BPG is committed to discovery and dissemination of knowledge
Basic Study Open Access
©Author(s) (or their employer(s)) 2026. No commercial re-use. See Permissions. Published by Baishideng Publishing Group Inc.
World J Gastroenterol. Mar 7, 2026; 32(9): 114207
Published online Mar 7, 2026. doi: 10.3748/wjg.v32.i9.114207
Evaluation of a 3,5-diethoxycarbonyl-1,4-dihydrocollidine diet-induced mouse model in a comparative experimental study of portal hypertension
Jin-Bo Zhao, Zheng-Hao Wu, Jia-Yun Lin, Gu-Qing Luo, Chi-Hao Zhang, Guang-Bo Wu, Qiang Fan, Xiao-Liang Qi, Hong-Jie Li, Lei Zheng, Meng Luo, Department of General Surgery, Ninth People’s Hospital Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai Jiao Tong University, Shanghai 200011, China
Hai-Zhong Huo, Department of General Surgery, Ninth People’s Hospital Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai 200011, China
Ji-Wei Yu, Department of General Surgery, Ninth People’s Hospital, Shanghai Jiao Tong University, School of Medicine, Shanghai 201999, China
ORCID number: Ji-Wei Yu (0000-0003-0427-7958); Meng Luo (0000-0003-3975-7476).
Co-first authors: Jin-Bo Zhao and Zheng-Hao Wu.
Co-corresponding authors: Lei Zheng and Meng Luo.
Author contributions: Zhao JB and Wu ZH contributed equally to this work; Zhao JB participated in experimental design, conducted core laboratory experiments, and drafted the initial manuscript; Wu ZH handled data collection, statistical analysis, and result validation; Lin JY led literature review and methodology refinement; Luo GQ assisted with experimental reproducibility and manuscript revision; Zhang CH managed sample preparation and quality control; Wu GB and Fan Q collaborated on data visualization and result presentation; Qi XL refined experimental protocols; Huo HZ and Yu JW contributed to manuscript revision and logical flow improvements; Li HJ, Zheng L, and Luo M supervised the project, provided research guidance, secured funding, finalized the manuscript, and approved its submission as corresponding authors; all authors have read and approved the final manuscript.
Supported by the Postdoctoral Scientific Research Foundation of Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, No. 202401023; Shanghai Municipal Commission of Health and Family Planning, No. 20244Y0195 and No. 20234Y0132; and National Natural Science Foundation of China, No. 82100639, No. 82200630 and No. 81970526.
Institutional review board statement: This study does not involve any human experiments.
Institutional animal care and use committee statement: The animal experimental protocol involved in this study has been reviewed and approved by the Ethics Committee of Shanghai Ninth People’s Hospital Affiliated to Shanghai Jiao Tong University (approval No. SH9H-2021-A233-SB). The experiment was conducted in strict compliance with animal ethics norms and relevant management regulations.
Conflict-of-interest statement: The authors declare that they have no conflict of interest.
ARRIVE guidelines statement: The authors have read the ARRIVE guidelines, and the manuscript was prepared and revised according to the ARRIVE guidelines.
Data sharing statement: All original data and related materials can be obtained upon reasonable request made to the corresponding authors.
Corresponding author: Meng Luo, MD, Chief Physician, Department of General Surgery, Ninth People’s Hospital Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai Jiao Tong University, No. 639 Manufacturing Bureau Road, Shanghai 200011, China. luosh9hospital@sina.com
Received: September 16, 2025
Revised: November 6, 2025
Accepted: December 11, 2025
Published online: March 7, 2026
Processing time: 167 Days and 0.1 Hours

Abstract
BACKGROUND

Portal hypertension (PHT) is a life-threatening complication of chronic liver disease, necessitating reliable animal models that mimic its clinical heterogeneity. Classical mouse models like bile duct ligation (BDL) exhibit a low 4-week survival (35%), while carbon tetrachloride (CCl4) models have delayed pathogenesis, requiring ≥ 8 weeks for PHT development, limiting their efficiency.

AIM

To evaluate the 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) diet-induced mouse model as a biliary PHT model, comparing it to BDL and CCl4 models.

METHODS

Mice were assigned to DDC diet, BDL, or CCl4 groups. Assessments included portal pressure, histological examination of biliary fibrosis and hepatic stellate cell (HSC) activation (desmin expression), scanning electron microscopy for sinusoidal fenestrae and capillarization, endothelial nitric oxide synthase (eNOS) regulation (phosphorylated-eNOS/total eNOS ratio and total eNOS level), ductular reaction, inflammatory infiltration, and portosystemic shunting. Survival rates and operational feasibility (feed-based administration) were evaluated.

RESULTS

At 4 weeks, DDC induced portal pressure comparable to BDL and CCl4. The DDC model showed moderate biliary fibrosis (similar to BDL but less than CCl4) and greater HSC activation than the other two models. Sinusoidal fenestrae reduction and capillarization in DDC matched BDL and CCl4 models. DDC had decreased phosphorylated-eNOS/total eNOS ratio, while BDL and CCl4 models exhibited reduced total eNOS. DDC demonstrated robust ductular response, inflammation, and shunting, a hallmark of PHT. Survival was 100% (vs 35% BDL, 58.3%-66.6% CCl4), with simpler feed-based induction.

CONCLUSION

The DDC model offers strong biliary PHT relevance, high survival, and efficiency, making it a superior alternative to BDL and CCl4 models for biliary PHT research.

Key Words: 3,5-diethoxycarbonyl-1,4-dihydrocollidine; Portal hypertension; Mouse model; Portal pressure; Ductular reaction; Chronic liver disease

Core Tip: This study validates the 0.1% 3,5-diethoxycarbonyl-1,4-dihydrocollidine diet mouse model for biliary-related portal hypertension (PHT). It matches bile duct ligation (BDL) and carbon tetrachloride (CCl4) models in PHT pathologies (e.g., elevated portal pressure, sinusoidal changes) but outperforms them with 100% 4-week survival (vs 35% BDL, 58.3%-66.6% CCl4), simpler feed-based use, and better recapitulation of PHT hallmarks, serving as a superior alternative.



INTRODUCTION

Portal hypertension (PHT) is a common and severe complication of chronic liver disease (CLD), particularly cirrhosis, resulting in life-threatening outcomes such as gastroesophageal variceal bleeding, ascites, hepatorenal syndrome, and hepatic encephalopathy[1]. This pathology is central to cirrhosis-related morbidity, contributing to 1 million of the 2 million annual global liver disease-related deaths[2]. As the primary driver of hepatic decompensation in cirrhosis, PHT significantly worsens mortality rates; for instance, cirrhosis accounted for 2.4% of worldwide deaths in 2019, with an age-standardized prevalence of 1.4%[3]. This substantial burden underscores the gaps in our understanding of disease mechanisms and the scarcity of effective treatments, underscoring the critical need for deeper mechanistic insights and novel therapeutic strategies.

Animal models serve as primary tools for investigating disease pathogenesis and conducting drug research[4-6]. These models can simulate disease onset, progression, and drug responses to a significant extent. Classic PHT models, such as rat bile duct ligation (BDL), carbon tetrachloride (CCl4 or thioacetamide), and partial portal vein ligation (PPVL) models, each have distinct characteristics[7]. Researchers studying treatments for related diseases or PHT-related complications often choose the BDL model[8,9] (characterized by early-stage high portal pressure and biliary fibrosis), the PPVL model[10] (featuring early visible portal vein shunting), and the CCl4 model[11,12] (known for its simple modeling process). It is widely acknowledged that the larger body size and robust vascular system of the rat model have significantly facilitated PHT research for decades[8,13-15]. A recent study on silencing the 5-hydroxytryptamine receptor 1a gene in rats confirmed that in vivo gene intervention effectively alleviates PHT[16]. However, due to immature gene editing technology in rats, mice with genomes more homologous to humans and advanced gene editing tools have become the preferred model for PHT research[17]. Increasingly, researchers are adapting rat PHT model construction methods to explore PHT pathogenesis and treatment in mice, with or without gene interventions. Examples include studies showing how mechanical stretch increases chemokine (C-X-C motif) ligand 1 (Cxcl1) expression in liver sinusoidal endothelial cells (LSEC) to promote PHT[18] and how endothelial p300 promotes PHT and hepatic fibrosis through C-C motif chemokine ligand 2-mediated angiocrine signaling[19].

