Published online Jul 14, 2026. doi: 10.3748/wjg.v32.i26.119398
Revised: February 22, 2026
Accepted: March 13, 2026
Published online: July 14, 2026
Processing time: 155 Days and 0.3 Hours
Multidrug resistance protein 3 (MDR3) is expressed in the capillary duct mem
To explore the pathogenicity of two newly discovered intronic variants of ABCB4.
In 2018-2021, two patients with two novel ABCB4 intronic variants were enrolled and their clinical characteristics were analyzed. The Hospital’s Ethical Review Board approved the study and informed consent was obtained. The pathogenicity of the intronic variants was predicted and analyzed in silico. Minigene analysis was performed to investigate their effects on splicing patterns, and their effects on ABCB4 messenger RNA (mRNA) expression and MDR3 expression were ex
The main clinical manifestation in both patients was cholestasis. Liver pathology analysis showed bile duct damage, inflammation, and fibrosis that differed between the patients. Three different pathogenicity prediction tools showed similar results, suggesting that these variants interfere with normal splicing. Minigene experiments demonstrated that c.537-32G>T creates a new alternative intron-splicing receptor, resulting in the retention of a 16-bp intronic sequence. The c.833+2T>C mutation created an alternative intron-splicing donor, resulting in the retention of a 67-bp intronic sequence. Neither variant greatly affected mRNA expression (P < 0.05), but MDR3 expression was downregulated by both (P < 0.05). Literature on ABCB4 intronic variants remains limited, and research into the in vitro pathogenic mechanisms of ABCB4 intron variants is especially scarce.
The c.537-32G>T and c.833+2T>C variants of ABCB4 are splicing variants, with 3’ and 5’ splicing sites, respectively. Clinical data, bioinformatic predictions, and in vitro experiments indicate that both are pathogenic.
Core Tip: This study focuses on two rare ABCB4 intronic variants identified in a clinic through gene sequencing. The clinical characteristics of the patients mainly were cholestasis. And the variants were predicted in silico tools which showed pathogenic. Through literature review, we found two intron variants have not been reported, and there is little research on intron variants. In vitro experiments confirmed that both variants lead to intron retention. These two variants have little effect on ABCB4 messenger RNA and both downregulate multidrug resistance protein 3 expression. Which can explain the clinical pathogenicity of the two cases.
- Citation: Zheng YF, Weng YH, Li SX, Yang YF. Two novel intronic variants in ABCB4: Clinical features, molecular mechanisms, and literature review. World J Gastroenterol 2026; 32(26): 119398
- URL: https://www.wjgnet.com/1007-9327/full/v32/i26/119398.htm
- DOI: https://dx.doi.org/10.3748/wjg.v32.i26.119398
ABCB4, a member of the ABC subfamily, is located on chromosome 7 (7q21) and is responsible for encoding multidrug resistance protein 3 (MDR3). MDR3 is composed of 12 transmembrane domains, six intracellular domains, six extrace
Diseases are often caused by genetic variations that affect the splicing of precursor messenger RNA (pre-mRNA). Previous studies have shown that gene variants affecting RNA splicing account for 15%-30% of pathogenic variants and exceed 50% for certain genes/exons[4]. A key step in the gene expression of eukaryotes is the precise splicing of pre-mRNA, including recognition of the junction between exons and introns and the excision of introns. Previous studies have elucidated the structure and function of ABCB4, and the pathogenic mechanisms of its mutants in different liver diseases. However, research on missense variants is the main focus. Although numerous in vitro studies on the mecha
In this study, we detected two intronic variants in patients with clinical manifestations of cholestasis and used bioinformatic software to predict their impact on gene splicing. We then elucidated their effects on splicing through minigene splice assays. Our aim was to evaluate the pathogenicity and pathogenic mechanisms of these two newly identified intron variants. This comprehensive analysis of the pathogenicity and mechanisms of ABCB4 intronic variants, integrating clinical data with in vitro experiments, will facilitate early clinical intervention and decision-making for patients with relevant variants, while also contributing to the development of therapeutics.
