BPG is committed to discovery and dissemination of knowledge
Basic Research
©The Author(s) 2004.
World J Gastroenterol. Jul 1, 2004; 10(13): 1923-1927
Published online Jul 1, 2004. doi: 10.3748/wjg.v10.i13.1923
Table 1 Oligonucleotides used for PCR
GeneQuantification methodPrimer sequencecDNA
NOS IIForward primer5’-CCCTTCCGAAGTTTCTGGCAGCAG-3’2793-2817
Reverse primer5’-GGGCTCCTCCAAGGTGTTGCCC-3’3424-3446
Probe5’-(FAM)TCTTCGGTGCGGTCTTTTCCTATGGAGCAA(TAMRA)-3’3391-3421
NOS IIIForward primer5’-CAAGACCGATTACACGACAT-3’31-51
Reverse primer5’-GCTGGTTGCCATAGTGACAT-3’300-321
Probe5’-(FAM)GAGTGTTTGGACAAGTCCTCACCGCCTTTT-(TAMRA)-3’158-188
GAPDHForward primer5’-GAAGGTGAAGGTCGGAGTCA-3’
Reverse primer5’-GAAGATGGTGATGGGA-3’
Probe5’-(JOE)CAAGCTTCCCGTTCTCAGCC(TAMRA)-3’
Table 2 Effects of tetrandrine and on serum NO in cirrhotic rats (μmol/L, mean ± SD)
GradeTetrandrineCirrhosisNegative control
(n = 8)(n = 8)(n = 8)
Earlier period6.51 ± 0.56b10.27 ± 0.715.91 ± 0.67
Metaphase6.87 ± 0.78b10.88 ± 0.826.04 ± 0.98
Late period6.49 ± 0.83b6.35 ± 1.48b6.17 ± 0.73
Table 3 Effects of Tetrandrine on NOS activity in cirrhotic rats (mol/min·g, mean ± SD)
GradeTetrandrineCirrhosisNegative control
(n = 8)(n = 8)(n = 8)
Earlier period0.5165 ± 1455a1.6916 ± 0.80990.4275 ± 0.2037
Metaphase0.6901 ± 0.2092a1.9756 ± 0.78330.5639 ± 0.4275
Late period0.8483 ± 0.2393a1.9789 ± 0.76900.6723 ± 0.5784
Table 4 Effects of tetrandrine on hemodynamics in cirrhotic rats (mean ± SD)
StageIndexTetrandrineCirrhosisNegative control
(n = 8)(n = 8)(n = 8)
Earlier periodPVF18.37 ± 1.8321.25 ± 1.7616.50 ± 1.73
PVP1.35 ± 0.25b1.67 ± 0.211.18 ± 0.13
ICVP0.31 ± 0.040.32 ± 0.040.31 ± 0.04
PVR5.73 ± 0.886.38 ± 1.125.81 ± 1.04
MetaphasePVF14.50 ± 1.61a20.35 ± 1.0717.75 ± 1.37
PVP1.44 ± 0.13b1.72 ± 0.691.30 ± 0.21
ICVP0.32 ± 0.040.31 ± 0.040.32 ± 0.04
PVR7.98 ± 1.689.56 ± 1.295.53 ± 0.67
Late periodPVF15.85 ± 1.2317.57 ± 1.9315.42 ± 1.27
PVP1.45 ± 0.24b1.67 ± 0.231.37 ± 0.10
ICVP0.31 ± 0.040.32 ± 0.040.32 ± 0.04
PVR7.44 ± 1.088.01 ± 0.796.76 ± 0.34
Table 5 Quantification of PCR products
StageIndexTetrandrineCirrhosisNegative control
(n = 8)(n = 8)(n = 8)
Earlier periodNOS II0.1723 ± 0.00140.5635 ± 0.0104-
NOS III0.2578 ± 0.00760.2694 ± 0.00430.2786 ± 0.0107
MetaphaseNOS II0.1679 ± 0.00930.7521 ± 0.0098-
NOS III0.3210 ± 0.00840.3412 ± 0.01130.2916 ± 0.0089
Late periodNOS II0.1876 ± 0.00650.6987 ± 0.0078-
NOS III0.2917 ± 0.01020.3002 ± 0.00910.2815 ± 0.0098


Write to the Help Desk