Etiologies of cirrhosis include viral infections (hepatitis B, C, and D), alcohol-related liver disease, metabolic and genetic disorders, autoimmune diseases, biliary diseases, vascular disorders, drug-induced cases, and cryptogenic cases[20]. Given the diverse pathogeneses of cirrhosis, BDL and CCl4 mouse models fail to capture the full range of PHT mechanisms across etiologies. There is an urgent need to develop mouse models simulating multiple liver diseases that induce PHT, better reflecting clinical heterogeneity. For instance, Mdr2 knockout mice exhibited early portal pressure elevation as early as 2015[21]. Recently, we found that a 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) diet mouse model of primary biliary cholangitis (PBC) showed portal pressure comparable to BDL- and CCl4-induced PHT models at 4 weeks. As previously reported, DDC-fed mice serve as a toxicant-induced model of sclerosing cholangitis and biliary fibrosis[22]. Chronic DDC feeding for 4 weeks induces biliary porphyrin secretion, resulting in intraductal plug formation, ductular proliferation, onion-skin periductal fibrosis, and subsequent biliary fibrosis[23]. This approach is simpler than the CCl4 model and addresses liver diseases leading to PHT such as PBC not covered by BDL or CCl4 models. Therefore, we aim to investigate the mechanisms of early-onset PHT in the DDC diet model and evaluate its potential as a primary pathogenic model for PHT research by assessing fibrosis, abnormal liver sinusoidal endothelial function, and inflammation. These analyses will support future studies on pathogenic mechanisms.

MATERIALS AND METHODS
Animal models

All animal experiments involving mice were reviewed and approved by the Ethics Committee of the Ninth People’s Hospital Affiliated to Shanghai Jiao Tong University (approval No. SH9H-2021-A233-SB).

DDC diet mouse model

C57BL/6 male mice (8-10 weeks old) were fed a normal chow diet (NCD) supplemented with 0.1% DDC to induce ductular reaction (DR) and biliary fibrosis[24]. For the 2-8 week feeding experiment and subsequent pathological characterization, five mice per group were used to measure portal pressure and body weight at 2, 4, 6, and 8 weeks. In follow-up comparative experiments, four mice per group were sacrificed at 4 weeks for sample collection.

BDL mouse model

C57BL/6 male mice (8-10 weeks old) were anesthetized with isoflurane and subjected to a midline laparotomy (approximately 1 cm) to expose the common bile duct. Two knots were tied using 5-0 silk sutures without transecting the duct. The peritoneum was reapproximated, and the muscle layer and skin were separately sutured with 3-0 silk sutures. Sham-operated mice underwent laparotomy and bile duct dissection only. This procedure induces biliary obstruction, leading to cholestasis and PHT for comparative studies. In previous studies, we used 8 sham and 20 BDL mice; in comparative studies with the DDC diet model, we initially used 8 sham and 25 BDL mice (sample sizes based on expected survival rates and power analysis). Survival improvement measures for BDL mice included intraperitoneal vitamin K injections (50 μg/kg, once a week), switching to 4-0 silk sutures for ligation, and postoperative feeding with digestible jelly rich in sugar and water. At 4 weeks post-surgery, all surviving mice had portal pressure and body weight measured, with liver and mesentery samples collected for analysis.

CCl4 mouse model

C57BL/6 male mice (8-10 weeks old) were housed in a pathogen-free facility at 22 °C under a 12-hour light/dark cycle. Liver fibrosis was induced by intraperitoneal injection of CCl4 (1 μL/g body weight; Sigma-Aldrich, catalog No. 319961) diluted in oil, administered twice weekly for 8 or 12 weeks. Control mice received an equivalent volume of oil. At the end of the 8-week treatment period, control (oil) and 8-week CCl4-injected mice were euthanized after measuring portal pressure and body weight, with tissues harvested for analysis. The same protocol was applied to 12-week CCl4-injected mice at study termination. In prior cohorts, the control (oil) group consisted of 8 mice, whereas the 8-week and 12-week CCl4 groups each included 12 mice (sample sizes justified by prior power calculations). This configuration was maintained in comparative studies with the DDC diet model.

Measurement of portal pressure

In accordance with our previous study[8], mice were anesthetized by inhalation of isoflurane (1.5%-2%) and monitored for respiratory rate to ensure adequate anesthesia. A 23-gauge needle was carefully inserted into the portal vein. The catheter attached to the needle was connected to a pressure transducer to detect portal pressure using an ALC-MPA multi-channel biological information analysis system (Shanghai Alcott Biotech Co., Ltd.).

Biochemical analysis

Mice were sacrificed after hemodynamic measurements. Plasma was obtained from mouse blood samples by centrifugation at 1500 × g for 15 minutes at 4 °C. The serum levels of alanine aminotransferase (ALT) (catalog No. 105-020579-00), aspartate aminotransferase (catalog No. 105-020580-00), total bilirubin (T-Bil) (catalog No. 105-020584-00), direct bilirubin (D-Bil) (catalog No. 105-00021A-00), and total bile acid (TBA) (catalog No. 105-020596-00) were measured using commercial kits (Mindray, Shenzhen, China) following the manufacturer’s instructions. All assays were performed in triplicate.

Scanning electron microscopy

Mice were euthanized, and livers were harvested, perfused with phosphate-buffered saline (potential of hydrogen = 7.4) at 37 °C to maintain tissue integrity, and minced into 1 mm3 cubes. Samples were incubated in 1.5% glutaraldehyde at 4 °C overnight, washed three times with 0.05 M sodium cacodylate buffer, post-fixed with 1% osmium tetroxide for 1 hour at 4 °C, and washed three times with distilled water. Tissues were dehydrated via an ethanol series, critical point dried, mounted on stubs with copper tape, sputter-coated with 15 nm platinum, and observed under a field-emission scanning electron microscope (AURIGA®, Carl Zeiss) to assess sinusoidal fenestrae and capillarization.

Immunohistochemistry

Liver pathological morphology and portosystemic shunting were evaluated using hematoxylin and eosin (HE), Masson, and Sirius red staining protocols. For immunohistochemistry, sections underwent antigen retrieval with citrate buffer, followed by blocking of endogenous peroxidase activity with 0.3% hydrogen peroxide in methanol and preincubation with 10% normal horse serum to prevent nonspecific binding. Primary antibodies against collagen 1 (1:2500, catalog No. 67288-1-Ig, Proteintech), α-smooth muscle actin (SMA) (1:200, catalog No. ab5694, Abcam), desmin (1:4000, catalog No. 16520-1-AP, Proteintech), lymphatic vessel endothelial hyaluronan receptor 1 (LyVE-1) (1:100, catalog No. ab219556, Abcam), cluster of differentiation (CD) 34 (1:1000, catalog No. 14486-1-AP, Proteintech), von Willebrand factor (vWF) (1:200, catalog No. 27186-1-AP, Proteintech), vascular endothelial growth factor receptor 2 (VEGFR2) (1:150, catalog No. ab2349, Abcam), vascular endothelial growth factor A (VEGF-A) (1:100, catalog No. ab52917, Abcam), and CD31 (1:5000, catalog No. 11265-1-AP, Proteintech) were applied overnight at 4 °C, followed by 60-minute incubation with secondary antibodies at room temperature. Sections were counterstained with hematoxylin, dehydrated through ethanol gradients, cleared with xylene, and mounted for visualization under a fluorescence microscope to analyze protein expression and localization. Staining was quantified using ImageJ software.

Western blotting analysis

Liver and mesenteric artery tissues from mice were immediately stored at -80 °C until use. For protein extraction, samples were homogenized in radio immunoprecipitation assay buffer (Beyotime) according to the manufacturer’s protocol. Homogenates were centrifuged at 12000 × g for 15 minutes at 4 °C, and supernatants were collected to determine total protein concentration using a bicinchoninic acid assay kit (Beyotime). Equal protein amounts were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electro-transferred to polyvinylidene difluoride membranes. Membranes were probed with primary antibodies against endothelial nitric oxide synthase (eNOS) (1:1000, Cell Signaling), phosphorylated eNOS (p-eNOS) (1:1000, Affinity), and glyceraldehyde 3-phosphate dehydrogenase (1:5000, Proteintech). After washing, membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 60 minutes at room temperature and visualized using enhanced chemiluminescence detection (Millipore). Bands were quantified using densitometry (ImageJ).