Among the outpatients and hospitalized patients presenting with cholestasis at the Department of Difficult Liver Diseases of The Second Hospital of Nanjing from 2018 to 2021, there were 219 patients whose etiology could not be clarified by routine physical examination, biochemistry, imaging, or liver puncture pathologic examination. Indications include diagnosing the causes of complex liver diseases, distinguishing overlapping diseases, assessing the degree of inflammation and fibrosis, etc.[10].
Next-generation sequencing detected ABCB4 variants in seven of these patients, including two patients with intronic variants. This study was approved by the Medical Ethics Committee of Nanjing Hospital Affiliated to Nanjing University of Traditional Chinese Medicine (No. 2021-LY-kt052). Informed consent was obtained from all patients prior to the study.
Genomic DNA was obtained from peripheral blood according to standard procedures, and next-generation sequencing of the target exome or whole exome was performed for all patients to explore potential genetic causes. The detected ABCB4 variant was verified by Sanger sequencing. Sequencing was conducted by KingMed Diagnostics Co. (Nanjing, Jiangsu Province, China). The sequencing-identified variants were mapped against common genomic databases (the Exome Sequencing Project, Human Gene Mutation Database, and Genome Aggregation Database) to determine whether the mutation sites were novel. Simultaneously, the National Center for Biotechnology Information and PubMed databases were searched to determine whether they were de novo variants. Three splice-variant prediction bioinformatics programs (SpliceAI[11], NNSplice and FSplice[12]) were used to assess the likelihood of the splice-site variants disrupting normal splicing and whether they could be pathogenic. The pathogenicity of the definitive variants was determined in accor
The pathogenicity of the two intronic ABCB4 variants was analyzed using a minigene assay. A partial sequence of the intron that contained the possible pathogenic variant, and the full-length sequence of the adjacent ABCB4 exons were cloned into pcDNA3.1. The constructed vectors were verified by Sanger sequencing (Supplementary Figure 1). A wild-type (WT) plasmid was used as a normal control. This analysis was performed by Wuhan BioEagle Biotechnology Co. (Wuhan, Hubei Province, China).
The WT and mutant plasmid expression vectors were transfected into HEK293T cells (Cell Bank of the Academy of Sciences, Beijing, China). The cells were harvested 48 hours after transfection and total cellular RNA was extracted using the FastPure® Cell/Tissue Total RNA Isolation Kit V2. Total RNA was then reverse transcribed to complementary RNA (cDNA) and amplified using the following primers: MDR3-F: 5’ACATGGTCCTGCTGGAGTTC’, MDR3-R: 5’GCTGATGCCCAGTTCAAAGT3’, glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-F: 5’GAAGGTGAAGGTCGGAGTCA3’, GADPH-R: 5’GACAAGCTTCCCGTTCTCAG3’. The amplified products were analyzed on 2% agarose gel and exposed under an ultraviolet (UV) gel imager. When the samples produced two target bands in the electrophoresis results, the two bands were cut under the UV lamp, and the gel was purified and recovered using the Agarose Gel Purification and Recovery Kit (PROTEINBIO, Nanjing, Jiangsu Province, China). For samples with only one band, the polymerase chain reaction (PCR) products were sent directly to Tianlin Biotechnology Co. (Nanjing, Jiangsu Province, China) for sequencing.
To explore the effects of the intronic variants on mRNA and protein levels, intronic variant expression vectors containing the complete cDNA of ABCB4 were constructed. The WT plasmids contained the coding DNA sequence region of the full segment of ABCB4. Total RNA was extracted from HEK 293T cells using quantitative real-time-PCR and reverse-transcribed for mRNA expression analysis. Relative amounts were analyzed using GAPDH (ABclonal, Wuhan, Hubei Province, China) as an internal reference. For further details, refer to the ChamQ SYBR quantitative PCR Master Mix (Vazyme, Nanjing, Jiangsu Province, China) instructions for 40 cycles.
