©The Author(s) 2005.
World J Gastroenterol. Aug 28, 2005; 11(32): 5037-5043
Published online Aug 28, 2005. doi: 10.3748/wjg.v11.i32.5037
Published online Aug 28, 2005. doi: 10.3748/wjg.v11.i32.5037
Table 1 Clinical characteristics of two SARS patients
| P1 | P2 | |
| Age (yr) | 57 | 40 |
| Gender | Male | Female |
| Body temperature (°C) | 39.2 | 36.8 |
| White cell count (×109/L) | 13.3 | 4.67 |
| Neutrophil (×109/L) | 12.8 | 3.25 |
| Lymphocyte (×109/L) | 0.406 | 0.897 |
| CD3+ (/µL) | 359 | 791 |
| CD4+CD3+/CD3+ (%) | 86 | 58 |
| CD8+CD3+/CD3+ (%) | 13 | 36 |
| CD4+CD8+CD3+/CD3+ (%) | 4 | 2 |
| CD4+/CD8+ | 6.38 | 1.62 |
| Monocyte (×109/L) | 0.122 | 0.442 |
| Eosinophil (×109/L) | 0.004 | 0.033 |
| Basophil (×109/L) | 0.009 | 0.041 |
| Outcome | Death | Rehabilitation |
Table 2 Primer sequence used in real-time quantitative PCR analysis
| Accession number | Description | Forward primer (5’→3’) | Reverse primer (5’→3’) |
| NM_000634 | IL-8R α | GGAACTGGTGTCTTCAGGG | CATCTAATGTCAGATTCGGGG |
| NM_003855 | IL-18R1 | GGGTATTACTCCTGCGTGCA | CCATTTTCTTCCCCGAACATCC |
| BC025925 | GAPDH | GGTATCGTGGAAGGACTCATGAC | ATGCCAGTGAGCTTCCCGTTCAGC |
Table 3 Comparison of microarray and real-time quantitative PCR analysis on selected genes (mean±SD)
| Gene description | Techniques | P1 | P2 |
| IL-8R α | Microarray | 73.52 | – |
| Real-time qPCR | 11.63±0.15 | 0.37±0.09 | |
| IL-18R1 | Microarray | 42.33 | – |
| Real-time qPCR | 48.55±0.36 | 0.38±0.27 |
Table 4 Functional categories of over 2.0-fold-regulated genes in two SARS patients
| Classification | P1 | P2 |
| Cell communication | 802 (518↑284↓) | 288 (116↑172↓) |
| Cell differentiation | 65 (33↑32↓) | 24 (6↑12↓) |
| Cellular physiological process | 1 056 (645↑411↓) | 406 (188↑218↓) |
| Coagulation | 42 (25↑17↓) | 17 (6↑11↓) |
| Development | 316 (202↑114↓) | 132 (50↑82↓) |
| Death | 166 (116↑50↓) | 80 (45↑35↓) |
| Extracellular structure | 3 (1↑2↓) | 2 (2↓) |
| organization and biogenesis | ||
| Homeostasis | 30 (13↑17↓) | 11 (8↑3↓) |
| Metabolism | 1 497 (867↑630↓) | 512 (191↑330↓) |
| Obsolete biological process | 1 (1↓) | 1 (1↓) |
| Organismal physiological process | 467 (278↑189↓) | 198 (110↑88↓) |
| Pathogenesis | 1 (1↑) | 2 (2↑) |
| Regulation of cell process | 57 (57↓) | 88 (48↑40↓) |
| Response to stimulus | 532 (317↑215↓) | 232 (124↑108↓) |
| Viral life cycle | 15 (7↑8↓) | 10 (5↑5↓) |
| Behavior | 14 (8↑6↓) | 6 (1↑5↓) |
| Total | 3 854 (2 273↑1 581↓) | 1 380 (527↑853↓) |
Table 5 Differentially expressed genes encoding pro- and anti-inflammatory cytokines are involved in IL-1 and TNF-α signaling cassettes in two patients
| GenBank access | Definition | P1 | P2 |
| Pro- and anti-inflammatory cytokines and receptors | |||
| AF043337 | IL-8 | 8 | –2.46 |
| NM_000634 | IL-8 receptor, α | 73.52 | – |
| NM_001557 | IL-8 receptor, β | 51.98 | 4.29 |
| NM_000575 | IL-1, α | 3.73 | – |
