Correlation of p53 over-expression and alteration in p53 gene detected by polymerase chain reaction-single strand conformation polymorphism in adenocarcinoma of gastric cancer patients from India

Table 1 Detail of the primers and cycling parameters

p53 exons	Sequence (5’-3’)	Cycling parameters1	PCR product (bp)
5	Sp5F: TGTTCACTTGTGCCCTGACT	45 s denaturation at 94°C, 30 s annealing at 54°C, 1 min extension at 72°C	266
	Sp5R: CAGCCCTGTCGTCTCTCCAG
6	Sp6F: GCCTCTGATTCCTCACTGAT	45 s denaturation at 94°C, 30 s annealing at 53°C, 1 min extension at 72°C	160
	Sp6R: TTAACCCCTCCTCCCAGAGA
7	Sp7F: ACTGGCCTCATCTTGGGCCT	45 s denaturation at 94°C, 30 s annealing at 56°C, 1 min extension at 72°C	180
	Sp7R: TGTGCAGGGTGGCAAGTGGC
8	Sp8F: TAAATGGGACAGGTAGGACC	45 s denaturation at 94°C, 30 s annealing at 54°C, 1 min extension at 72°C	230
	Sp8R: TCCACCGCTTCTTGTCCTGC

¹Initial denaturation of 10 min at 94°C and final extension of 10 min at 72°C were used in all amplifications. Number of cycles in all amplifications was 35.

Table 2 Relationship between p53 protein over-expression detected by IHC and p53 gene mutation detected by SSCP analysis of 103 gastric carcinomas n (%)

IHC status	SSCP-negative	SSCP-positive	Total	P
IHC-negative	62 (60)	4 (4)	66 (64)	0.000
IHC over-expression	22 (21)	15 (15)	37 (36)
Total	84 (81)	19 (19)	103 (100)

Table 3 Correlation between clinicopathological characteristics and p53 genetic alteration in patients with gastric adenocarcinoma

Factors	p53 alteration		n (%)	P1
	Negative (%)	Positive (%)
Age
< 40 yr	12 (14.29)	1 (5.26)	13 (12.62)	0.533
40-65 yr	55 (65.48)	15 (78.95)	70 (67.96)
> 65 yr	17 (20.23)	3 (15.79)	20 (19.42)
Gender				0.407
Male	62 (73.81)	16 (84.21)	78 (75.73)
Female	22 (26.19)	3 (15.79)	25 (24.27)
Cell differentiation				0.462
Well	9 (10.72)	2 (10.53)	11 (10.68)
Moderately	31 (36.90)	8 (42.11)	39 (37.86)
Poorly	44 (52.38)	9 (47.37)	53 (51.46)
Histology				0.522
Intestinal	35 (41.67)	10 (52.63)	45 (43.69)
Diffused	41 (48.81)	8 (42.11)	49 (47.57)
Undiff/mixed	8 (9.52)	1 (5.26)	9 (8.74)
Site				0.606
Cardiac	19 (22.62)	2 (10.53)	21 (20.39)
Fundus	14 (16.67)	2 (10.53)	16 (15.53)
Body	18 (21.43)	5 (26.32)	23 (22.33)
Antrum	33 (39.29)	10 (52.63)	43 (41.75)
Stage				0.813
I	26 (30.95)	6 (31.58)	32 (31.07)
II	32 (38.10)	6 (31.58)	38 (36.89)
III	21 (25.00)	6 (31.58)	27 (26.21)
IV	5 (5.95)	1 (5.26)	6 (5.83)

¹χ² test with Fisher’s test were used to test the frequency distribution of p53 alteration.

Undiff: Undifferentiated.