BPG is committed to discovery and dissemination of knowledge
Basic Research Open Access
©The Author(s) 2003. Published by Baishideng Publishing Group Inc. All rights reserved.
World J Gastroenterol. Jul 15, 2003; 9(7): 1559-1562
Published online Jul 15, 2003. doi: 10.3748/wjg.v9.i7.1559
Effect of compound rhodiola sachalinensis A Bor on CCl4-induced liver fibrosis in rats and its probable molecular mechanisms
Xiao-Ling Wu, Pi-Long Wang, Chun-Tao Lei, Department of Gastroenterology, First Affiliated Hospital, Chongqing University of Medical Sciences, Chongqing 400016, China
Wei-Zheng Zeng, Ming-De Jiang, Xiao-Bin Chen, Yong Zhang, Hui Xu, Zhao Wang, Department of Digestion, General Hospital of Chengdu Military Command, Chengdu 610083, Sichuan Province, China Supported by the Tenth-Five Year Plan of Medical Science Foundation of Chengdu Military Command, No. 01A009
Author contributions: All authors contributed equally to the work.
Correspondence to: Professor Wei-Zheng Zeng, Department of Digestion, General Hospital of Chengdu Military Command, Chengdu 610083, Sichuan Province, China. zengweizheng@163.com
Telephone: +86-28-86570347
Received: November 6, 2002
Revised: December 4, 2002
Accepted: December 30, 2002
Published online: July 15, 2003

Abstract

AIM: To explore the anti-fibrotic effect of a traditional Chinese medicine, compound rhodiola sachalinensis A Bor on CCl4-induced liver fibrosis in rats and its probable molecular mechanisms.

METHODS: Ninety healthy male SD rats were randomly divided into three groups: normal group (n = 10), treatment group of compound rhodiola sachalinensis A Bor (n = 40) and CCl4-induced model group (n = 40). The liver fibrosis was induced by CCl4 subcutaneous injection. Treatment group was administered with compound rhodiola sachalinensis A Bor (0.5 g/kg) once a day at the same time. Then the activities of several serum fibrosis-associated enzymes: alanine aminotransferase (ALT), aspartate aminotransferase (AST), N-acetyl-beta-D-glucosaminidase (β-NAG) and the levels of serum procollagen III (PC III), collagen IV (C IV), hyaluronic acid (HA) were assayed. The histopathological changes were observed with HE, VG and Masson stain. The expression of TGF-β1 mRNA, α1 (I) mRNA and Na+/Ca2+ exchanger (NCX) mRNA was detected by reverse transcription polymerase chain reaction (RT-PCR) in situ.

RESULTS: Compound rhodiola sachalinensis A Bor significantly reduced serum activities of ALT, AST, β-NAG and decreased the levels of PC III, C IV, HA, improved the liver histopathological changes, inhibited the expression of TGF-β1 mRNA, α(I) mRNA and Na+/Ca2+ exchanger mRNA in rats.

CONCLUSION: Compound rhodiola sachalinensis A Bor can intervene in CCl4-induced liver fibrosis in rats, in which potential mechanisms may be decreasing the production of TGF-β1, reducing the production of collagen, preventing the activation of hepatic stellate cell (HSC) and inhibiting the expression of TGF-β1 mRNA, α1(I) mRNA and Na+/Ca2+ exchanger mRNA.




INTRODUCTION

Transforming growth factor beta 1 (TGF-β 1) is the most potent profibrogenic mediator in liver fibrosis and cirrhosis as shown in animal models and human chronic hepatic injury[1-4]. It plays critical roles in the activation of hepatic stellate cell (HSC) and the regulation of the production, degradation, and accumulation of extracellular matrix (ECM) proteins[5-7]. Recent studies have identified that TGF-beta 1 mRNA transcription is significantly increased during chronic liver injury. Thus the TGF-beta signal transduction pathway has become a new effective target for the prevention or treatment of liver fibrosis[8-11]. Several traditional Chinese herbs have been shown to have the ability of intervention in liver fibrosis[12-20], however, most of them were limited in morphological and serum studies, lacking of deep research in their molecular biological mechanisms. Our previous study has shown another Chinese medicine, compound rhodiola sachalinensis A Bor, can effectively prevent CCl4-induced liver fibrosis in rats[21-23]. In this study, the probable biological mechanism of it, especially in the expression of TGF-beta 1 mRNA, α1(I) mRNA and Na+/Ca2+ exchanger mRNA was explored.