Proteins were collected from HEK293T cells after transfection in six-well plates for 48 hours. All procedures were performed on ice. The processed protein samples were separated by 6% (w/v) sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes, which were then closed with skimmed milk. Anti-MDR3 P3II-26 antibody (Thermo, MA, United States) (1:200) was used as the primary antibody for the target protein and GAPDH (ABclonal) (1:10000) was used as the internal reference. Horseradish peroxidase goat anti-mouse immunoglobulin G (1:5000) was used as the horseradish antibody. Fluorescent color development was performed using an ultrasensitive luminescent liquid kit (Biosharp, Beijing, China) and a Fluorchem M instrument (ProteinSimple, Beijing, China).
We comprehensively reviewed the ABCB4-related literature on the PubMed and China National Knowledge Infrastruc
Categorical data are presented as n, while the continuous data prepared during the data processing for the quantitative PCR and western blot were summarized as mean ± SD. Pairwise comparisons were performed using the Student’s t-test. Descriptive analyses were conducted with SPSS 25.0 software (IBM Corp., Armonk, NY, United States), and statistical graphs were generated using GraphPad Prism version 9.0 (GraphPad Software, San Diego, CA, United States).
The patients were both adults. Their liver function indicated increases in bilirubin and transaminase levels, and diffe
| Patient | Sex | Age of disease | Clinical features | TB (max) | ALT (max) | ALP (max) | GGT (max) | Imaging findings | Gene name | Reference sequence information | Allele 1 (amino acid) | Allele 2 (amino acid) | Zygosity | Inflammation grading and fibrosis stage | Bile ducts | MDR3 IHC |
| 1 | Male | 21 | Chronic cholestasis | 29 | 159 | 346 | 1016 | Liver cirrhosis, calcification of right lobe of liver, cholecystitis, mild splenomegaly | ABCB4 | NG 007118.3 | c.2362C>T (p.R788W) | c.537-32G>T (p. ?) | Homozygote | G2-3S2 | Reduction | Normal |
| 2 | Male | 37 | Chronic cholestasis, cirrhosis, portal hypertension, and upper gastrointestinal bleeding | 21 | 51 | 386 | 219 | Liver cirrhosis, splenomegaly, portal vein enlargement, portal hypertension, cholecystitis | ABCB4 | NG 007118.3 | c.833+2T>C (p. ?) | (-) | Heterozygote | G1-3S4 | Absence | Reduction |
Both intronic variants may interfere with the splicing of ABCB4. Sequencing demonstrated that, for c.537-32G>T, an intronic sequence of 16-bp was retained on the right side of exon 6 when compared to the WT sequence (Supplementary Figure 1). For c.833+2T>C, a 67-bp intronic sequence was retained on the left side of exon 8 (Supplementary Figure 1). SpliceAI suggested two possible pathways through which both variants could affect splicing, while NNsplice and FSplice suggested that both variants may affect the location of the splice donor (Table 2). Both variants were classified as having uncertain significance, according to the American College of Medical Genetics and Genomics guidelines.