Preparation and reverse transcription quantitative polymerase chain reaction

Total RNA was isolated from liver tissues using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. RNA purity and concentration were assessed via absorbance ratios at 260/280 nm and 260/230 nm using a NanoDrop spectrophotometer. First-strand complementary DNA was synthesized from 1 μg of total RNA using the PrimeScript RT Reagent Kit (Takara) with genomic DNA Eraser to eliminate genomic DNA contamination. Reverse transcription quantitative polymerase chain reaction was performed on an ABI 7900HT fast real-time polymerase chain reaction system using SYBR green master mix (Yeasen). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the endogenous control. Reactions were run in triplicate with the following thermal cycling conditions: 95 °C for 30 seconds, followed by 40 cycles of 95 °C for 5 seconds and 60 °C for 30 seconds. Melt curve analysis verified amplicon specificity. Relative gene expression levels were calculated using the 2-ΔΔCt method, normalized to GAPDH, and calibrated to control samples. The primer sequences are listed in Table 1. Primer efficiency was validated (90%-110%).

Table 1 Primer sequences.
Gene name
Sequence (5’-3’) forward
Sequence (5’-3’) reverse
TNF-α (mouse)CCCTCACACTCAGATCATCTTCTGCTACGACGTGGGCTACAG
IL-1β (mouse)GCAACTGTTCCTGAACTCAACTATCTTTTGGGGTCCGTCAACT
IL-6 (mouse)TAGTCCTTCCTACCCCAATTTCCTTGGTCCTTAGCCACTCCTTC
GAPDH (mouse)AGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA
Statistical analysis

All data are presented as mean ± SD. Experiments were conducted in a randomized (software-generated random number randomization) and blinded (code-based blinding) manner to minimize subjective bias. Normality was assessed using the Shapiro-Wilk test. Statistical differences between two groups were evaluated using an unpaired Student’s t-test, while differences among three or more groups were assessed with one-way analysis of variance. Survival curve analysis incorporated the Gehan-Breslow-Wilcoxon test and Mantel-Haenszel risk ratio estimation. Statistical significance was set at P < 0.05. Data analysis and visualization were performed using SPSS® (Version 23.0, IBM) and GraphPad Prism® (Version 7.0, GraphPad Software).

RESULTS
DDC diet mouse model (4 weeks) showed portal pressure comparable to BDL and CCl4 mouse models

Building on previous literature[19,25,26], we successfully established PHT mouse models using BDL and CCl4 methods. The timelines and procedures are shown in Figure 1A-C. CCl4 protocols vary widely across institutions, so our group standardized two durations (8 or 12 weeks) to explore PHT progression. BDL mice reached approximately 10 mmHg portal pressure by 4 weeks, far exceeding sham controls (Figure 1D), but survival dropped to just 35% post-surgery (Figure 1E). Even with modifications to the surgical approach and additional postoperative care methods, the survival rate did not improve significantly (Supplementary Figure 1). In the CCl4 mouse model, toxic effects elevated portal pressure to approximately 10 mmHg at 8 weeks, with minimal further rise at 12 weeks (Figure 1F). Survival rates hovered at 58.3%-66.6% for both groups (Figure 1G). To comprehensively characterize phenotypic changes in DDC diet mouse models, we collected data from mice fed DDC for 2, 4, 6, and 8 weeks. At 2 weeks, no differences emerged in body weight or portal pressure vs NCD controls. By 4 weeks, DDC mice showed marked weight loss compared to the NCD group, with portal pressure reaching approximately 10 mmHg (Figure 1H and I). Extending feeding to 6-8 weeks brought no additional changes, with only one death noted (Figure 1J), underscoring the model’s safety.

Figure 1
Figure 1 The 3,5-diethoxycarbonyl-1,4-dihydrocollidine diet mouse model (4 weeks) exhibited portal pressure comparable to bile duct ligation and carbon tetrachloride mouse models. A-C: Schematics of the modeling procedures and timelines for 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) diet (A), bile duct ligation (BDL) (B), and carbon tetrachloride (CCl4) mouse models (C), respectively; D and E: Portal pressure measurements and survival curve of sham (n = 8) and BDL (n = 7) groups; F and G: Portal pressure and survival curve in oil (n = 8), 8-week CCl4 (n = 7), and 12-week CCl4 (n = 8) groups; H-J: Longitudinal comparisons of body weight, portal pressure, and survival curve between normal chow diet and DDC groups at 2 (n = 5), 4 (n = 5), 6 (n = 5), and 8 (n = 4) weeks post-modeling. aP < 0.05. bP < 0.01. cP < 0.001. NCD: Normal chow diet; DDC: 3,5-diethoxycarbonyl-1,4-dihydrocollidine; BDL: Bile duct ligation; CCl4: Carbon tetrachloride; HR: Hazard ratio; CI: Confidence interval; NS: No significant.
DDC diet mouse model (4 weeks) exhibited moderate biliary fibrosis in the portal vein region

To investigate mechanisms underlying portal pressure elevation in the DDC diet mouse in comparison with other PHT animal models, we examined portal vein fibrosis via HE, Masson, and Sirius red stains. In HE staining, liver portal tracts of DDC diet mice exhibited intraductal plug formation, DR, onion-skin periductal fibrosis, and secondary biliary fibrosis. In contrast, BDL-induced bile duct hyperplasia around the portal veins was less extensive but more densely cellular. Additionally, the CCl4 mouse model showed minimal bile duct proliferation, with predominant hepatocellular ballooning changes. The DDC diet mouse model and the BDL mouse model exhibited comparable biliary fibrosis in the periductal region. Periductal fibrosis aligned closely between DDC and BDL, contrasting CCl4’s broader fibrous deposition in the portal tracts and interlobular spaces (Figure 2A). The DDC diet mouse model and the BDL mouse model exhibited comparable biliary fibrosis in the periductal region. In contrast, the CCl4-induced model predominantly showed fibrous deposition in the portal tracts and interlobular spaces (Figure 2A). Masson quantification showed comparable fibrosis across models (Figure 2B-D), although Sirius red staining revealed that DDC-induced fibrosis was moderately less severe than in the CCl4 and BDL mouse models (Figure 2E-G).

Figure 2
Figure 2 The 3,5-diethoxycarbonyl-1,4-dihydrocollidine diet mouse model (4 weeks) exhibited moderate biliary fibrosis in the portal vein region. A: Hematoxylin-eosin, Masson, and Sirius red staining of mouse livers; B-G: Statistical analysis of Masson and Sirius red staining results; H: Immunohistochemistry staining for collagen-1, α-smooth muscle actin (SMA), and desmin in mouse livers; I-Q: Statistical analysis of collagen-1, α-SMA, and desmin staining results. Sample sizes (n): 8:8 (normal chow diet vs 3,5-diethoxycarbonyl-1,4-dihydrocollidine), 8:7 (sham vs bile duct ligation), and 8:7:8 (oil vs 8-week carbon tetrachloride vs 12-week carbon tetrachloride). aP < 0.05. bP < 0.01. cP < 0.001. NS: No significant; NCD: Normal chow diet; DDC: 3,5-diethoxycarbonyl-1,4-dihydrocollidine; BDL: Bile duct ligation; CCl4: Carbon tetrachloride; HE: Hematoxylin-eosin; COL1: Collagen-1; SMA: Smooth muscle actin.

The expression levels of hepatic stellate cell (HSC) activation markers including collagen 1, α-SMA, and desmin key proteins implicated in liver fibrogenesis, were also assessed (Figure 2H). Quantification of collagen 1 protein levels showed that both CCl4 and BDL mouse models exhibit significantly increased collagen fiber deposition (Figure 2I-K). However, α-SMA and desmin staining indicated that HSC activation in the DDC diet mouse model was significantly higher than in the other two models (Figure 2L-Q). These results suggest that the DDC diet induces biliary fibrosis comparable to the other two models, contributing to portal pressure elevation and PHT-associated complications[27].

