BPG is committed to discovery and dissemination of knowledge
Basic Research
©2005 Baishideng Publishing Group Inc.
World J Gastroenterol. Jun 14, 2005; 11(22): 3426-3430
Published online Jun 14, 2005. doi: 10.3748/wjg.v11.i22.3426
Table 1 Primers used in study.
Targeted mRNAPrimerLength
Rat Pdx-1F: gaggacccgtacagcctaca201 bp
R: cgttgtcccgctactacgtt
Rat InsulinF: ccgtcgtgaagtggagga154 bp
R: cagttggtagagggagcagat
Rat Cytokeratin 19F: atccccaaagacacgagatg200 bp
R: gtgagctacaaccgcagctt
Rat β-actinF: taaagagaagctgtgctatgttgc354 bp
R: atgatcttgatcttcatggtgcta