| Variants | Gene name | Reference sequence information | SNP | gnomAD | HGMD | SpliceAI | NNSplice | FSplice | ACMG | ||
| Type | Score | Pre-mRNA position | |||||||||
| c.537-32G>T | ABCB4 | NG 007118.3 | (-) | (-) | (-) | Acceptor loss | 0.18 | -32 bp | Donor loss | Donor loss | Uncertain significance (PS3 + PM2 + PM4 + PP3) |
| Acceptor gain | 0.09 | -16 bp | |||||||||
| c.833+2T>C | ABCB4 | NG 007118.3 | (-) | (-) | (-) | Donor loss | 0.99 | 2 bp | Donor loss | Donor loss | Uncertain significance (PS3 + PM2 + PM4 + PP3) |
The effects of the two intronic variants were analyzed using minigene splice assays. In the DNA electrophoresis results (excluding the mock sample) only mutation-c.833+2T>C had one band, whereas the rest of the samples had two bands (Figure 1A). To determine the desired destination bands, we performed sequence analysis using molecular biology analysis software. The upper band of WT1 showed normal splicing; the lower band showed abnormal splicing with an exon deletion. The lower band of WT2 was a normal splicing reference sequence, and the upper band showed an abnormal splicing sequence. We found that the c.537-32G>T variant resulted in the creation of a new intronic shear acceptor in front of the original intronic shear receptor site, leading to the retention of a 16-bp intronic sequence in the exon (Figure 1B). Similarly, the c.833+2T>C variant caused the original intron-shearing donor site to become inactive, followed by the activation of another intron-shearing donor site, resulting in the retention of a 67-bp intronic sequence (Figure 1C).
ABCB4 mRNA expression in the two variants was similar to that of ABCB4-WT (P < 0.05) (Figure 2), suggesting that these variants have little effect on ABCB4 mRNA content.
In vitro, we identified mature (160 kDa) and immature (140 kDa) forms of MDR3, consistent with previous findings[6,13]. The results showed that the expression levels of MDR3 in the two mutants were lower than those in the WT, with relative expression levels of 0.883 and 0.838, respectively (P < 0.05) (Figure 3).
We retrieved 102 records from the China National Knowledge Infrastructure and PubMed databases, 14 of which were associated with ABCB4 intron variants. The references comprised 14 publications, including three in Chinese[7,14,15] and 11 in English[8,9,16-24]. These included eight clinical studies, seven bioinformatics analyses, three sequencing studies, three in vitro experimental studies, and one review article (Supplementary Table 1 and Supplementary Figure 2).
Among the many previously studied clinical cohorts, missense variants in exons are the most commonly reported ABCB4 defects, whereas intron variants are rare. In this study, we detected two novel intron variants of ABCB4 in patients with unexplained liver disease and evaluated their pathogenicity.
Three different in silico analyses suggested that the two variants may affect the correct splicing of introns. We then used micro-gene splicing analysis in vitro to verify that the two variants were splicing variants that caused abnormal splicing patterns. These variants caused splice-site substitutions and retained a redundant intron sequence, which affected the mRNA and protein expression of ABCB4 to different degrees.
The patient with the c.833+2T>C variant (patient 2) showed a more severe clinical presentation, with the development of cirrhosis, portal hypertension, and upper gastrointestinal bleeding at the first visit. Liver biopsy showed dense and proliferative hepatocytes in the lobules, with a small amount of focal necrosis. The portal area was enlarged, inflammatory cells slightly increased, and fibers significantly increased, resulting in multiple bridging fibrosis. Moreover, the bile duct was missing. Immunohistochemistry revealed decreased MDR3 expression. The in vitro experiments suggest that this variant affects the splicing of ABCB4. This variant is classified as a class I intronic variant that disrupts conserved sequences at both ends of the intron (e.g., canonical GT-AG dinucleotides)[25]. Pathogenesis is caused by the inactivation of the 5’ splice site and the activation of the potential splicing initiation recognition site, resulting in the retention of a 67-bp intronic fragment that would normally be removed. Interestingly, this variant exhibited minimal impact at the mRNA level compared to the WT, suggesting that it does not induce premature mRNA degradation. Western blot analysis revealed a decrease in MDR3 protein levels, which may have resulted from an in-frame frameshift caused by the variant producing an unstable or non-functional protein. This mechanism likely contributed to the phenotype observed in patient 2. In 2020, Sticova et al[26] reported an adjacent variant site, c.833+1G>T, which existed only in the index patient and strongly suggested pathogenicity. Therefore, the destruction of highly conservative GT-AG splicing motifs (± one or two slicing junctions) is strong evidence toward being identified as a pathogenic variant. Only one variant was detected in patient 2. However, the severe clinical manifestation and decreased MDR3 expression in the liver biopsy confirmed the strong pathogenicity of classical splice site variants.