DDC diet mouse model (4 weeks) exhibited significant LSEC dysfunction

Liver vascular integrity depends on LSEC and HSC homeostasis. Shear stress is critical for LSEC function, promoting LSECs to vasodilators (e.g., nitric oxide) for sinusoidal pressure control[28]. In PHT, LSEC dysfunction involves loss of fenestrations, dysregulated paracrine factor secretion[29], impaired sinusoidal cell crosstalk, activated mechanosensitive pathways, and altered membrane proteomics, which increase intrahepatic vascular resistance (IHVR) and simulate downstream effects[1]. First, we assessed liver sinusoidal endothelial fenestration disruption using scanning electron microscopy (SEM) (Figure 3), which revealed sharp fenestrae losses in DDC, BDL, and CCl4 models (Figure 3A, C, and E), with 12-week CCl4 showing the deepest declines (Figure 3B, D, and F). There were subtle variations in eNOS protein alterations across these models. DDC preserved total eNOS but decreased the p-eNOS/total eNOS ratio (Figure 3G and H), while BDL and CCl4 reduced total eNOS (Figure 3I-M). Collectively, these results suggest dysfunctional abnormalities in LSECs. Capillarization markers LyVE-1, CD34, and vWF serve as classic markers for assessing liver sinusoidal capillarization[30], with staining shown in Figure 3N. LyVE-1 staining indicated that the DDC diet or BDL significantly suppressed LyVE-1 protein expression in hepatic sinusoids, leading to sinusoidal dysfunction. In contrast, 8-week CCl4 injection failed to stably inhibit LyVE-1 protein, whereas 12-week injection potently induced liver sinusoidal capillarization (Figure 3O, R, and U). CD34 yielded consistent results: 8-week CCl4 injection failed to stably impair liver sinusoidal function, whereas 12-week injection recapitulated dysfunction comparable to DDC diet and BDL mouse models (Figure 3P, S, and V). vWF staining revealed subtle discrepancies: 8-week CCl4 injection exacerbated LSEC dysfunction, comparable to DDC diet and BDL mouse models, with more profound impairment at 12 weeks (Figure 3Q, T, and W). Despite marker inconsistencies in these functional markers, all models disrupt LSEC homeostasis and contribute to PHT pathogenesis.

Figure 3
Figure 3 The 3,5-diethoxycarbonyl-1,4-dihydrocollidine diet mouse model (4 weeks) exhibited significant liver sinusoidal endothelial cell dysfunction. A: Scanning electron microscopy (SEM) of liver sinusoids in normal chow diet (NCD) and 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) diet mouse models; B: Statistical analysis of fenestrae number and porosity; C: SEM of liver sinusoids in sham and bile duct ligation (BDL) mouse models; D: Statistical analysis of fenestrae number and porosity; E: SEM of liver sinusoids in oil, 8-week carbon tetrachloride (CCl4), and 12-week CCl4 mouse models; F: Statistical analysis of fenestrae number and porosity; G and H: Protein expression and quantitative analysis of total endothelial nitric oxide synthase (eNOS) and phosphorylated eNOS (p-eNOS) in NCD and DDC diet mouse livers; I and J: Protein expression and quantitative analysis of total eNOS and p-eNOS in sham and BDL mouse livers; K-M: Protein expression and quantitative analysis of total eNOS and p-eNOS in oil, 8-week CCl4, and 12-week CCl4 mouse livers; N: Immunohistochemistry staining for lymphatic vessel endothelial hyaluronan receptor 1 (LyVE-1), cluster of differentiation (CD) 34, and von Willebrand factor (vWF) in livers of the three model groups; O-W: Quantitative analysis of positive staining areas for LyVE-1, CD34, and vWF. Sample sizes (n): 8:8 (normal chow diet vs 3,5-diethoxycarbonyl-1,4-dihydrocollidine), 8:7 (sham vs bile duct ligation), and 8:7:8 (oil vs 8-week carbon tetrachloride vs 12-week carbon tetrachloride). aP < 0.05. bP < 0.01. cP < 0.001. NS: No significant; NCD: Normal chow diet; DDC: 3,5-diethoxycarbonyl-1,4-dihydrocollidine; BDL: Bile duct ligation; CCl4: Carbon tetrachloride; eNOS: Endothelial nitric oxide synthase; p-eNOS: Phosphorylated endothelial nitric oxide synthase; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase; LyVE-1: Lymphatic vessel endothelial hyaluronan receptor 1; vWF: Von Willebrand factor; CD: Cluster of differentiation.
Dysfunction DDC diet induces abnormal proliferation of intrahepatic vascular structures and extrahepatic portosystemic shunting

Contrary to expectations, augmented intrahepatic angiogenesis may represent a compensatory repair mechanism, yet it exacerbates liver pathology without alleviating PHT[31]. This paradox arises because newly formed vasculature diverges from the sinusoidal vascular system, failing to enhance blood perfusion in cirrhotic livers. Instead, these abnormal vessels disrupt hepatocellular homeostasis, deteriorate liver injury, and potentiate fibrogenesis and inflammation[32]. Vascular markers VEGFR2, CD31, and VEGF-A revealed that the DDC diet, BDL, and CCl4 injection all significantly promoted intrahepatic vascular proliferation in the portal vein region at sampling (Figure 4A-J). CD31 staining quantified BDL as marginally less pronounced than in the other two models (Figure 4C, F, and I). Intriguingly, VEGFR2 and VEGF-A expression levels were elevated in the 12-week CCl4 injection group compared to the oil group, validating the ligand-receptor interplay between VEGF-A and VEGFR2 (Figure 4H and J). Additionally, we observed extensive extrahepatic portosystemic shunting (Figure 4J-M), reflecting the PHT pathology and thus validating model establishment. These collateral vessels augment blood inflow into the liver, exacerbating portal pressure and precipitating other complications.

Figure 4
Figure 4 The 3,5-diethoxycarbonyl-1,4-dihydrocollidine diet induces abnormal proliferation of intrahepatic vascular structures and extrahepatic portosystemic shunting. A: Immunohistochemistry (IHC) staining for vascular endothelial growth factor receptor 2, cluster of differentiation 31, and vascular endothelial growth factor A in mouse livers; B-J: Statistical analysis of positive staining areas from IHC results; K-M: Hematoxylin-eosin staining of mesenteric tissues. Sample sizes (n): 8:8 (normal chow diet vs 3,5-diethoxycarbonyl-1,4-dihydrocollidine), 8:7 (sham vs bile duct ligation), and 8:7:8 (oil vs 8-week carbon tetrachloride vs 12-week carbon tetrachloride). bP < 0.01. cP < 0.001. NS: No significant; NCD: Normal chow diet; DDC: 3,5-diethoxycarbonyl-1,4-dihydrocollidine; BDL: Bile duct ligation; CCl4: Carbon tetrachloride; CD: Cluster of differentiation; VEGFR2: Vascular endothelial growth factor receptor 2; VEGF-A: Vascular endothelial growth factor A.
DDC-induced intrahepatic inflammatory responses contribute to elevated portal pressure

Hepatocyte damage in CLD causes injury, triggering a pro-inflammatory state in parenchymal and non-parenchymal liver cell types, leading to liver fibrosis, cirrhosis, PHT, and hepatic failure[33]. Based on macrophage marker F4/80 detection in mice (Figure 5A), the DDC diet mouse model exhibited the most robust inflammatory cell infiltration (Figure 5B). To evaluate hepatic inflammation and injury, we assessed inflammatory cytokines and liver enzymes across the three models. In the CCl4 mouse model, tumor necrosis factor-α elevation was marginally less pronounced than in the other two models, while interleukin-1β activation showed no significant inter-model differences (Figure 5C-G). Notably, interleukin-6 exhibited the most substantial increase in the BDL mouse model (Figure 5C, E, and G). In the DDC diet mouse model, ALT demonstrated the most pronounced elevation among liver enzymes (Figure 5D). In the BDL mouse model, serum T-Bil and D-Bil levels increased by nearly three orders of magnitude, potentially accounting for the higher mortality rate (Figure 5F). Under CCl4 intoxication, hepatic tissues exhibited a nearly 100-fold increase in TBA levels (Figure 5H). Despite extensive inflammatory cell infiltration, upregulation of inflammatory cytokines and liver enzymes remained relatively modest in the DDC model, warranting further mechanistic exploration.