MATERIALS AND METHODS
Animals

Male SD rats (weighing 140-160 g) were obtained from the Experimental Animal Center of Sichuan University (Chengdu, Sichuan Province, China). The rats were housed in a room with controlled temperature (15-20 °C) and lighting (10 h light, 14 h dark). Free access to water and food was allowed during the experimental period. All the rats were randomly divided into three groups: normal group (n = 10), treatment group (n = 40) and model group (n = 40). For model group, 300 mL/L CCl4 in liquid paraffin was injected subcutaneously at a dose of 3 mL/kg twice weekly. The treatment group, apart from the administration of CCl4, was fed with compound rhodiola sachalinensis A Bor 0.5 g/kg once per day. The model group was given normal food and water, received injection of liquid paraffin with the same dosage and duration as CCl4.

At the end of the 15-week experimental period, all the rats were anesthetized with intramuscular injection of sodium pentobarbital (30 mg/kg) before sacrificed. Blood was collected from the heart and the serum obtained through centrifugation. The liver was removed rapidly, part of it was conserved in 100 mL/L neutral formalin, and the rest was frozen in a refrigerator at -20 °C.

Serum parameters of hepatic fibrosis

Parameters of hepatic fibrosis were determined by levels of type III procollagen (PC III), type IV collagen (C IV) and hyaluronic acid (HA), using radioimmunoassay (commercial kit obtained from Shanghai Navy Medical Institute, China). Serum activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were assayed by a automatic analyzer. Another serum enzyme N-acetyl-beta-D-glucosaminidase (β-NAG) was assayed with spectrophotometric method.

Histopathological grading

Liver samples from each rat were embedded in paraffin, stained with hematoxylin-eosin (HE), Van Gieson (VG) and Masson trichrome collagen stain, and then examined under an optical microscope. Fibrosis-degree of liver sections was graded numerically based on the criteria described below: 0, no fibrosis; +, slight fibrosis, fibrosis located in the central liver lobule; +2, moderate fibrosis, widen central fibrosis; +3, severe fibrosis, fibrosis extended to the edge of liver lobule; +4, liver cirrhosis.

Molecular biological detection: RT-PCR in situ

Each liver sample embedded in paraffin was sectioned and fixed onto a poly-L-lysine covered glass. The expression of α1(I) mRNA, TGF-β1 mRNA and Na+/Ca2+ exchanger (NCX) mRNA was detected with RT-PCR in situ. (primers obtained from Shanghai Sangon Biotechnology Co. Ltd.) (Table 1).

Table 1 Primer sequences of α1(I), TGF-β1 and Na+/Ca2+ exchanger mRNA.
mRNAUpstream (5'→3')Downstream (5'→3')
α1(I)CACCCTCAAGAGCCTGAGTCGTTCGGGCTGATGTACCAGT
TGF-β1CTTTGTACAACAGCACCCGCGTCAAAAGACAGCCACTCAGG
NCXTATTGCCGAACCGGTTTATGTCTCGTCTCTCCATCTGGGAC
Statistical analysis

Data were analyzed using t-test and Microsoft Excel 2000.

RESULTS
Changes of serum fibrosis-associated markers

In model group, the serum activities of ALT, AST and β-NAG were significantly increased (P < 0.01), the serum levels of PC III, C IV and HA were also elevated (P < 0.01). With administration of compound Rhodiola Sachalinensis A Bor (RSC), serum activities of ALT, AST, β-NAG and levels of PC III, C IV, HA were decreased obviously (P < 0.01), although they were still higher than those in normal group (P < 0.05) (Table 2).

