©2009 The WJG Press and Baishideng.
World J Gastroenterol. Mar 21, 2009; 15(11): 1381-1387
Published online Mar 21, 2009. doi: 10.3748/wjg.15.1381
Published online Mar 21, 2009. doi: 10.3748/wjg.15.1381
Table 1 Detail of the primers and cycling parameters
| p53 exons | Sequence (5’-3’) | Cycling parameters1 | PCR product (bp) |
| 5 | Sp5F: TGTTCACTTGTGCCCTGACT | 45 s denaturation at 94°C, 30 s annealing at 54°C, 1 min extension at 72°C | 266 |
| Sp5R: CAGCCCTGTCGTCTCTCCAG | |||
| 6 | Sp6F: GCCTCTGATTCCTCACTGAT | 45 s denaturation at 94°C, 30 s annealing at 53°C, 1 min extension at 72°C | 160 |
| Sp6R: TTAACCCCTCCTCCCAGAGA | |||
| 7 | Sp7F: ACTGGCCTCATCTTGGGCCT | 45 s denaturation at 94°C, 30 s annealing at 56°C, 1 min extension at 72°C | 180 |
| Sp7R: TGTGCAGGGTGGCAAGTGGC | |||
| 8 | Sp8F: TAAATGGGACAGGTAGGACC | 45 s denaturation at 94°C, 30 s annealing at 54°C, 1 min extension at 72°C | 230 |
| Sp8R: TCCACCGCTTCTTGTCCTGC |
Table 2 Relationship between p53 protein over-expression detected by IHC and p53 gene mutation detected by SSCP analysis of 103 gastric carcinomas n (%)
| IHC status | SSCP-negative | SSCP-positive | Total | P |
| IHC-negative | 62 (60) | 4 (4) | 66 (64) | 0.000 |
| IHC over-expression | 22 (21) | 15 (15) | 37 (36) | |
| Total | 84 (81) | 19 (19) | 103 (100) |
Table 3 Correlation between clinicopathological characteristics and p53 genetic alteration in patients with gastric adenocarcinoma
| Factors | p53 alteration | n (%) | P1 | |
| Negative (%) | Positive (%) | |||
| Age | ||||
| < 40 yr | 12 (14.29) | 1 (5.26) | 13 (12.62) | 0.533 |
| 40-65 yr | 55 (65.48) | 15 (78.95) | 70 (67.96) | |
| > 65 yr | 17 (20.23) | 3 (15.79) | 20 (19.42) | |
| Gender | 0.407 | |||
| Male | 62 (73.81) | 16 (84.21) | 78 (75.73) | |
| Female | 22 (26.19) | 3 (15.79) | 25 (24.27) | |
| Cell differentiation | 0.462 | |||
| Well | 9 (10.72) | 2 (10.53) | 11 (10.68) | |
| Moderately | 31 (36.90) | 8 (42.11) | 39 (37.86) | |
| Poorly | 44 (52.38) | 9 (47.37) | 53 (51.46) | |
| Histology | 0.522 | |||
| Intestinal | 35 (41.67) | 10 (52.63) | 45 (43.69) | |
| Diffused | 41 (48.81) | 8 (42.11) | 49 (47.57) | |
| Undiff/mixed | 8 (9.52) | 1 (5.26) | 9 (8.74) | |
| Site | 0.606 | |||
| Cardiac | 19 (22.62) | 2 (10.53) | 21 (20.39) | |
| Fundus | 14 (16.67) | 2 (10.53) | 16 (15.53) | |
| Body | 18 (21.43) | 5 (26.32) | 23 (22.33) | |
| Antrum | 33 (39.29) | 10 (52.63) | 43 (41.75) | |
| Stage | 0.813 | |||
| I | 26 (30.95) | 6 (31.58) | 32 (31.07) | |
| II | 32 (38.10) | 6 (31.58) | 38 (36.89) | |
| III | 21 (25.00) | 6 (31.58) | 27 (26.21) | |
| IV | 5 (5.95) | 1 (5.26) | 6 (5.83) | |
-
Citation: Karim S, Ali A. Correlation of p53 over-expression and alteration in
p53 gene detected by polymerase chain reaction-single strand conformation polymorphism in adenocarcinoma of gastric cancer patients from India. World J Gastroenterol 2009; 15(11): 1381-1387 - URL: https://www.wjgnet.com/1007-9327/full/v15/i11/1381.htm
- DOI: https://dx.doi.org/10.3748/wjg.15.1381