Figure 5
Figure 5 The 3,5-diethoxycarbonyl-1,4-dihydrocollidine-induced intrahepatic inflammatory responses contribute to elevated portal pressure. A: Immunohistochemistry staining for F4/80 in mouse livers; B: Statistical analysis of F4/80-positive staining areas; C and D: Detection of hepatic inflammatory index messenger RNA and liver enzymes in normal chow diet and 3,5-diethoxycarbonyl-1,4-dihydrocollidine groups; E and F: Detection of hepatic inflammatory index messenger RNA and liver enzymes in sham and bile duct ligation groups; G and H: Detection of hepatic inflammatory index messenger RNA and liver enzymes in oil, 8-week carbon tetrachloride (CCl4), and 12-week CCl4 mouse models. Sample sizes (n): 8:8 (normal chow diet vs 3,5-diethoxycarbonyl-1,4-dihydrocollidine), 8:7 (sham vs bile duct ligation), and 8:7:8 (oil vs 8-week carbon tetrachloride vs 12-week carbon tetrachloride). bP < 0.01. cP < 0.001. NS: No significant; NCD: Normal chow diet; DDC: 3,5-diethoxycarbonyl-1,4-dihydrocollidine; BDL: Bile duct ligation; CCl4: Carbon tetrachloride; IL: Interleukin; TNF: Tumor necrosis factor; ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; T-Bil: Total bilirubin; D-Bil: Direct bilirubin; TBA: Total bile acid.
DDC diet induces DRs comparable to those in the BDL model

DR, a periportal compensatory response to various liver injuries, including biliary diseases, viral hepatitis, non-alcoholic fatty liver disease, and acute fulminant liver failure[34], appeared comparable in DDC and BDL portal areas. Cytokeratin 7 (CK7) analysis showed DDC surpassing the BDL mouse model. Moreover, CK7 protein analysis revealed that DR induced by the DDC diet was even higher than in the BDL model, a severe model (Figure 6A-G). Focusing on the CCl4 model, the advantages of the DDC diet-induced biliary disease-related PHT model become more prominent. Although 12 weeks of CCl4 injection can stably induce DR in the portal area, 8 weeks of CCl4 failed to significantly trigger biliary epithelial hyperplasia as assessed by CK7 (Figure 6H-J). Studies have shown that DR is associated with PHT and liver disease prognosis[35], and the DDC diet mouse model outperforms BDL and CCl4 models in inducing DR and biliary epithelial proliferative responses, particularly in short-term modeling. The DDC-induced model may therefore be used to study PHT pathogenesis primarily involving biliary disorders.

Figure 6
Figure 6 The 3,5-diethoxycarbonyl-1,4-dihydrocollidine diet induces ductular reactions comparable to those in the bile duct ligation model. A: Immunohistochemistry staining for cytokeratin (CK) 7, CK19, and SOX9 in mouse livers; B-J: Statistical analysis of positive staining areas for CK7, CK19, and SOX9. Sample sizes (n): 8:8 (normal chow diet vs 3,5-diethoxycarbonyl-1,4-dihydrocollidine), 8:7 (sham vs bile duct ligation), and 8:7:8 (oil vs 8-week carbon tetrachloride vs 12-week carbon tetrachloride). bP < 0.01. cP < 0.001. NS: No significant; NCD: Normal chow diet; DDC: 3,5-diethoxycarbonyl-1,4-dihydrocollidine; BDL: Bile duct ligation; CCl4: Carbon tetrachloride; CK: Cytokeratin.
DISCUSSION

Cholestasis is a pathological condition defined by the obstruction of bile flow from the liver to the duodenum, often due to reduced bile-forming capacity, defective secretion by hepatocytes or cholangiocytes, or mechanical blockage of bile ducts[36]. Among cholestatic liver diseases, PBC and primary sclerosing cholangitis (PSC) are major causes of CLD in adults, leading to biliary cirrhosis, end-stage liver disease, and the need for liver transplantation[37,38]. Due to limitations in studying human patients, rodent models replicating cholestatic histopathology have been developed. Common models include BDL and diet-based approaches (e.g., DDC diet). Although both are validated for PBC studies, the DDC diet model is particularly valuable for investigating DR in liver regeneration[39]. In clinical PBC, early inflammation spreads to the periportal area[40], with cholangiocyte proliferation acting as a “pacemaker” for periportal fibrosis[41] and PHT complications[42]. This pattern mirrors our DDC mouse model findings, where DR is comparable to BDL and hyperproliferative cholangiocytes surround the portal vein, triggering early PHT. Notably, portal pressure in 4-week DDC mice reaches approximately 10 mmHg, comparable to BDL and CCl4 models. However, due to natural aversion to toxins, mice reduce DDC intake over time, preventing further portal pressure increases at 6-8 weeks differing slightly from long-term PBC progression. Thus, we selected the 4-week DDC model for PHT pathogenesis studies, as it shows peak portal pressure and the greatest difference from controls.

Classic PHT syndromes involve fibrosis from HSC activation[32], liver sinusoidal dysfunction[43], angiogenic effects, including vascular endothelial cell growth and proliferation that exacerbate intrahepatic resistance and fibrosis[34], and liver inflammatory infiltration with enzyme abnormalities due to liver injury. Most classical animal models of PHT reproduce similar pathological phenotypes. In fibrosis, classic BDL and CCl4 mouse models show similar collagen deposition but in different locations. The DDC model mirrors BDL in portal region deposition but with less overall fibrosis, aligning with non-cirrhotic PHT in clinical PBC. However, HSC activation in the DDC mouse model is equivalent to that observed in the BDL and CCl4 models, with even higher fold changes in the expression of the marker desmin. These comparative results indicate that significant liver fibrosis or cirrhosis has been established in the DDC diet mouse model, substantially increasing IHVR and thereby elevating portal pressure.

As the primary channel for fluid and substance exchange in the liver, the fenestrations of LSECs, along with their morphological and functional homeostasis, are critical factors in maintaining portal pressure[32]. Recent studies on LSEC function and homeostasis have further confirmed their pivotal role in PHT. For instance, increased expression of Cxcl1 in LSECs recruits neutrophils, generates sinusoidal microthrombi, and promotes PHT[18]. Additionally, endothelial p300 promotes PHT and hepatic fibrosis through C-C motif chemokine ligand 2-mediated angiocrine signaling[19]. In this study, electron microscopy revealed that the DDC diet mouse model effectively induces LSEC capillarization, characterized by reductions in both the number of fenestrae and the total fenestral area. These changes were comparable to those in the BDL and CCl4 models. Furthermore, as reported in previous studies[44], loss of LyVE-1 expression, leading to increased α-SMA a sign of LSEC dysfunction was detected in all three models. Meanwhile, significant upregulation of LSEC capillarization markers, such as CD34 (indicated by single-cell sequencing[45] and vWF (associated with sinusoidal contraction in hepatitis C virus induced liver fibrosis[46]), was observed in all three models. eNOS, which mediates LSEC-derived nitric oxide, serves as both a classic marker of LSEC capillarization and a key protein for LSEC function. Consistent with prior reports, the DDC mouse model showed a decreased ratio of p-eNOS to total eNOS, which, alongside vascular cell adhesion molecule 1 and intercellular adhesion molecule 1, induces LSEC dysfunction[44]. In contrast, the BDL and CCl4 mouse models exhibited a direct reduction in total eNOS levels, another indicator of impaired LSEC function and worsening PHT[47]. Despite these differing patterns of eNOS alterations across models, all models impair eNOS function, thereby exacerbating LSEC dysfunction and PHT. Notably, pharmacological rescue of eNOS protein signaling pathway activation alleviates the pathological phenotypes of LSECs and PHT[48,49].

Abnormal angiogenesis in the portal area, driven by the proliferation of vascular endothelial cells, exacerbates fibrosis[50]. For example, pharmacological inhibition of VEGFR2 protein[13] or its related signaling pathways[11] suppresses abnormal hepatic vascularization and ameliorates PHT phenotypes. In this study, the DDC mouse model exhibited even more pronounced portal vascular proliferation than the other two models. Similar to the BDL and CCl4 models, DDC diet-induced liver disease triggered extensive portosystemic shunting a hallmark of PHT providing compelling evidence of elevated portal pressure. Furthermore, in the DDC diet mouse model, we observed significantly increased infiltration of inflammatory cells and DR phenotypes compared to the NCD group, with more pronounced elevations than in the other two models. This represents a key advantage of the DDC model to serve as an animal model for studying clinical diseases such as biliary tract disorders or immune-related cirrhotic PHT.