The clinical manifestation in the patient with variant c.537-32G>T (patient 1) was chronic cholestasis. Imaging did not reveal liver cirrhosis. The pathology of the liver puncture included mild-to-moderate interfacial inflammation. Fibrous hyperplasia of the liver was observed, mainly in the portal area. The bile ducts were also reduced. However, MDR3 expression was normal. Considering that this patient carried both the intronic variant c.537-32G>T and the missense variant c.2362C>T, and since our previous research as well as the 2008 study by Schneider et al[18] confirmed that c.2362C>T downregulates phosphatidylcholine translocation, we conducted an in vitro experimental analysis of c.537-32G>T. The in vitro experiments suggested that this variant affects splicing, and that its pathogenesis involves a new intron terminal splice site before the original intron splice site is activated, resulting in the retention of a 16-bp intronic sequence. This variant can be classified as a class II intronic mutation, involving the activation of a cryptic splice site within a deep intron, leading to pseudoexon inclusion. The mRNA expression level of c.537-32G>T was not significantly different from that of the WT, indicating that the variant does not introduce a premature termination codon that would trigger mRNA degradation. Western blot analysis revealed a reduction in MDR3 protein levels relative to the WT. Although the decrease was less pronounced than that caused by the 833+2T>C variant, it partially explained the phenotype observed in patient 1.
A review of the literature revealed that research on the introns of ABCB4 is limited, with most studies focusing on sequencing and clinical investigations. In vitro mechanistic studies are also scarce. Two in vitro studies have reported mutations leading to frameshift deletions. Schneider et al[18] reported that the intronic variant c.3486+5G>A activates a cryptic splice site, resulting in an in-frame deletion of 54 bp (3465-3518). A Chinese study indicated that the c.2065-8T>G variant induces intron retention[14]. The patients described in that report presented with clinical phenotypes consistent with pathogenic effects. These reported cases share similarities with our observations, likely due to frameshift alterations that compromise functional MDR3 expression.
Currently, research on the treatment of patients with ABCB4 intronic variants is limited. Considering that these mutations may cause substantial frameshift alterations, the clinical manifestations and prognosis of carriers are highly heterogeneous and ultimately dependent on the pathogenic mechanisms of the individual mutation sites. Some studies have reported the effectiveness of ursodeoxycholic acid therapy[14], while others have reported poor therapeutic responses[7]. These patients may eventually require artificial liver support or liver transplantation for end-stage disease. Research on molecular therapies targeting ABCB4 also remains limited. In 2019, Song et al[27] found that miRNA-378a-5p negatively regulates MDR3 expression at both the mRNA and protein levels, which may represent a potential therapeutic strategy for a subset of patients. Other therapeutic approaches for intronic mutations exist, including splice-switching antisense oligonucleotides, small-molecule splicing modulators, RNA editing, and gene therapy approaches[28], although they have not yet been applied to ABCB4. These modalities show potential for future research into the treatment of ABCB4 intronic variants.
However, the sample size of the current study was small, limiting our ability to reach statistically significant conclusions to some extent. In addition, owing to economic limitations and subjective patient factors, this study failed to improve on the pedigree investigation of the probands. Functional experiments to further explore the effects of these two variants on the activity and stability of the MDR3 protein are warranted.
We identified two new ABCB4 intron variants and analyzed their pathogenicity in vitro. Both variants resulted in the retention of an intronic sequence within the reading frame, thereby impairing MDR3 expression. After excluding other cholestatic liver diseases, gene detection can be used in patients with jaundice accompanied by itching and whose liver function suggests elevated levels of conjugated bilirubin, transaminase, and alkaline phosphatase, especially in those with a family history of cholestasis. This could determine whether the patient has a related disease caused by gene variants. Novel variants that may affect splicing, especially intronic variants, can be analyzed using splice-site prediction tools. Different ABCB4 variants have different pathogenicity. Pathogenicity can be further verified, and the pathogenic me
We would like to express our gratitude to all the patients and researchers who participated in this study and to the biostatistician for their rigorous review.
