Copyright
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Feb 7, 2005; 11(5): 649-655
Published online Feb 7, 2005. doi: 10.3748/wjg.v11.i5.649
Published online Feb 7, 2005. doi: 10.3748/wjg.v11.i5.649
Table 1 Sequences of primers for mutagenesis reaction.
Primer | Direction | Length | Position (nt) | 5’-sequence-3’ |
A1762/G1764For | + | 34 | 1748-1781 | aggagattagttaaaggtctttgtactaggaggc |
1896/1899Rev | - | 20 | 1895-1876 | aaagccacccaaggcacagc |
A1896For | + | 31 | 1876-1906 | gctgtgccttgggtggctttagggcatggac |
A1899For | + | 34 | 1876-1909 | gctgtgccttgggtggctttgggacatggacatt |
A1896A1899For | + | 34 | 1876-1909 | gctgtgccttgggtggctttaggacatggacatt |
PS5For | + | 20 | 1260-1279 | gccgatccatactgcggaac |
PS4Rev | - | 20 | 2386-2405 | gagaccttcgtctgcgaggc |
Table 2 Mutation patterns of the 4 recombinant constructs.
Number | Recombinant constructs | Mutation pattern | |
A1896 | A1899 | ||
1 | pUC18-HBV1.2-WT | - | - |
2 | pUC18-HBV1.2-A1896 | + | - |
3 | pUC18-HBV1.2-A1899 | - | + |
4 | pUC18-HBV1.2-AA | + | + |
Table 3 HBsAg and HBV DNA secreted into cell culture medium with or without IFN (mean±SD).
Recombinants | HBsAg (A450) | HBV DNA (realtime PCR, log10) | ||
Without IFN | With IFN | Without IFN | With IFN | |
Puc18-HBV1.2-WT | 2.63±0.1c | 1.96±0.07c | 5.02±0.06ac | 4.86±0.07c |
Puc18-HBV1.2-A1896 | 1.43±0.05 | 1.46±0.07 | 4.43±0.09ac | 5.53±0.07c |
Puc18-HBV1.2-A1899 | 1.97±0.15 | 1.96±0.12 | 4.80±0.05 | 4.90±0.06 |
Puc18-HBV1.2-AA | 2.6±0.05 | 2.5±0.06 | 4.06±0.07ac | 4.46±0.05c |
-
Citation: Wang Y, Wei L, Jiang D, Cong X, Fei R, Xiao J, Wang Y.
In vitro resistance to interferon of hepatitis B virus with precore mutation. World J Gastroenterol 2005; 11(5): 649-655 - URL: https://www.wjgnet.com/1007-9327/full/v11/i5/649.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i5.649