Table 2 Liver fibrosis-associated enzymes and fibrosis markers in serum (¯x ± s).
GroupALT (IU/L)AST (IU/L)β-NAG (μmol/L)PC III (mg/L)C IV (mg/L)HA (mg/L)
Normal87.93 ± 18.61a104.3 ± 32.40a189.00 ± 26.70a89.99 ± 10.85a35.69 ± 9.68a112.41 ± 45.62a
Model198.64 ± 71.02514.59 ± 180.22415.77 ± 133.37265.54 ± 98.21159.67 ± 29.64455.79 ± 113.55
Treatment114.17 ± 47.89a291.62 ± 141.75a244.67 ± 46.8a164.25 ± 45.68a96.73 ± 16.48a289.35 ± 75.68a
Histopathological changes of the liver

The control livers showed a normal lobular architecture with central veins and radiating hepatic cords. The staging score was 0. Subcutaneous injection of CCl4 caused severe liver pathological damages such as: inflammation, necrosis and excessive collagen deposition. The semiquantitative staging score of hepatic fibrosis was raised to 3.53 ± 0.68 in model group. The livers in treatment group showed less inflammation, necrosis, collagen deposition and a significantly decreased staging score of 2.43 ± 0.47 (P < 0.05) (Table 3, Figure 1, Figure 2).

Table 3 Histopathological semiquantitative scores in the liver.
Groupn0+1+2+3+4Staging scores
Normal101000000a
Model300038193.53 ± 0.68
Treatment3502181322.43 ± 0.47b
Figure 1
Figure 1 Liver VG staining in model rats (10 × 40).
Figure 2
Figure 2 Liver VG staining in treatment rats (10 × 40).
Molecular biological changes

Scoring method: according to the number of positive cells within one visual field on average. (-), no positive cells, scoring 0; (+), positive cells < 1/3, scoring 1; (++), positive cells < 2/3, scoring 2; (+++), positive cells > 2/3, scoring 3. There were less positive signals of α1(I) mRNA, TGF-β1 mRNA and Na+/Ca2+ exchanger mRNA detected with RT-PCR in situ in normal group, in which scores were 1.11, 0.75, 0.10 and the ratio of positive samples was 77.8%, 62.5%, 10.0% respectively (Table 4, Table 5, Table 6). In model group, the positive signals of RT-PCR in situ for α1(I) mRNA, TGF-β1 mRNA and Na+/Ca2+ exchanger mRNA were significantly enhanced. The semiquantitative scores of them were increased to 2.80, 2.40, 2.30 and the ratio of positive samples rised to 100.0%, 90.0%, 100.0% respectively (P < 0.01). Treatment with RSC made the scores reduced to 1.63, 1.20, 1.50, and positive ratio lowered to 87.5%, 80.0%, 80.0% respectively in comparison with model group (P < 0.05) (Table 4, Table 5, Table 6, Figure 3, Figure 4, Figure 5, Figure 6).

Table 4 Expression of α1 (I) mRNA (semiquantitative scores and positive ratio).
Groupn-++++++ScoresPositive ratio (%)
Normal924301.11a77.8b
Model1000282.80100.0
Treatment812411.63b87.5b
Table 5 Expression of TGF-β1mRNA (semiquantitative scores and positive ratio).
Groupn-++++++ScoresPositive ratio (%)
Normal834100.75a62.5a
Model1011172.4090.0
Treatment1025211.20b80.0b
Table 6 Expression of Na+/Ca2+ exchanger mRNA (semiquantitative scores and positive ratio).
Groupn-++++++ScoresPositive ratio (%)
Normal1091000.10a10.0a
Model1002352.30100.0
Treatment1023321.50b80.0b
Figure 3
Figure 3 Expression of TGF-β1mRNA in liver of model rats (10 × 40).
Figure 4
Figure 4 Expression of TGF-β1mRNA in liver of treatment rats (10 × 40).
Figure 5
Figure 5 Expression of NCX mRNA in liver of model rats (10 × 40).
Figure 6
Figure 6 Expression of NCX mRNA in liver of treatment rats (10 × 40).
DISCUSSION

Liver fibrosis is generally preceded by chronic liver injury despite of its primary causes, including alcohol, hepatic virus, oxidant stress and other persistent damages. The activation of hepatic stellate cells (HSC) is considered to be of great importance during the long period of liver fibrosis, which is induced by some critical cytokines and then becomes the main source of most collagen proteins[24]. Among the cytokine mediating factors, transforming growth factor beta 1 (TGF-β1) has been considered as the essential profibrogenesis factor and the main target of treatment[25-31]. Additionally, Na+/Ca2+ exchanger was a newly noticed factor whose expression increased along with the activation of HSC, and its real role in liver fibrosis has not been interpreted[32]. Thus, detection of the expression of TGF-β1 and Na+/Ca2+ exchanger mRNA is useful in exploring the probable mechanisms of anti-fibrotic drugs.