Over the years, animal models of PHT have evolved from initial rat-based systems to more advanced mouse-derived models. However, pathological characteristics vary between species. For instance, BDL in rats produces significant, even palpable, liver cirrhosis, whereas BDL in mice leads to milder cirrhosis but more frequent extensive liver necrosis a feature rarely seen in rat models (Supplementary Figure 1A). Furthermore, reviews of relevant literature and our team’s research indicate that BDL mouse models, when applied to clinical disease studies[51], suffer from low 4-week survival rates, limiting their use in mechanistic investigations involving drugs, proteins, or genetic interventions to alleviate PHT. The potential for survivor bias remains uncertain. Despite our efforts to enhance survival through procedural adjustments such as switching ligation sutures from 5-0 to 4-0, administering weekly vitamin K1 injections for hemostasis, and providing postoperative feeding with easily digestible jelly (Supplementary Figure 1B); however, these measures failed to significantly improve 4-week outcomes in BDL mice. In stark contrast, the DDC-induced biliary model offers substantially higher survival rates, highlighting a major advantage for advancing PHT research with DDC mouse models.

Another PHT model the CCl4 mouse model is favored by many researchers for its simplicity and reliable success rate[52]. However, compared to the DDC diet model, the entirely feed-based method of the DDC diet is even more straight forward. The DDC diet model achieves portal pressure levels comparable to those in the CCl4 model at 4 weeks, at least 4 weeks earlier than CCl4 injection. Additionally, DR cannot be stably increased for 8 weeks in the CCl4 model, and even intraperitoneal injection-induced DR at 12 weeks is slightly inferior to that in the BDL and DDC diet models. This limits the CCl4 model’s utility as an animal model for studying biliary-related PHT syndromes.

In this study, we analyzed the advantages and disadvantages of three PHT animal models. Among them, the DDC mouse model though not originally developed for PHT research was introduced to address the insufficient etiological coverage of existing PHT models. The Mdr2-knockout mouse model, a classic for studying DR-associated PSC, also exhibits PHT pathological phenotypes, as reported in previous studies[21]. While the Mdr2-knockout model retains notable value, with ongoing exploration of its phenotypic variations to identify distinct PHT pathophysiological mechanisms and inform clinical treatments, its modeling and long-term maintenance costs are significantly higher than those of the DDC model. It should be acknowledged that this study had inherent limitations: It did not explore variables like mouse strain, gender, or age, and mouse size prevented measuring systemic hemodynamics, focusing only on intrahepatic PHT changes. Future research should address these, such as validating DDC in diverse strains or combining with genetic models for broader PHT etiologies. Additionally, while DDC excels in short-term biliary PHT, long-term studies could assess progression to cirrhosis. Overall, the DDC model advances preclinical PHT research by overcoming key limitations of BDL and CCl4, potentially informing therapies for cholestatic diseases.

CONCLUSION

This study demonstrates that the DDC diet mouse model effectively recapitulates PHT, with portal pressure reaching approximately 10 mmHg at 4 weeks comparable to classic BDL and CCl4 models. Notably, the DDC model exhibits a 100% 4-week survival rate, surpassing BDL (35%) and exceeding CCl4 (58.3%-66.6%). Mechanistically, DDC induces biliary fibrosis in the portal region similar to BDL but with less deposition than CCl4, while showing more pronounced HSC activation (desmin). SEM revealed comparable reductions in liver sinusoidal fenestrae and capillarization across models, though eNOS regulation differed. The DDC model also induced robust DR and inflammatory infiltration, outperforming BDL and CCl4 in short-term modeling, alongside extensive extrahepatic portosystemic shunting. Its feed-based administration offers operational simplicity compared to surgical (BDL) or injectable (CCl4) methods. These findings establish the DDC model as a superior tool for biliary disorder-related PHT research, integrating pathological relevance and high survival. Future studies should explore its application in diverse etiologies to further advance therapeutic development.