| 1. | Ben Saad A, Bruneau A, Mareux E, Lapalus M, Delaunay JL, Gonzales E, Jacquemin E, Aït-Slimane T, Falguières T. Molecular Regulation of Canalicular ABC Transporters. Int J Mol Sci. 2021;22:2113. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 8] [Cited by in RCA: 25] [Article Influence: 5.0] [Reference Citation Analysis (0)] |
| 2. | Gadour E, Miutescu B, Alqahtani MS, Vuletici D, Elsayed G, Domilescu I, Facciorusso A. Diagnostic challenges in progressive familial intrahepatic cholestasis type 3 (PFIC3) misdiagnosed as Wilson's disease: A systematic review. Adv Clin Exp Med. 2026. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 1] [Reference Citation Analysis (0)] |
| 3. | Al-Hussaini A, Lone K, Bashir MS, Alrashidi S, Fagih M, Alanazi A, AlYaseen S, Almayouf A, Alruwaithi M, Asery A. ATP8B1, ABCB11, and ABCB4 Genes Defects: Novel Mutations Associated with Cholestasis with Different Phenotypes and Outcomes. J Pediatr. 2021;236:113-123.e2. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 20] [Cited by in RCA: 18] [Article Influence: 3.6] [Reference Citation Analysis (1)] |
| 4. | Padgett RA. New connections between splicing and human disease. Trends Genet. 2012;28:147-154. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 127] [Cited by in RCA: 137] [Article Influence: 9.8] [Reference Citation Analysis (0)] |
| 5. | Madry C, Elbahnsi A, Delaunay JL, Stary A, Lagaye S, Couvert P, Corpechot C, Lemoinne S, Chignard N, Boucherle B, Gautheron J, Décout JL, Callebaut I, Aït-Slimane T. ABCB4 disease-causing variants S242R, S346I, T437I and T1077M significantly impair its function and display differential sensitivity to potentiators. Sci Rep. 2025;15:44544. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 3] [Reference Citation Analysis (0)] |
| 6. | Delaunay JL, Elbahnsi A, Bruneau A, Madry C, Durand-Schneider AM, Stary A, Housset C, Gautheron J, Callebaut I, Aït-Slimane T. Ivacaftor-Mediated Potentiation of ABCB4 Missense Mutations Affecting Critical Motifs of the NBDs: Repositioning Perspectives for Hepatobiliary Diseases. Int J Mol Sci. 2023;24:1236. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 9] [Cited by in RCA: 10] [Article Influence: 3.3] [Reference Citation Analysis (0)] |
| 7. | Cao LL, Yan JG, Feng DN, Dong Y, Xu ZQ, Wang FC, Gao YJ, Zhu SS, Zhang M. [Analysis of clinical characteristic of children with progressive familial intrahepatic cholestasis type 3]. Zhonghua Er Ke Za Zhi. 2024;62:462-466. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 1] [Reference Citation Analysis (0)] |
| 8. | Wang S, Liu Q, Sun X, Wei W, Ding L, Zhao X. Identification of novel ABCB4 variants and genotype-phenotype correlation in progressive familial intrahepatic cholestasis type 3. Sci Rep. 2024;14:27381. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 3] [Cited by in RCA: 4] [Article Influence: 2.0] [Reference Citation Analysis (0)] |
| 9. | Weber SN, Lambert I, Lammert F, Krawczyk M. A family with gallstone disease: defining inherited risk in the era of clinical genetic testing. Intern Emerg Med. 2025;20:509-514. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 3] [Reference Citation Analysis (0)] |
| 10. | Johnson KD, Laoveeravat P, Yee EU, Perisetti A, Thandassery RB, Tharian B. Endoscopic ultrasound guided liver biopsy: Recent evidence. World J Gastrointest Endosc. 2020;12:83-97. [PubMed] [DOI] [Full Text] |