| NM_000576 | IL-1, β | 6.5 | 11.31 |
| NM_000877 | IL-1 receptor, type I | 18.38 | – |
| NM_004633 | IL-1 receptor, type II | 362.04 | 3.84 |
| U64094 | Soluble type II IL-1 receptor | 630.35 | – |
| NM_003856 | IL-1 receptor-like 1 | 11.31 | 3.25 |
| U65590 | IL-1 receptor antagonist IL-1Ra | 14.93 | – |
| AF051151 | Toll/IL-1 receptor-like protein 3 | 14.93 | – |
| NM_000418 | IL-4 receptor | 13.93 | – |
| NM_000600 | IL-6 | – | 3.03 |
| NM_002184 | IL-6 signal transducer gp130 | – | –2.14 |
| BC001903 | IL-10 receptor, β | 4 | – |
| NM_004512 | IL-11 receptor, α | –6.06 | –2.30 |
| NM_001560 | IL-13 receptor, α1 | 3.25 | – |
| U62858 | IL-13 receptor | 5.66 | – |
| U81380.2 | IL-13 receptor soluble form | 4.29 | – |
| NM_000585 | IL-15 | –3.03 | 2 |
| NM_004513 | IL-16 | – | –2.83 |
| NM_014339 | IL-17 receptor | 4.29 | – |
| NM_003855 | IL-18 receptor 1 | 42.22 | – |
| NM_003853 | IL-18 receptor accessory protein | 19.7 | – |
| AF269133 | Novel interleukin receptor | –3.03 | – |
| NM_004862 | TNF-α | 17.15 | – |
| NM_001065 | TNFRSF1A | 4 | – |
| NM_003841 | TNFRSF10C | 19.7 | – |
| NM_000760 | G-CSF 3 receptor | 25.99 | – |
| BC002635 | GM-CSF 2 receptor, α, low-affinity | 3.03 | – |
| M64445 | GM-CSF receptor | 4.92 | 2.64 |
| NM_002607 | Platelet-derived growth factor α polypeptide | –2.46 | – |
| NM_004347 | Caspase 5 | 4.59 | – |
| NM_000201 | Intercellular adhesion molecule 1 | 17.15 | – |
| NM_002162 | Intercellular adhesion molecule 3 | 6.28 | – |
| NM_003243 | Transforming growth factor, β receptor III | –36.76 | –4.59 |
| NM_003242 | Transforming growth factor, β receptor II | – | –2.30 |
| NM_000358 | Transforming growth factor, β-induced, 68 ku | –24.25 | – |
| The genes involved in the IL-1 signaling pathway | |||
| NM_007199 | IL-1 receptor-associated kinase M | 19.7 | – |
| NM_002182 | IL-1 receptor accessory protein | 25.99 | – |
| AF167343 | Soluble IL-1 receptor accessory protein | 55.72 | – |
| M87507 | IL-1 β convertase | 3.25 | – |
| U13698 | IL-1-β converting enzyme isoform γ | 3.03 | – |
| U13699 | IL-1-β converting enzyme isoform δ | – | 2.14 |
| U13700 | IL-1-β converting enzyme isoform ε | 2.64 | – |
| The TNF signal downstream genes | |||
| NM_004619 | TNF receptor-associated factor 5 | – | –2.00 |
| NM_016614 | TRAF and TNF receptor-associated protein | 3.84 | –2.30 |
| NM_006290 | TNF-α induced protein 3 | 5.66 | – |
| NM_007115 | TNF-α induced protein 6 | 45.25 | 4.92 |
| AB034747 | Small integral membrane protein of lysosome late endosome | 7.46 | – |
| U50062 | RIP protein kinase | – | –2.00 |
Table 6 Differentially expressed genes involved in immune regulation in two SARS cases
| GenBank access | Definition | P1 | P2 |
| IFN and IFN-induced genes | |||
| M29383 | IFN-γ | – | 2.14 |
| NM_000416 | IFN-γ receptor 1 | 4.59 | – |
| NM_005534 | IFN-γ receptor 2 | 3.84 | – |
