©2012 Baishideng Publishing Group Co.
World J Gastroenterol. May 7, 2012; 18(17): 2105-2111
Published online May 7, 2012. doi: 10.3748/wjg.v18.i17.2105
Published online May 7, 2012. doi: 10.3748/wjg.v18.i17.2105
Table 1 Primers used for polymerase chain reaction analysis of voculating cytotoxin gene A and cytotoxin associated gene A
| Region | Primer | Sequence (5'-3') | Size and location of PCR product |
| s1a | vacA s1a-F | CTC TCG CTT TAG TAG GAG C | 213 bp |
| VA1-R | CTG CTT GAA TGC GCC AAA C | (843-1055) | |
| s1b | SS3-F | AGC GCC ATA CCG CAA GAG | 187 bp |
| VA1-R | CTG CTT GAA TGC GCC AAA C | (869-1055) | |
| s1c | vacA s1c-F | CTC TCG CTT TAG TGG GGY T | 213 bp |
| VA1-R | CTG CTT GAA TGC GCC AAA C | (843-1055) | |
| s2 | SS2-F | GCT AAC ACG CCA AAT GAT CC | 199 bp |
| VA1-R | CTG CTT GAA TGC GCC AAA C | (433-631) | |
| m1a | VA3-F | GGT CAA AAT GCG GTC ATG G | 290 bp |
| VA3-R | CCA TTG GTA CCT GTA GAA AC | (2741-3030) | |
| m1b | VAm-F3 | GGC CCC AAT GCA GTC ATG GA | 291 bp |
| VAm-R3 | GCT GTT AGT GCC TAA AGA AGC AT | (2741-3031) | |
| m2 | VA4-F | GGA GCC CCA GGA AAC ATT G | 352 bp |
| VA4-R | CAT AAC TAG CGC CTT GCA | (976-1327) | |
| cagA | cagA-U | GGA ATA CCA AAA ACG CAA AAA CCA | 300 bp |
| cagA-L | CCC CAC AAT ACA CCA GCA AAA CT | ||
| ureC (glmM) | GlmM1-R | GCTTACTTTCTAACACTAACGCGC | 296 bp |
| GlmM1-F | GGATAAGCTTTTAGGGGTGTTAGGGG |
Table 2 The frequency of cytotoxin associated gene A and voculating cytotoxin gene A genotypes in gastric biopsy, saliva and stool samples
| cagA n (%) | vacA n (%) | ||||||||||||
| s1a/m1a | s1a/m1b | s1a/m2 | s1b/m1a | s1b/m1b | s1b/m2 | s1c/m1a | s1c/m1b | s1c/m2 | s2/m1a | s2/m1b | s2/m2 | ||
| Gastric biopsy | 220 (94.42) | 36 (15.45) | 9 (3.86) | 60 (25.75) | 7 (3) | 5 (2.14) | 13 (5.57) | 17 (7.29) | 5 (2.14) | 39 (16.73) | 12 (5.15) | 0 | 30 (12.87) |
| Saliva | 25 (100) | 5 (20) | - | 18 (72) | - | - | - | - | - | - | - | - | 2 (8) |
| Stool | 162 (97) | 14 (8) | 2 (1.19) | 120 (71.85) | 2 (1.19) | - | 2 (1.19) | 3 (1.79) | - | 3 (1.79) | - | - | 22 (13.17) |
Table 3 The list of patients with incompatible Helicobacter pylori voculating cytotoxin gene A genotypes
| Patient number | Gastric biopsy strain | Saliva strain | Stool strain |
| 1 | s1a/m1a | s1a/m2 | s2/m2 |
| 2 | s1a/m1a | s1a/m2 | - |
| 3 | s2/m1a | s1a/m2 | - |
| 4 | s1c/m2 | s1a/m2 | s1c/m2 |
| 5 | s2/m2 | s1a/m2 | - |
| 6 | s2/m2 | s1a/m2 | s2/m2 |
| 7 | s1a/m1a | s1a/m1a | s2/m2 |
| 8 | s1a/m2 | s1a/m2 | s2/m2 |
| 9 | s1a/m2 | - | s1a/m1a |
| 10 | s1a/m1b | - | s1b/m2 |
| 11 | s2/m2 | s2/m2 | s1a/m2 |
| 12 | s2/m2 | - | s1a/m2 |
| 13 | s2/m2 | - | s1a/m2 |
| 14 | s1a/m2 | s1a/m2 | s1a/m1a |
| 15 | s2/m2 | - | s1c/m2 |
| 16 | s2/m1a | - | s2/m2 |
Table 4 Summary of studies which analysed Helicobacter pylori status in different oral cavity, stool and gastric sample
| Author name | Country | Target population | Number of sample | Type of specimens | Method | Positive rate % |
| Cześnikiewicz-Guzik et al[16] | Poland | Gastrointensinal patients | 100 | Gastic biopsy, saliva and gingival plaques | ELISA | 51 biopsy 54 saliva and 48.3 gingival pockets |
| Medina et al[3] | Argentina | Gastroduodenal patients | 98 | Saliva, dental plaque and gastric biopsy | PCR | 88.4 biopsy and 18.98 oral samples |
| Iamaroon et al[7] | Thailand | Recurrent auphtus ulcer patients and healthy volunteers | 22 patients/15 normal people | Mocusa | Nested PCR | 4.5 auphtus patients and 4.5 normal patients |
| Tanahashi et al[37] | Northern California | Gastric patients | 16 infected 10 uninfected | Stool, saliva and vomits | PCR and culture | 18.8 saliva, 21.8 stool and 37.5 vomits |
| Silva et al[6] | Brazil | Gastric patients | 30 | Gastric biopsy, saliva and dental plaque | Single step and nested PCR | 80 gastric biopsy, 30 saliva and 20 dental plaque |
| Fernández-Tilapa et al[5] | Mexico | Adults without dyspepsia | 200 | Gastric biopsy, saliva and dental plaque | Nested and semi nested PCR, ELISA | 62 biopsy and 17 oral samples |
| Wang et al[8] | Tennessee | Gastric patients | 31 | Gastric biopsy and saliva | PCR and DNA sequencing | 100 gastric biopsy and 71 saliva |
| Current study | Iran | Gastroduodenal patients | 300 | Gastric biopsy, saliva, dental plaque and stool | PCR | 77.66 biopsy, 10.72 saliva, 0 dental plaque and 71.67 stool |
-
Citation: Momtaz H, Souod N, Dabiri H, Sarshar M. Study of
Helicobacter pylori genotype status in saliva, dental plaques, stool and gastric biopsy samples. World J Gastroenterol 2012; 18(17): 2105-2111 - URL: https://www.wjgnet.com/1007-9327/full/v18/i17/2105.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i17.2105