| 11. | Ha C, Kim JW, Jang JH. Performance Evaluation of SpliceAI for the Prediction of Splicing of NF1 Variants. Genes (Basel). 2021;12:1308. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 16] [Cited by in RCA: 35] [Article Influence: 7.0] [Reference Citation Analysis (0)] |
| 12. | Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, Grody WW, Hegde M, Lyon E, Spector E, Voelkerding K, Rehm HL; ACMG Laboratory Quality Assurance Committee. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17:405-424. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 27361] [Cited by in RCA: 25717] [Article Influence: 2337.9] [Reference Citation Analysis (12)] |
| 13. | Delaunay JL, Durand-Schneider AM, Dossier C, Falguières T, Gautherot J, Davit-Spraul A, Aït-Slimane T, Housset C, Jacquemin E, Maurice M. A functional classification of ABCB4 variations causing progressive familial intrahepatic cholestasis type 3. Hepatology. 2016;63:1620-1631. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 98] [Cited by in RCA: 83] [Article Influence: 8.3] [Reference Citation Analysis (3)] |
| 14. | Ye XL, Yu FH, Zhou J, Zhao CN, Wu J. [Clinical phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 3 caused by novel ABCB4 gene mutation]. Zhonghua Er Ke Za Zhi. 2024;62:649-654. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 3] [Reference Citation Analysis (0)] |
| 15. | Cao LL, Dong Y, Xu ZQ, Wang FC, Gao YJ, Yan JG, Feng DN, Zhang M. [Clinical characteristics of ABCB4 gene variant-associated cholestatic liver disease in adults]. Zhonghua Gan Zang Bing Za Zhi. 2024;32:929-934. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in RCA: 1] [Reference Citation Analysis (0)] |
| 16. | Jiao J, Morotti R, Shafizadeh N, Jain D. Expanding the spectrum of progressive familial intrahepatic cholestasis: A report of 3 cases. Am J Clin Pathol. 2025;163:332-339. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1] [Cited by in RCA: 1] [Article Influence: 1.0] [Reference Citation Analysis (0)] |
| 17. | Pauli-Magnus C, Lang T, Meier Y, Zodan-Marin T, Jung D, Breymann C, Zimmermann R, Kenngott S, Beuers U, Reichel C, Kerb R, Penger A, Meier PJ, Kullak-Ublick GA. Sequence analysis of bile salt export pump (ABCB11) and multidrug resistance p-glycoprotein 3 (ABCB4, MDR3) in patients with intrahepatic cholestasis of pregnancy. Pharmacogenetics. 2004;14:91-102. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 228] [Cited by in RCA: 186] [Article Influence: 8.5] [Reference Citation Analysis (1)] |
| 18. | Schneider G, Paus TC, Kullak-Ublick GA, Meier PJ, Wienker TF, Lang T, van de Vondel P, Sauerbruch T, Reichel C. Linkage between a new splicing site mutation in the MDR3 alias ABCB4 gene and intrahepatic cholestasis of pregnancy. Hepatology. 2007;45:150-158. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 72] [Cited by in RCA: 56] [Article Influence: 2.9] [Reference Citation Analysis (0)] |
| 19. | Saito S, Iida A, Sekine A, Miura Y, Ogawa C, Kawauchi S, Higuchi S, Nakamura Y. Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population. J Hum Genet. 2002;47:38-50. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 66] [Cited by in RCA: 60] [Article Influence: 2.5] [Reference Citation Analysis (0)] |
