©2013 Baishideng Publishing Group Co.
World J Gastroenterol. Feb 21, 2013; 19(7): 1056-1067
Published online Feb 21, 2013. doi: 10.3748/wjg.v19.i7.1056
Published online Feb 21, 2013. doi: 10.3748/wjg.v19.i7.1056
Table 1 Primers used to study Helicobacter pylori and Pseudomonas fluorescens isolates
| Target gene | Primer name | Primer sequence (5’-3’) | PCR condition (number of cycles, size of product) |
| 16S rRNA | 16S F | TTGGAGAGTTTGATCCTGGCC | 94 °C, 30 s; 59 °C, 30 s; 72 °C, 30 s (30, 1155 bp) |
| 16S R | ACGTCATCCCACCTTCTC | ||
| HSP60 | |||
| Primary | HSP1 | AAGGCATGCAATTTGATAGAGGCT | 94 °C, 30 s; 56 °C, 30 s; 72 °C, 30 s (35, 594 bp) |
| HSP2 | CTTTTTTCTCTTTCATTTCCACTT | ||
| Nested | HSPN1 | TTGATAGAGGCTACCTCTCC | 94 °C, 30 s; 56 °C, 30 s; 72 °C, 30 s (35, 501 bp) |
| HSPN2 | TGTCATAATCGCTTGTCGTGC | ||
| Putative membrane-bound protein (PFMP) | |||
| Primary | PFMPF | TCTKRYCRMGAATCRARACWRYC | 94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min (35, 704 bp) |
| PFMPR | GKTWYTGCKCRWWKCSYTSMMC | ||
| Nested | PFMPNF | TGCGYWMMWCCYWRWCCWTGA | 94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min (35, 613 bp) |
| PFMPNR | AKCABGGTSCWGCMVRCCRBGC | ||
| mupV | |||
| Primary | mupVF | TGAGTTCGATGTGACCTGCCTG | 94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min (35 cycles, 722 bp) |
| mupVR | AACTCGCCAGATTGTCGTACAC | ||
| Nested | mupVnF | CAGCATTATCCTGCCACTGAC | 94 °C, 1 min; 55 °C, 1 min; 72 °C, 1 min (35, 611 bp) |
| mupVnR | ATGATGTCCTGGCACACCTGATC |
Table 2 Comparative isolation rates and prevalence of Helicobacter pylori and Pseudomonas fluorescens against rapid urease test in antral biopsies by nested polymerase chain reaction targeting HSP60 gene and membrane bound protein n (%)
| Diseases | Antral biopsies | RUT, positivity | H. pylori HSP60, positivity | P value1 | P. fluorescens putative outer membrane protein, positivity | P value2 | Isolation of different types of bacteria, positivity | P value3 | |
| Group A | Group B | ||||||||
| PUD | 65 | 51 (78.5) | 59 (90.8) | < 0.001 | 63 (96.9) | < 0.010 | 61 (93.8) | 23 (35.4) | < 0.001 |
| NUD | 123 | 92 (74.8) | 109 (88.6) | < 0.001 | 121 (98.4) | < 0.001 | 119 (96.7) | 39 (31.7) | < 0.001 |
| CA | 49 | 23 (46.9) | 24 (48.9) | < 0.050 | 46 (93.9) | < 0.001 | 43 (87.5) | 12 (24.5) | < 0.001 |
| Normal | 21 | 13 (61.9) | 19 (90.4) | < 0.001 | 20 (95.2) | 0.001 | 17 (80.9) | 6 (28.6) | < 0.001 |
| Total | 258 | 179 (69.4) | 211 (81.8) | < 0.001 | 250 (96.9) | < 0.001 | 240 (93.0) | 80 (31.0) | < 0.001 |
-
Citation: Patel SK, Pratap CB, Verma AK, Jain AK, Dixit VK, Nath G.
Pseudomonas fluorescens -like bacteria from the stomach: A microbiological and molecular study. World J Gastroenterol 2013; 19(7): 1056-1067 - URL: https://www.wjgnet.com/1007-9327/full/v19/i7/1056.htm
- DOI: https://dx.doi.org/10.3748/wjg.v19.i7.1056