References
1.  Gracia-Sancho J, Marrone G, Fernández-Iglesias A. Hepatic microcirculation and mechanisms of portal hypertension. Nat Rev Gastroenterol Hepatol. 2019;16:221-234.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 85]  [Cited by in RCA: 201]  [Article Influence: 28.7]  [Reference Citation Analysis (0)]
2.  GBD 2017 Cirrhosis Collaborators. The global, regional, and national burden of cirrhosis by cause in 195 countries and territories, 1990-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet Gastroenterol Hepatol. 2020;5:245-266.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1184]  [Cited by in RCA: 1137]  [Article Influence: 189.5]  [Reference Citation Analysis (5)]
3.  Huang DQ, Terrault NA, Tacke F, Gluud LL, Arrese M, Bugianesi E, Loomba R. Global epidemiology of cirrhosis - aetiology, trends and predictions. Nat Rev Gastroenterol Hepatol. 2023;20:388-398.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 194]  [Cited by in RCA: 516]  [Article Influence: 172.0]  [Reference Citation Analysis (0)]
4.  Boyer-Diaz Z, Aristu-Zabalza P, Andrés-Rozas M, Robert C, Ortega-Ribera M, Fernández-Iglesias A, Broqua P, Junien JL, Wettstein G, Bosch J, Gracia-Sancho J. Pan-PPAR agonist lanifibranor improves portal hypertension and hepatic fibrosis in experimental advanced chronic liver disease. J Hepatol. 2021;74:1188-1199.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 39]  [Cited by in RCA: 118]  [Article Influence: 23.6]  [Reference Citation Analysis (0)]
5.  Asada S, Kaji K, Nishimura N, Koizumi A, Matsuda T, Tanaka M, Yorioka N, Sato S, Kitagawa K, Namisaki T, Akahane T, Yoshiji H. Tofogliflozin Delays Portal Hypertension and Hepatic Fibrosis by Inhibiting Sinusoidal Capillarization in Cirrhotic Rats. Cells. 2024;13:538.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 14]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
6.  Zhao Z, Fan Q, Zhang C, Zheng L, Lin J, Chen M, Wu G, Li H, Huo H, Zhao Q, Luo M. Imperatorin attenuates CCl(4)-induced cirrhosis and portal hypertension by improving vascular remodeling and profibrogenic pathways. Eur J Pharmacol. 2024;980:176833.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 4]  [Article Influence: 2.0]  [Reference Citation Analysis (0)]
7.  Bosch J, Iwakiri Y. The portal hypertension syndrome: etiology, classification, relevance, and animal models. Hepatol Int. 2018;12:1-10.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 52]  [Cited by in RCA: 87]  [Article Influence: 9.7]  [Reference Citation Analysis (0)]
8.  Wu G, Fan Q, Chen M, Luo G, Wu Z, Zhao J, Lin J, Zhang C, Li H, Qi X, Huo H, Zheng L, Luo M. Activation of AMP-activated Protein Kinase by Metformin Inhibits Dedifferentiation of Platelet-derived Growth Factor-BB-induced Vascular Smooth Muscle Cells to Improve Arterial Remodeling in Cirrhotic Portal Hypertension. Cell Mol Gastroenterol Hepatol. 2025;19:101487.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 3]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
9.  Hu L, Su L, Dong Z, Wu Y, Lv Y, George J, Wang J. AMPK agonist AICAR ameliorates portal hypertension and liver cirrhosis via NO pathway in the BDL rat model. J Mol Med (Berl). 2019;97:423-434.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 12]  [Cited by in RCA: 29]  [Article Influence: 4.1]  [Reference Citation Analysis (0)]
10.  Tanaka M, Jeong J, Thomas C, Zhang X, Zhang P, Saruwatari J, Kondo R, McConnell MJ, Utsumi T, Iwakiri Y. The Sympathetic Nervous System Promotes Hepatic Lymphangiogenesis, which Is Protective Against Liver Fibrosis. Am J Pathol. 2023;193:2182-2202.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 8]  [Article Influence: 2.7]  [Reference Citation Analysis (11)]
11.  Noah AA, El-Mezayen NS, El-Ganainy SO, Darwish IE, Afify EA. Reversal of fibrosis and portal hypertension by Empagliflozin treatment of CCl(4)-induced liver fibrosis: Emphasis on gal-1/NRP-1/TGF-β and gal-1/NRP-1/VEGFR2 pathways. Eur J Pharmacol. 2023;959:176066.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 10]  [Reference Citation Analysis (0)]
12.  Gracia-Sancho J, Manicardi N, Ortega-Ribera M, Maeso-Díaz R, Guixé-Muntet S, Fernández-Iglesias A, Hide D, García-Calderó H, Boyer-Díaz Z, Contreras PC, Spada A, Bosch J. Emricasan Ameliorates Portal Hypertension and Liver Fibrosis in Cirrhotic Rats Through a Hepatocyte-Mediated Paracrine Mechanism. Hepatol Commun. 2019;3:987-1000.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 25]  [Cited by in RCA: 47]  [Article Influence: 6.7]  [Reference Citation Analysis (1)]
13.  Fan Q, Wu G, Chen M, Luo G, Wu Z, Huo H, Li H, Zheng L, Luo M. Cediranib ameliorates portal hypertensive syndrome via inhibition of VEGFR-2 signaling in cirrhotic rats. Eur J Pharmacol. 2024;964:176278.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 7]  [Cited by in RCA: 8]  [Article Influence: 4.0]  [Reference Citation Analysis (0)]
14.  Luo G, Wu Z, Fan Q, Zhang C, Lin J, Li H, Zhao J, Huo H, Qi X, Wu G, Chen M, Yu J, Zheng L, Luo M. S-Allyl-Cysteine Ameliorates Cirrhotic Portal Hypertension by Enhancing Lymphangiogenesis via a VEGF-C-Independent Manner. Liver Int. 2025;45:e70024.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 4]  [Reference Citation Analysis (5)]
15.  Chen M, Zhao JB, Wu GB, Wu ZH, Luo GQ, Zhao ZF, Zhang CH, Lin JY, Li HJ, Qi XL, Huo HZ, Tuersun A, Fan Q, Zheng L, Luo M. Platelet activation relieves liver portal hypertension via the lymphatic system though the classical vascular endothelial growth factor receptor 3 signaling pathway. World J Gastroenterol. 2025;31:100194.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in CrossRef: 1]  [Cited by in RCA: 3]  [Article Influence: 3.0]  [Reference Citation Analysis (4)]
16.  Zhu CP, Liu SQ, Wang KQ, Xiong HL, Aristu-Zabalza P, Boyer-Díaz Z, Feng JF, Song SH, Luo C, Chen WS, Zhang X, Dong WH, Gracia-Sancho J, Xie WF. Targeting 5-Hydroxytryptamine Receptor 1A in the Portal Vein to Decrease Portal Hypertension. Gastroenterology. 2024;167:993-1007.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 3]  [Cited by in RCA: 6]  [Article Influence: 3.0]  [Reference Citation Analysis (0)]
17.  De Gendt K, Verhoeven G. Tissue- and cell-specific functions of the androgen receptor revealed through conditional knockout models in mice. Mol Cell Endocrinol. 2012;352:13-25.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 91]  [Cited by in RCA: 90]  [Article Influence: 6.4]  [Reference Citation Analysis (0)]
18.  Hilscher MB, Sehrawat T, Arab JP, Zeng Z, Gao J, Liu M, Kostallari E, Gao Y, Simonetto DA, Yaqoob U, Cao S, Revzin A, Beyder A, Wang RA, Kamath PS, Kubes P, Shah VH. Mechanical Stretch Increases Expression of CXCL1 in Liver Sinusoidal Endothelial Cells to Recruit Neutrophils, Generate Sinusoidal Microthombi, and Promote Portal Hypertension. Gastroenterology. 2019;157:193-209.e9.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 86]  [Cited by in RCA: 192]  [Article Influence: 27.4]  [Reference Citation Analysis (1)]
19.  Gao J, Wei B, Liu M, Hirsova P, Sehrawat TS, Cao S, Hu X, Xue F, Yaqoob U, Kang N, Cui H, Pomerantz WCK, Kostallari E, Shah VH. Endothelial p300 Promotes Portal Hypertension and Hepatic Fibrosis Through C-C Motif Chemokine Ligand 2-Mediated Angiocrine Signaling. Hepatology. 2021;73:2468-2483.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 30]  [Cited by in RCA: 81]  [Article Influence: 16.2]  [Reference Citation Analysis (0)]
20.  Ginès P, Krag A, Abraldes JG, Solà E, Fabrellas N, Kamath PS. Liver cirrhosis. Lancet. 2021;398:1359-1376.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 211]  [Cited by in RCA: 1092]  [Article Influence: 218.4]  [Reference Citation Analysis (3)]
21.  Ikenaga N, Liu SB, Sverdlov DY, Yoshida S, Nasser I, Ke Q, Kang PM, Popov Y. A new Mdr2(-/-) mouse model of sclerosing cholangitis with rapid fibrosis progression, early-onset portal hypertension, and liver cancer. Am J Pathol. 2015;185:325-334.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 67]  [Cited by in RCA: 81]  [Article Influence: 7.4]  [Reference Citation Analysis (0)]
22.  O'Hara SP, Splinter PL, Felzen A, Turner CA, Morgenthaler OT, Gores GJ, LaRusso NF. Differential MYC Phosphorylation Drives the Divergent Cholangiocyte Response to Stress. Cell Mol Gastroenterol Hepatol. 2025;19:101547.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 1]  [Article Influence: 1.0]  [Reference Citation Analysis (0)]
23.  Wen M, Liu Y, Chen R, He P, Wu F, Li R, Lin Y. Geniposide suppresses liver injury in a mouse model of DDC-induced sclerosing cholangitis. Phytother Res. 2021;35:3799-3811.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 5]  [Cited by in RCA: 21]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
24.  Zhang J, Lyu Z, Li B, You Z, Cui N, Li Y, Li Y, Huang B, Chen R, Chen Y, Peng Y, Fang J, Wang Q, Miao Q, Tang R, Gershwin ME, Lian M, Xiao X, Ma X. P4HA2 induces hepatic ductular reaction and biliary fibrosis in chronic cholestatic liver diseases. Hepatology. 2023;78:10-25.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 4]  [Cited by in RCA: 36]  [Article Influence: 12.0]  [Reference Citation Analysis (0)]
25.  Klein S, Rick J, Lehmann J, Schierwagen R, Schierwagen IG, Verbeke L, Hittatiya K, Uschner FE, Manekeller S, Strassburg CP, Wagner KU, Sayeski PP, Wolf D, Laleman W, Sauerbruch T, Trebicka J. Janus-kinase-2 relates directly to portal hypertension and to complications in rodent and human cirrhosis. Gut. 2017;66:145-155.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 50]  [Cited by in RCA: 57]  [Article Influence: 6.3]  [Reference Citation Analysis (0)]