| NM_000629 | IFN (α, β, and ω) receptor 1 | 4.29 | – |
| NM_002198 | IFN regulatory factor 1 | – | 3.84 |
| NM_002460 | IFN regulatory factor 4 | – | –2.30 |
| NM_004030 | IFN regulatory factor 7 | – | 3.25 |
| BC001356 | IFN-induced protein 35 | – | 2.83 |
| M34455 | IFN-γ-inducible indoleamine 2,3-dioxygenase | – | 5.66 |
| NM_001548 | IFN-induced protein with tetratricopeptide repeats 1 | – | 3.03 |
| NM_001549 | IFN-induced protein with tetratricopeptide repeats 4 | – | 6.06 |
| NM_002053 | Guanylate binding protein 1, IFN-inducible | – | 3.03 |
| NM_004120.2 | Guanylate binding protein 2, IFN-inducible | – | 3.73 |
| NM_022873 | IFN-α-inducible protein | – | 6.5 |
| NM_003641 | IFN-induced transmembrane protein 1 (9-27) | – | 2.3 |
| NM_004509 | IFN-induced protein 41 | – | 2.14 |
| NM_005532 | IFN-α inducible protein 27 | – | 14.93 |
| NM_005101 | IFN-stimulated protein, 15 ku | – | 6.5 |
| NM_006417 | IFN-induced, hepatitis C-associated microtubular aggregate protein | –2.46 | 2.64 |
| NM_002759 | PKR | – | 2.14 |
| NM_002462 | Mx1 | – | 2.14 |
| Chemokines and receptors | |||
| NM_001511 | GRO1 | 55.72 | – |
| NM_002993 | Granulocyte chemotactic protein 2 | 3.73 | – |
| NM_001565 | CXCL10 | – | 14.93 |
| AF030514 | CXCL11 | – | 18.38 |
| AJ224869 | CXCR4 | 6.5 | 2.83 |
| M21121 | RANTES | –13.93 | – |
| NM_001295 | CCR1 | 3.84 | – |
| NM_000648 | CCR2 | –9.19 | –3.25 |
| NM_001837 | CCR3 | – | 6.5 |
| NM_000579 | CCR5 | –3.25 | –4.00 |
| NM_001838 | CCR7 | –3.73 | –2.64 |
| U20350 | CX3CR1 | –42.22 | – |
| Toll-like receptors | |||
| NM_003264 | Toll-like receptor 2 | 8 | – |
| NM_003265 | Toll-like receptor 3 | –3.25 | –2.30 |
| NM_003266 | Toll-like receptor 4 | 3.73 | –2.64 |
| NM_016562 | Toll-like receptor 7 | –17.15 | 2.3 |
Table 7 Differentially expressed genes involving MAPK or JAK-STAT signaling pathways in two SARS cases
| GenBank access | Definition | P1 | P2 |
| U35002 | JNK2 β1 protein kinase | –2.00 | –2.14 |
| U31601 | JAK-3B | 10.56 | – |
| NM_007315 | STAT-1 | – | 2.14 |
| NM_005419 | STAT-2 | – | 3.03 |
| NM_003151 | STAT-4 | –2.30 | – |
| NM_012448 | STAT5B | 8.57 | – |
| AB005043 | STAT induced STAT inhibitor 1 | 5.66 | 3.03 |
| NM_003955 | STAT induced STAT inhibitor 3 | 4.92 | – |
| NM_002745 | MAPK 1 | 4 | – |
| NM_002748 | MAPK 6 | 3.73 | – |
| NM_001315 | MAPK 14 | 9.19 | – |
| NM_004759 | MAPK-activated protein kinase 2 | 4.29 | – |
| NM_003668 | MAPK-activated protein kinase 5 | –2.46 | – |
| NM_001674 | Activating transcription factor 3 | 2.46 | 5.27 |
| NM_007348 | Activating transcription factor 6 | 3.73 | – |
- Citation: Yu SY, Hu YW, Liu XY, Xiong W, Zhou ZT, Yuan ZH. Gene expression profiles in peripheral blood mononuclear cells of SARS patients. World J Gastroenterol 2005; 11(32): 5037-5043
- URL: https://www.wjgnet.com/1007-9327/full/v11/i32/5037.htm
- DOI: https://dx.doi.org/10.3748/wjg.v11.i32.5037