Several drugs, including cytokines, antioxidant, chemical drugs, soluble type II receptor of TGF-β1[9,33], antibody of TGF-β1 have been used to block liver fibrosis. But their effects are not as prosperous as we expected[1]. Besides, some traditional Chinese drugs have been found to be effective on preventing fibrogenesis and other chronic liver injury, which develop a more hopeful future in controlling liver fibrosis and cirrhosis. The present study aimed at exploring the effects of a traditional Chinese herb, compound rhodiola sachalinensis A Bor, which consists of rhodiola sachalinensis A Bor, sophora flavescens Ait and other herbs, on the prevention of CCl4-induced liver fibrosis in rats. The potential mechanisms of RSC was explained at the same time.

In this study, chronic administration of CCl4 caused liver fibrosis and cirrhosis as indicated by the changes of serum markers, histopathological changes, and molecular biological changes. The activities of serum fibrosis-associated enzymes, namely ALT, AST, β-NAG and contents of extracellular matrix (ECM) components (PC III, C IV, HA) were significantly increased along with increased expression of α1(I) mRNA, TGF-β1 mRNA and Na+/Ca2+ exchanger mRNA. Under the light microscope, the liver fibrosis/cirrhosis was verified by the typical liver structure: inflammation, necrosis and excessive collagen deposition, some of the samples even had pseudolobules. With the therapy of compound rhodiola sachalinensis A Bor, serum parameters of liver fibrosis (ALT, AST, β-NAG, PC III, C IV, HA) were significantly decreased (P < 0.01). HE, VG and Masson stained histopathological sections showed mild inflammation, necrosis and fewer collagen deposition. The semiquantitative fibrosis staging scores were also decreased obviously (P < 0.01). The expression of α1(I) mRNA, TGF-β1 mRNA and Na+/Ca2+ exchanger mRNA was significantly inhibited using RT-PCR in situ (P < 0.01). These results suggest that compound rhodiola sachalinensis A Bor may prevent experimental liver fibrosis by modulating the synthesis and releasing of critical cytokines, such as TGF-β1, thus inhibiting the activation of HSC and its production of collagen proteins. The inhibition of Na+/Ca2+ exchanger mRNA may partly relate to its anti-fibrotic effects. In conclusion, traditional Chinese medicine compound rhodiola sachalinensis A Bor has significant anti-fibrogenesis effects on CCl4-induced liver fibrosis in rats. The probable molecular mechanisms may include blocking the synthesis of TGF-β1, interfering with the activation of HSC, preventing production and deposition of collagen, and inhibiting the expression of Na+/Ca2+ exchanger mRNA. The exact molecular mechanisms remain to be explored.