| 20. | Khabou B, Siala-Sahnoun O, Gargouri L, Mkaouar-Rebai E, Keskes L, Hachicha M, Fakhfakh F. In silico investigation of the impact of synonymous variants in ABCB4 gene on mRNA stability/structure, splicing accuracy and codon usage: Potential contribution to PFIC3 disease. Comput Biol Chem. 2016;65:103-109. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 5] [Cited by in RCA: 8] [Article Influence: 0.8] [Reference Citation Analysis (0)] |
| 21. | Hegarty R, Gurra O, Tarawally J, Allouni S, Rahman O, Strautnieks S, Kyrana E, Hadzic N, Thompson RJ, Grammatikopoulos T. Clinical outcomes of ABCB4 heterozygosity in infants and children with cholestatic liver disease. J Pediatr Gastroenterol Nutr. 2024;78:339-349. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 1] [Cited by in RCA: 8] [Article Influence: 4.0] [Reference Citation Analysis (0)] |
| 22. | Mbongo-Kama E, Harnois F, Mennecier D, Leclercq E, Burnat P, Ceppa F. MDR3 mutations associated with intrahepatic and gallbladder cholesterol cholelithiasis: an update. Ann Hepatol. 2007;6:143-149. [PubMed] |
| 23. | Belbin GM, Rutledge S, Dodatko T, Cullina S, Turchin MC, Kohli S, Torre D, Yee MC, Gignoux CR, Abul-Husn NS, Houten SM, Kenny EE. Leveraging health systems data to characterize a large effect variant conferring risk for liver disease in Puerto Ricans. Am J Hum Genet. 2021;108:2099-2111. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 4] [Cited by in RCA: 11] [Article Influence: 2.2] [Reference Citation Analysis (0)] |
| 24. | Gudbjartsson DF, Helgason H, Gudjonsson SA, Zink F, Oddson A, Gylfason A, Besenbacher S, Magnusson G, Halldorsson BV, Hjartarson E, Sigurdsson GT, Stacey SN, Frigge ML, Holm H, Saemundsdottir J, Helgadottir HT, Johannsdottir H, Sigfusson G, Thorgeirsson G, Sverrisson JT, Gretarsdottir S, Walters GB, Rafnar T, Thjodleifsson B, Bjornsson ES, Olafsson S, Thorarinsdottir H, Steingrimsdottir T, Gudmundsdottir TS, Theodors A, Jonasson JG, Sigurdsson A, Bjornsdottir G, Jonsson JJ, Thorarensen O, Ludvigsson P, Gudbjartsson H, Eyjolfsson GI, Sigurdardottir O, Olafsson I, Arnar DO, Magnusson OT, Kong A, Masson G, Thorsteinsdottir U, Helgason A, Sulem P, Stefansson K. Large-scale whole-genome sequencing of the Icelandic population. Nat Genet. 2015;47:435-444. [RCA] [PubMed] [DOI] [Full Text] [Cited by in Crossref: 544] [Cited by in RCA: 580] [Article Influence: 52.7] [Reference Citation Analysis (4)] |
| 25. | Anna A, Monika G. Splicing mutations in human genetic disorders: examples, detection, and confirmation. J Appl Genet. 2018;59:253-268. [RCA] [PubMed] [DOI] [Full Text] [Full Text (PDF)] [Cited by in Crossref: 274] [Cited by in RCA: 483] [Article Influence: 60.4] [Reference Citation Analysis (0)] |
| 26. | Sticova E, Neroldova M, Kotalova R, Subhanova I, Jirsa M. ABCB4 disease mimicking morbus Wilson: A potential diagnostic pitfall. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2020;164:121-125. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 4] [Reference Citation Analysis (0)] |
| 27. | Song CW, Qiu W, Zhou XQ, Feng XC, Chen WS. Elevated hepatic MDR3/ABCB4 is directly mediated by MiR-378a-5p in human obstructive cholestasis. Eur Rev Med Pharmacol Sci. 2019;23:2539-2547. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 4] [Reference Citation Analysis (0)] |
| 28. | Awaya T, Kurosawa R, Hagiwara M. Genome-wide functional annotation and interpretation of splicing variants: toward RNA-targeted therapies. J Hum Genet. 2025. [RCA] [PubMed] [DOI] [Full Text] [Cited by in RCA: 2] [Reference Citation Analysis (0)] |