Copyright
©2012 Baishideng Publishing Group Co.
World J Gastroenterol. Apr 21, 2012; 18(15): 1745-1752
Published online Apr 21, 2012. doi: 10.3748/wjg.v18.i15.1745
Published online Apr 21, 2012. doi: 10.3748/wjg.v18.i15.1745
Table 1 Primer sequences of genes validating the microarray analysis by quantitative real-time polymerase chain reaction
Gene name | Sense primer | Antisense primer |
Wnt5a | AGGGCTCCTACGAGAGTGCT | GACACCCCATGGCACTTG |
Frizzled2 | TCTCTGAGGACGGTTATCGCA | CAGAATCACCCACCAGATGGA |
Calcium calmodulin mediated kinase IIdelta | TCGGCTCACACAGTACATGGA | CCCCGAACGATGAAAGTGAA |
α-1 type I collagen | ACAGACTGGCAACCTCAAGAAG | AAGCGTGCTGTAGGTGAATCG |
Connective tissue growth factor | GTTGGCGAACAAATGGCCTT | TGCCTCCCA AACCAGTCATAG |
Glyceraldehydes-3-phosphate dehydrogenase | TCCTGCACCACCAACTGCTTAG | AGTGGCAGTGATGGCATGGACT |
Table 2 Top 20 enriched Gene Ontology terms based on Gene Ontology classifications
Biological process | Count | Percent | Molecular function | Count | Percent | Cellular component | Count | Percent |
Response to wounding | 78 | 7.24 | Cytoskeletal protein binding | 73 | 6.78 | Extracellular region part | 125 | 11.61 |
Wound healing | 46 | 4.27 | Actin binding | 52 | 4.83 | Extracellular region | 180 | 16.71 |
Regulation of cell growth | 43 | 3.99 | Growth factor binding | 24 | 2.23 | Extracellular matrix | 69 | 6.41 |
Vasculature development | 50 | 4.64 | Glycosaminoglycan binding | 24 | 2.23 | Proteinaceous extracellular matrix | 61 | 5.66 |
Actin cytoskeleton organization | 42 | 3.90 | Calcium ion binding | 76 | 7.06 | Extracellular matrix part | 34 | 3.16 |
Actin filament-based process | 43 | 3.99 | Extracellular matrix structural constituent | 14 | 1.30 | Cytoskeleton | 125 | 11.61 |
Blood vessel development | 48 | 4.46 | Heparin binding | 19 | 1.76 | Basement membrane | 25 | 2.32 |
Cell migration | 51 | 4.73 | Polysaccharide binding | 24 | 2.23 | Extracellular space | 71 | 6.59 |
Cell adhesion | 72 | 6.69 | Pattern binding | 24 | 2.23 | Cell projection | 92 | 8.54 |
Biological adhesion | 72 | 6.69 | Insulin-like growth factor binding | 11 | 1.02 | Cytoskeletal part | 88 | 8.17 |
Regulation of growth | 55 | 5.11 | Integrin binding | 12 | 1.11 | Cell surface | 53 | 4.92 |
Regulation of cellular component size | 46 | 4.27 | Carbohydrate binding | 39 | 3.62 | Actin cytoskeleton | 39 | 3.62 |
Extracellular matrix organization | 27 | 2.51 | Chemokine activity | 10 | 0.93 | Actin filament bundle | 14 | 1.30 |
Regulation of cell proliferation | 87 | 8.08 | Chemokine receptor binding | 10 | 0.93 | Plasma membrane | 216 | 20.06 |
Cytoskeleton organization | 54 | 5.01 | Protein complex binding | 29 | 2.69 | Collagen | 12 | 1.11 |
Response to organic substance | 109 | 10.1 | Identical protein binding | 57 | 5.29 | Actomyosin | 14 | 1.30 |
Response to hormone stimulus | 72 | 6.69 | Collagen binding | 8 | 0.74 | Stress fiber | 13 | 1.21 |
Response to endogenous stimulus | 77 | 7.15 | Growth factor activity | 20 | 1.86 | Microtubule cytoskeleton | 53 | 4.92 |
Cell motion | 62 | 5.76 | Platelet-derived growth factor binding | 5 | 0.46 | Cell leading edge | 26 | 2.41 |
Blood vessel morphogenesis | 38 | 3.52 | Phospholipid binding | 20 | 1.86 | Vesicle lumen | 15 | 1.39 |
Table 3 Signaling pathway related to activation of hepatic stellate cells
Terms | Count | Percent | P value | Fold enrichment | Benjamini |
rno04510: Focal adhesion | 51 | 4.73 | 6.34E-19 | 4.16 | 9.90E-17 |
rno04512: Extracellular matrix-receptor interaction | 27 | 2.50 | 9.93E-13 | 5.30 | 7.75E-11 |
rno04810: Regulation of actin cytoskeleton | 36 | 3.34 | 5.18E-08 | 2.74 | 2.69E-06 |
rno05200: Pathways in cancer | 40 | 3.71 | 2.74E-05 | 2.00 | 0.001066 |
rno05414: Dilated cardiomyopathy | 18 | 1.67 | 3.27E-05 | 3.18 | 0.00102 |
rno05410: Hypertrophic cardiomyopathy | 17 | 1.57 | 5.01E-05 | 3.22 | 0.001302 |
rno04350: Transforming growth factor-beta signaling pathway | 17 | 1.57 | 6.76E-05 | 3.148 | 0.001505 |
rno04540: Gap junction | 15 | 1.39 | 4.27E-04 | 2.94 | 0.008302 |
rno04110: Cell cycle | 19 | 1.76 | 7.69E-04 | 2.40 | 0.013254 |
rno04666: Fc gamma R-mediated phagocytosis | 15 | 1.39 | 0.001011 | 2.71 | 0.015653 |
rno05222: Small cell lung cancer | 14 | 1.29 | 0.001758 | 2.68 | 0.024645 |
rno04062: Chemokine signaling pathway | 22 | 2.04 | 0.002121 | 2.04 | 0.027229 |
rno04115: p53 signaling pathway | 12 | 1.11 | 0.002359 | 2.89 | 0.027945 |
rno05211: Renal cell carcinoma | 12 | 1.11 | 0.003385 | 2.76 | 0.03708 |
rno04310: Wnt signaling pathway | 19 | 1.76 | 0.003846 | 2.08 | 0.039281 |
rno04670: Leukocyte transendothelial migration | 16 | 1.48 | 0.005063 | 2.21 | 0.048281 |
rno04010: MAPK signaling pathway | 28 | 2.59 | 0.008006 | 1.67 | 0.071107 |
rno05219: Bladder cancer | 7 | 0.64 | 0.022754 | 3.09 | 0.172201 |
rno04270: Vascular smooth muscle contraction | 14 | 1.29 | 0.0235 | 1.97 | 0.169299 |
rno05212: Pancreatic cancer | 10 | 0.92 | 0.027028 | 2.30 | 0.184168 |
- Citation: Xiong WJ, Hu LJ, Jian YC, Wang LJ, Jiang M, Li W, He Y. Wnt5a participates in hepatic stellate cell activation observed by gene expression profile and functional assays. World J Gastroenterol 2012; 18(15): 1745-1752
- URL: https://www.wjgnet.com/1007-9327/full/v18/i15/1745.htm
- DOI: https://dx.doi.org/10.3748/wjg.v18.i15.1745