References
1.  Bissell DM, Roulot D, George J. Transforming growth factor beta and the liver. Hepatology. 2001;34:859-867.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 289]  [Cited by in RCA: 274]  [Article Influence: 11.0]  [Reference Citation Analysis (3)]
2.  Liu F, Liu JX. The role of transforming growth factor b1 in liver fobrosis. Shijie Huaren Xiaohua Zazhi. 2000;8:86-88.  [PubMed]  [DOI]
3.  Schuppan D, Popov Y. Hepatic fibrosis: from bench to bedside. J Gastroenterol Hepatol. 2002;17 Suppl 3:S300-S305.  [PubMed]  [DOI]
4.  Cui DL, Yao XX. The serum detection of liver fibrosis. Shijie Huaren Xiaohua Zazhi. 2000;8:683-684.  [PubMed]  [DOI]
5.  Qin JP, Jiang MD. The phenotype and regulation of hepatic stellate cell and liver fibrosis. Shijie Huaren Xiaohua Zazhi. 2001;9:801-804.  [PubMed]  [DOI]
6.  Wu JX, Meng XJ, Chen YW, Li DG, Lu HM. Message molecular of Smads and the activation of hepatic stellate cells. Weichangbingxue He Ganbingxue Zazhi. 2002;11:197-199.  [PubMed]  [DOI]
7.  Shi YJ, Tian ZB, Zhao QX. The current research of Smads protein family. Zhonghua Fubu Jibing Zazhi. 2002;2:497-500.  [PubMed]  [DOI]
8.  Li D, Friedman SL. Liver fibrogenesis and the role of hepatic stellate cells: new insights and prospects for therapy. J Gastroenterol Hepatol. 1999;14:618-633.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 284]  [Cited by in RCA: 266]  [Article Influence: 9.9]  [Reference Citation Analysis (0)]
9.  George J, Roulot D, Koteliansky VE, Bissell DM. In vivo inhibition of rat stellate cell activation by soluble transforming growth factor beta type II receptor: a potential new therapy for hepatic fibrosis. Proc Natl Acad Sci U S A. 1999;96:12719-12724.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 272]  [Cited by in RCA: 257]  [Article Influence: 9.5]  [Reference Citation Analysis (0)]
10.  Yoshiji H, Kuriyama S, Yoshii J, Ikenaka Y, Noguchi R, Nakatani T, Tsujinoue H, Fukui H. Angiotensin-II type 1 receptor interaction is a major regulator for liver fibrosis development in rats. Hepatology. 2001;34:745-750.  [PubMed]  [DOI]
11.  Jiang SL, Yao XX, Sun YF. The treatment of liver fibrosis. Shijie Huaren Xiaohua Zazhi. 2000;8:684-686.  [PubMed]  [DOI]
12.  Sun YF, Yao XX, Jiang SL. The traditional Chinese medicine treatment of liver fibrosis. Shijie Huaren Xiaohua Zazhi. 2000;8:686-687.  [PubMed]  [DOI]
13.  Du WD, Zhang YE, Zhai WR, Zhou XM. Dynamic changes of type I, III and IV collagen synthesis and distribution of collagen-producing cells in carbon tetrachloride-induced rat liver fibrosis. World J Gastroenterol. 1999;5:397-403.  [PubMed]  [DOI]
14.  Liu P, Liu C, Xu LM, Hu YY, Xue HM, Liu CH, Zhang ZQ. Effects of Fuzheng Huayu 319 recipe on liver fibrosis in chronic hepatitis B. World J Gastroenterol. 1998;4:348-353.  [PubMed]  [DOI]
15.  Liu CH, Hu YY, Wang XL, Liu P, Xu LM. Effects of salvianolic acid-A on NIH/3T3 fibroblast proliferation, collagen synthesis and gene expression. World J Gastroenterol. 2000;6:361-364.  [PubMed]  [DOI]
16.  Cai DY, Zhao G, Chen JC, Ye GM, Bing FH, Fan BW. Therapeutic effect of Zijin capsule in liver fibrosis in rats. World J Gastroenterol. 1998;4:260-263.  [PubMed]  [DOI]
17.  Shimizu I. Sho-saiko-to: Japanese herbal medicine for protection against hepatic fibrosis and carcinoma. J Gastroenterol Hepatol. 2000;15 Suppl:D84-D90.  [PubMed]  [DOI]
18.  Yang W, Zeng M, Fan Z, Mao Y, Song Y, Jia Y, Lu L, Chen CW, Peng YS, Zhu HY. [Prophylactic and therapeutic effect of oxymatrine on D-galactosamine-induced rat liver fibrosis]. Zhonghua Ganzangbing Zazhi. 2002;10:193-196.  [PubMed]  [DOI]
19.  Li CX, Li L, Lou J, Yang WX, Lei TW, Li YH, Liu J, Cheng ML, Huang LH. The protective effects of traditional Chinese medicine prescription, han-dan-gan-le, on CCl4-induced liver fibrosis in rats. Am J Chin Med. 1998;26:325-332.  [PubMed]  [DOI]
