Original Article
Copyright ©2011 Baishideng Publishing Group Co.
World J Gastroenterol. Sep 28, 2011; 17(36): 4090-4098
Published online Sep 28, 2011. doi: 10.3748/wjg.v17.i36.4090
Table 1 Design of small interfering RNA sequences for high-mobility group box 1
Plasmid constructsTarget sequence in mRNA(5’-3’)
HMGB1-1 (shRNAH1)GCAAATGACTCAATCTGATT
HMGB1-2 (shRNAH2)AATAGGAAAAGGATATTGCT
HMGB1-3 (shRNAH3)ACCCGGATGCTTCTGTCAAC
Table 2 Effect of high-mobility group box 1 siRNA on the cell cycle
Cell cycle phases(%)ShRNAH3 groupNC group
G0/G1 phase58.31% ± 0.48%a44.25% ± 0.63%
S phase29.12% ± 1.26%a41.32% ± 1.58%
G2/M phase 12.57% ± 1.04%14.53% ± 1.28%