©2011 Baishideng Publishing Group Co.
World J Gastroenterol. Sep 28, 2011; 17(36): 4090-4098
Published online Sep 28, 2011. doi: 10.3748/wjg.v17.i36.4090
Published online Sep 28, 2011. doi: 10.3748/wjg.v17.i36.4090
Table 1 Design of small interfering RNA sequences for high-mobility group box 1
| Plasmid constructs | Target sequence in mRNA(5’-3’) |
| HMGB1-1 (shRNAH1) | GCAAATGACTCAATCTGATT |
| HMGB1-2 (shRNAH2) | AATAGGAAAAGGATATTGCT |
| HMGB1-3 (shRNAH3) | ACCCGGATGCTTCTGTCAAC |
Table 2 Effect of high-mobility group box 1 siRNA on the cell cycle
| Cell cycle phases(%) | ShRNAH3 group | NC group |
| G0/G1 phase | 58.31% ± 0.48%a | 44.25% ± 0.63% |
| S phase | 29.12% ± 1.26%a | 41.32% ± 1.58% |
| G2/M phase | 12.57% ± 1.04% | 14.53% ± 1.28% |
- Citation: Ge WS, Wu JX, Fan JG, Wang YJ, Chen YW. Inhibition of high-mobility group box 1 expression by siRNA in rat hepatic stellate cells. World J Gastroenterol 2011; 17(36): 4090-4098
- URL: https://www.wjgnet.com/1007-9327/full/v17/i36/4090.htm
- DOI: https://dx.doi.org/10.3748/wjg.v17.i36.4090