20.  Liu P, Hu YY, Liu C, Zhu DY, Xue HM, Xu ZQ, Xu LM, Liu CH, Gu HT, Zhang ZQ. Clinical observation of salvianolic acid B in treatment of liver fibrosis in chronic hepatitis B. World J Gastroenterol. 2002;8:679-685.  [PubMed]  [DOI]
21.  Zeng WZ, Wu XL, Jiang MD, Chen XB, Xu H, Wang Z, Xiong BJ. The effect of rhodiola sachalinensis compound on the expression of TGF-β1 mRNA in rats of CCl4-induced liver fibrosis. Zhongguo Zhongxiyi Jiehe Xiaohua Zazhi. 2002;10:138-141.  [PubMed]  [DOI]
22.  Jiang MD, Gan XY, Xie FW, Zeng WZ, Wu XL. Effect of salidroside on the proliferation and collagen mRNA transcription in rat hepatic stellate cells stimulated by acetaldehyde. Yaoxue Xuebao. 2002;37:841-844.  [PubMed]  [DOI]
23.  Wu XL, Zene WZ, Chen XB, Jiang MD, Xiong BJ, Zhang Y, Xu H. The effects of rhodiola sachalinensis A Bor on the activities of fibrosis-associated enzymes in serum and tissue in rats of CCl4-induced liver fibrosis. Huaxi Yaoxue Zazhi. 2002;17:416-418.  [PubMed]  [DOI]
24.  Schuppan D, Koda M, Bauer M, Hahn EG. Fibrosis of liver, pancreas and intestine: common mechanisms and clear targets. Acta Gastroenterol Belg. 2000;63:366-370.  [PubMed]  [DOI]
25.  Gressner AM, Weiskirchen R, Breitkopf K, Dooley S. Roles of TGF-beta in hepatic fibrosis. Front Biosci. 2002;7:d793-d807.  [PubMed]  [DOI]
26.  Neuman MG, Benhamou JP, Bourliere M, Ibrahim A, Malkiewicz I, Asselah T, Martinot-Peignoux M, Shear NH, Katz GG, Akremi R. Serum tumour necrosis factor-alpha and transforming growth factor-beta levels in chronic hepatitis C patients are immunomodulated by therapy. Cytokine. 2002;17:108-117.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 36]  [Cited by in RCA: 38]  [Article Influence: 1.6]  [Reference Citation Analysis (0)]
27.  Bissell DM. Chronic liver injury, TGF-beta, and cancer. Exp Mol Med. 2001;33:179-190.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 134]  [Cited by in RCA: 132]  [Article Influence: 5.3]  [Reference Citation Analysis (3)]
28.  Kanzler S, Baumann M, Schirmacher P, Dries V, Bayer E, Gerken G, Dienes HP, Lohse AW. Prediction of progressive liver fibrosis in hepatitis C infection by serum and tissue levels of transforming growth factor-beta. J Viral Hepat. 2001;8:430-437.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 101]  [Cited by in RCA: 89]  [Article Influence: 3.6]  [Reference Citation Analysis (0)]
29.  Paizis G, Gilbert RE, Cooper ME, Murthi P, Schembri JM, Wu LL, Rumble JR, Kelly DJ, Tikellis C, Cox A. Effect of angiotensin II type 1 receptor blockade on experimental hepatic fibrogenesis. J Hepatol. 2001;35:376-385.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 128]  [Cited by in RCA: 123]  [Article Influence: 4.9]  [Reference Citation Analysis (1)]
30.  Deng L, Zhou Y, Peng X, Deng H, Deng Y, Yao J. [Serum markers and pathological evaluation in hepatitis fibrosis of chronic hepatitis B treated with interferon alpha]. Zhonghua Ganzangbing Zazhi. 2001;9 Suppl:66-67.  [PubMed]  [DOI]
31.  Jiang W, Wang J, Yang C, Wang Y, Liu W, He B. [Effects of antisense transforming growth factor beta receptor-I expressing plasmid on pig serum-induced rat liver fibrosis]. Zhonghua Yixue Zazhi. 2002;82:1160-1164.  [PubMed]  [DOI]
32.  Nakamura T, Arii S, Monden K, Furutani M, Takeda Y, Imamura M, Tominaga M, Okada Y. Expression of the Na+/Ca2+ exchanger emerges in hepatic stellate cells after activation in association with liver fibrosis. Proc Natl Acad Sci U S A. 1998;95:5389-5394.  [PubMed]  [DOI]
33.  Ueno H, Sakamoto T, Nakamura T, Qi Z, Astuchi N, Takeshita A, Shimizu K, Ohashi H. A soluble transforming growth factor beta receptor expressed in muscle prevents liver fibrogenesis and dysfunction in rats. Hum Gene Ther. 2000;11:33-42.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 102]  [Cited by in RCA: 98]  [Article Influence: 3.8]  [Reference Citation Analysis (0)]
Footnotes

Edited by Zhang JZ

Write to the Help Desk