26.  Rampa DR, Feng H, Allur-Subramaniyan S, Shim K, Pekcec A, Lee D, Doods H, Wu D. Kinin B1 receptor blockade attenuates hepatic fibrosis and portal hypertension in chronic liver diseases in mice. J Transl Med. 2022;20:590.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 9]  [Reference Citation Analysis (0)]
27.  Guixé-Muntet S, Zhu CP, Xie WF, Gracia-Sancho J. Novel therapeutics for portal hypertension and fibrosis in chronic liver disease. Pharmacol Ther. 2020;215:107626.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 9]  [Cited by in RCA: 20]  [Article Influence: 3.3]  [Reference Citation Analysis (0)]
28.  Felli E, Selicean S, Guixé-Muntet S, Wang C, Bosch J, Berzigotti A, Gracia-Sancho J. Mechanobiology of portal hypertension. JHEP Rep. 2023;5:100869.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 27]  [Reference Citation Analysis (0)]
29.  Lorenz L, Axnick J, Buschmann T, Henning C, Urner S, Fang S, Nurmi H, Eichhorst N, Holtmeier R, Bódis K, Hwang JH, Müssig K, Eberhard D, Stypmann J, Kuss O, Roden M, Alitalo K, Häussinger D, Lammert E. Mechanosensing by β1 integrin induces angiocrine signals for liver growth and survival. Nature. 2018;562:128-132.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 79]  [Cited by in RCA: 135]  [Article Influence: 16.9]  [Reference Citation Analysis (0)]
30.  Hwang JH, Heo W, Park JI, Kim KM, Oh HT, Yoo GD, Park J, Shin S, Do Y, Jeong MG, Hwang ES, Hong JH. Endothelial TAZ inhibits capillarization of liver sinusoidal endothelium and damage-induced liver fibrosis via nitric oxide production. Theranostics. 2023;13:4182-4196.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in RCA: 32]  [Reference Citation Analysis (0)]
31.  Kostallari E, Shah VH. Pericytes in the Liver. Adv Exp Med Biol. 2019;1122:153-167.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 12]  [Cited by in RCA: 35]  [Article Influence: 5.0]  [Reference Citation Analysis (2)]
32.  Iwakiri Y, Trebicka J. Portal hypertension in cirrhosis: Pathophysiological mechanisms and therapy. JHEP Rep. 2021;3:100316.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 73]  [Cited by in RCA: 119]  [Article Influence: 23.8]  [Reference Citation Analysis (36)]
33.  Taru V, Szabo G, Mehal W, Reiberger T. Inflammasomes in chronic liver disease: Hepatic injury, fibrosis progression and systemic inflammation. J Hepatol. 2024;81:895-910.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 14]  [Cited by in RCA: 160]  [Article Influence: 80.0]  [Reference Citation Analysis (0)]
34.  Ceci L, Gaudio E, Kennedy L. Cellular Interactions and Crosstalk Facilitating Biliary Fibrosis in Cholestasis. Cell Mol Gastroenterol Hepatol. 2024;17:553-565.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 1]  [Cited by in RCA: 11]  [Article Influence: 5.5]  [Reference Citation Analysis (0)]
35.  Hamesch K, Guldiken N, Aly M, Hüser N, Hartmann D, Rufat P, Ziol M, Remih K, Lurje G, Scheiner B, Trautwein C, Mandorfer M, Reiberger T, Mueller S, Bruns T, Nahon P, Strnad P. Serum keratin 19 (CYFRA21-1) links ductular reaction with portal hypertension and outcome of various advanced liver diseases. BMC Med. 2020;18:336.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 3]  [Cited by in RCA: 8]  [Article Influence: 1.3]  [Reference Citation Analysis (0)]
36.  Lazaridis KN, LaRusso NF. The Cholangiopathies. Mayo Clin Proc. 2015;90:791-800.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 138]  [Cited by in RCA: 165]  [Article Influence: 15.0]  [Reference Citation Analysis (39)]
37.  Nayagam JS, Pereira SP, Devlin J, Harrison PM, Joshi D. Controversies in the management of primary sclerosing cholangitis. World J Hepatol. 2016;8:265-272.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 7]  [Cited by in RCA: 7]  [Article Influence: 0.7]  [Reference Citation Analysis (0)]
38.  Selmi C, Bowlus CL, Gershwin ME, Coppel RL. Primary biliary cirrhosis. Lancet. 2011;377:1600-1609.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 229]  [Cited by in RCA: 249]  [Article Influence: 16.6]  [Reference Citation Analysis (0)]
39.  Mariotti V, Strazzabosco M, Fabris L, Calvisi DF. Animal models of biliary injury and altered bile acid metabolism. Biochim Biophys Acta Mol Basis Dis. 2018;1864:1254-1261.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 76]  [Cited by in RCA: 138]  [Article Influence: 15.3]  [Reference Citation Analysis (0)]
40.  Carey EJ, Ali AH, Lindor KD. Primary biliary cirrhosis. Lancet. 2015;386:1565-1575.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 357]  [Cited by in RCA: 412]  [Article Influence: 37.5]  [Reference Citation Analysis (0)]
41.  Penz-Österreicher M, Österreicher CH, Trauner M. Fibrosis in autoimmune and cholestatic liver disease. Best Pract Res Clin Gastroenterol. 2011;25:245-258.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 69]  [Cited by in RCA: 63]  [Article Influence: 4.2]  [Reference Citation Analysis (0)]
42.  Imam MH, Sinakos E, Gossard AA, Kowdley KV, Luketic VA, Edwyn Harrison M, McCashland T, Befeler AS, Harnois D, Jorgensen R, Petz J, Keach J, DeCook AC, Enders F, Lindor KD. High-dose ursodeoxycholic acid increases risk of adverse outcomes in patients with early stage primary sclerosing cholangitis. Aliment Pharmacol Ther. 2011;34:1185-1192.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 67]  [Cited by in RCA: 64]  [Article Influence: 4.3]  [Reference Citation Analysis (0)]
43.  Gao J, Lan T, Kostallari E, Guo Y, Lai E, Guillot A, Ding B, Tacke F, Tang C, Shah VH. Angiocrine signaling in sinusoidal homeostasis and liver diseases. J Hepatol. 2024;81:543-561.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 55]  [Cited by in RCA: 49]  [Article Influence: 24.5]  [Reference Citation Analysis (0)]
44.  Guo Q, Furuta K, Islam S, Caporarello N, Kostallari E, Dielis K, Tschumperlin DJ, Hirsova P, Ibrahim SH. Liver sinusoidal endothelial cell expressed vascular cell adhesion molecule 1 promotes liver fibrosis. Front Immunol. 2022;13:983255.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 58]  [Article Influence: 14.5]  [Reference Citation Analysis (0)]
45.  Su T, Yang Y, Lai S, Jeong J, Jung Y, McConnell M, Utsumi T, Iwakiri Y. Single-Cell Transcriptomics Reveals Zone-Specific Alterations of Liver Sinusoidal Endothelial Cells in Cirrhosis. Cell Mol Gastroenterol Hepatol. 2021;11:1139-1161.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 89]  [Cited by in RCA: 149]  [Article Influence: 24.8]  [Reference Citation Analysis (0)]
46.  Sun LJ, Yu JW, Shi YG, Zhang XY, Shu MN, Chen MY. Hepatitis C virus core protein induces dysfunction of liver sinusoidal endothelial cell by down-regulation of silent information regulator 1. J Med Virol. 2018;90:926-935.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 13]  [Cited by in RCA: 21]  [Article Influence: 2.6]  [Reference Citation Analysis (0)]
47.  Chen T, Shi Z, Zhao Y, Meng X, Zhao S, Zheng L, Han X, Hu Z, Yao Q, Lin H, Du X, Zhang K, Han T, Hong W. LncRNA Airn maintains LSEC differentiation to alleviate liver fibrosis via the KLF2-eNOS-sGC pathway. BMC Med. 2022;20:335.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Full Text (PDF)]  [Cited by in Crossref: 2]  [Cited by in RCA: 39]  [Article Influence: 9.8]  [Reference Citation Analysis (0)]
48.  Vairappan B, Wright G, M S, Ravikumar TS. Candesartan cilexetil ameliorates NOSTRIN-NO dependent portal hypertension in cirrhosis and ACLF. Eur J Pharmacol. 2023;958:176010.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 6]  [Cited by in RCA: 8]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
49.  Luo M, Du Y, Liu X, Zhang S, Zhu W, Liu K, Ren X, Zhang N. Fecal microbiota transplantation alleviates cirrhotic portal hypertension in rats via butyrate-mediated HDAC3 inhibition and PI3K/Akt/eNOS signaling regulation. Eur J Pharmacol. 2025;1002:177781.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 2]  [Cited by in RCA: 7]  [Article Influence: 7.0]  [Reference Citation Analysis (0)]
50.  Gana JC, Serrano CA, Ling SC. Angiogenesis and portal-systemic collaterals in portal hypertension. Ann Hepatol. 2016;15:303-313.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 15]  [Cited by in RCA: 24]  [Article Influence: 2.7]  [Reference Citation Analysis (0)]
51.  Jeong J, Hsu SJ, Horikami D, Utsumi T, Yang Y, Arefyev N, Zhang X, Cai SY, Boyer JL, Garcia-Milan R, Tanaka M, McConnell MJ, Huang HC, Iwakiri Y. Liver Lymphatic Dysfunction as a Driver of Fibrosis and Cirrhosis Progression. bioRxiv. 2025;2025.01.11.632552.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in RCA: 1]  [Reference Citation Analysis (0)]
52.  Königshofer P, Brusilovskaya K, Schwabl P, Reiberger T. Animal models of portal hypertension. Biochim Biophys Acta Mol Basis Dis. 2019;1865:1019-1030.  [RCA]  [PubMed]  [DOI]  [Full Text]  [Cited by in Crossref: 16]  [Cited by in RCA: 27]  [Article Influence: 3.4]  [Reference Citation Analysis (0)]
Footnotes

Provenance and peer review: Unsolicited article; Externally peer reviewed.

Peer-review model: Single blind

Specialty type: Gastroenterology and hepatology

Country of origin: China

Peer-review report’s classification

Scientific Quality: Grade B, Grade B, Grade B

Novelty: Grade A, Grade B, Grade B

Creativity or Innovation: Grade B, Grade B, Grade B

Scientific Significance: Grade B, Grade B, Grade B

Open Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/

P-Reviewer: Biswas MS, PhD, Assistant Professor, Bangladesh; Wan HJ, Chief Nurse, China S-Editor: Fan M L-Editor: A P-Editor: Xu J