	315 (75.5)
	Yes	102 (24.5)
Primary tumor site	Stomach	229 (54.9)
	Small bowel	123 (29.5)
	Colon	21 (5.0)
	Others	44 (10.6)
Predominant cell type	Spindle	271 (65.0)
	Epithelioid	54 (12.9)
	Mixed	92 (22.1)
Primary tumor size (cm)	0-5	202 (48.4)
	5.1-10	138 (33.1)
	> 10	77 (18.5)
	Median	5.5
Mitotic index (per 50 HPFs)	0-5	309 (74.1)
	6-10	60 (14.4)
	> 10	48 (11.5)
NIH stage	Very low risk	33 (7.9)
	Low risk	154 (36.5)
	Intermediate risk	67 (16.1)
	High risk	163 (39.1)
Recurrence	No	331 (79.4)
	Yes	71 (17.0)
	Insufficient data	15 (3.6)
Death from illness	No	376 (90.2)
	Yes	26 (6.2)
	Insufficient data	15 (3.6)

Table 4 Expression levels of SLITRK3 in gastrointestinal stromal tumor and adjacent non-tumor tissues n (%)

Tissue	SLITRK3 level
	-	+	++	+++
Tumor	14 (11)	37 (28)	49 (37)	31 (24)
Non-tumor tissue	91 (69)	33 (25)	5 (4)	2 (2)

Table 5 Correlations between SLITRK3 expression and clinicopathological factors in 417 gastrointestinal stromal tumor patients

Clinicopathological factors1		SLITRK3 expression		Number of patients	χ2	P value2
		Low	High
Gender	Male	100	123	224	0.001	1.000
	Female	85	104	189
Age (yr)	≤ 60	99	121	220	0.000	1.000
	> 60	87	106	193
Gastrointestinal bleeding	No	153	160	313	7.722	0.006
	Yes	33	67	100
Primary tumor site	Stomach	120	106	226	24.730	< 0.0013
	Small bowel	34	88	122
	Colon	14	7	21
	Others	18	26	44
Predominant cell type	Spindle	126	144	270	2.552	0.279
	Epithelioid	26	27	53
	Mixed	34	56	90
Primary tumor size	≤ 5 cm	116	83	199	27.260	< 0.0013
	> 5 cm	70	144	214
Mitotic index	≤ 5/50 HPF	157	149	306	18.763	< 0.0013
	> 5/50 HPF	29	78	107
NIH stage	Very low risk	28	3	31	53.340	< 0.0013
	Low risk	87	67	154
	Intermediate risk	25	41	66
	High risk	46	116	162

¹Cases with missing data were not included for analysis;

²P-value by χ² test;

³Statistically significant (P < 0.01).

Table 6 Univariate analysis of factors influencing overall survival in 402 patients with gastrointestinal stromal tumor

Factor		5-yr OS rate (%)	OS HR (95%CI)	P value
Gender	Male: Female	81.3: 89.2	0.508 (0.221-1.169)	0.111
Age (yr)	≤ 60: > 60	88.9: 80.0	2.186 (0.989-4.832)	0.053
Gastrointestinal bleeding	No: Yes	86.8: 81.2	1.259 (0.559-2.837)	0.578
Primary tumor site	Gastric: Non-gastric	83.0: 86.8	1.143 (0.529-2.470)	0.733
Predominant cell type	Spindle: Epithelioid: Mixed	87.7: 82.4: 88.8	0.935 (0.586-1.491)	0.778
Primary tumor size (cm)	≤ 5: > 5	99.2: 74.0	22.726 (3.079-167.742)	0.0021
Mitotic index (HPFs)	≤ 5/50: 6-10/50: > 10/50	96.5: 83.0: 39.7	4.727 (2.887-7.740)	< 0.0011
NIH stage	Very low: Low: Mid: High	100.0: 100.0: 88.6: 70.3	8.005 (2.365-27.098)	0.0011
SLITRK3 expression	(-): (+): (++): (+++)	100.0: 99.0: 86.7: 57.4	4.164 (2.227-7.786)	< 0.0011

¹Statistically significant (P < 0.01). Mid: Intermediate.

Table 7 Univariate analysis of factors influencing disease-free survival in 402 patients with gastrointestinal stromal tumor

Factor		5-yr DFS rate (%)	DFS HR (95%CI)	P value
Gender	Male: Female	69.0: 69.7	0.643 (0.398-1.038)	0.071
Age (yr)	≤ 60: > 60	72.1: 65.6	1.285 (0.806-2.049)	0.292
Gastrointestinal bleeding	No: Yes	71.6: 65.7	1.425 (0.874-2.322)	0.155
Primary tumor site	Gastric: Non-gastric	81.5: 59.4	2.669 (1.623-4.388)	0.0011
Predominant cell type	Spindle: Epithelioid: Mixed	72.0: 67.1: 71.3	0.877 (0.661-1.164)	0.365
Primary tumor size (cm)	≤ 5: > 5	92.2: 50.8	8.183 (3.921-17.079)	< 0.0011
Mitotic index (HPFs)	≤ 5/50: 6-10/50: > 10/50	84.2: 50.7: 19.0	3.289 (2.545-4.253)	< 0.0011
NIH stage	Very low: Low: Mid: High	100.0: 93.3: 87.1: 40.0	5.421 (3.249-9.045)	< 0.0011
SLITRK3 expression	(-): (+): (++): (+++)	91.7: 78.6: 71.6: 41.8	2.082 (1.575-2.753)	< 0.0011

¹Statistically significant (P < 0.01). Mid: Intermediate; DFS: Disease-free survival.

Table 8 Multivariate analysis of factors influencing disease-free survival in 402 patients with gastrointestinal stromal tumor

Factor		Model A		Model B		Model C
		DFS HR(95%CI)	P value	DFS HR(95%CI)	P value	DFS HR(95%CI)	P value
Primary tumor site	Gastric: Non-gastric	1.762 (1.036-2.999)	0.0371	2.046 (1.232-3.401)	0.0062	1.593 (0.928-2.733)	0.091
Primary tumor size (cm)	≤ 5: > 5	1.388 (0.567-3.398)	0.473	3.370 (1.545-7.351)	0.0022	1.183 (0.477-2.934)	0.717
Mitotic index (HPFs)	≤ 5/50: 6-10/50: > 10/50	2.027 (1.494-2.749)	< 0.0012	2.549 (1.930-3.366)	< 0.0012	2.032 (1.496-2.760)	< 0.0012
NIH stage	Very low: Low: Mid: High	2.753 (1.426-5.314)	0.0032			2.707 (1.387-5.283)	0.0042
SLITRK3 expression	(-): (+): (++): (+++)			1.508 (1.151-1.976)	0.0032	1.465 (1.114-1.928)	0.0062

¹Statistically significant (P < 0.05);

²Statistically significant (P < 0.01). Model A includes analysis of NIH stage without SLITRK3; model B includes SLITRK3 without NIH stage; model C includes both of them. Mid = intermediate.